11989 results for "cancer rna-seq"

in 28.64 milliseconds.

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Proteogenomic Landscape of Squamous Cell Lung Cancer

  To provide a detailed analysis on how genomic and transcriptomic alterations related to proteome level changes in squamous cell lung cancer (SCC), we performed an integrated analysis incorporating DNA copy number, somatic mutations, expression RNA-sequencing, and expression proteomics in 108 SCC nested within clinical outcome, tumor pathology, and other clinically relevant data.

  Study phs001781

• DAC for study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer."

  This is Data Access Committee will oversee data sharing for sequence data in the EGA study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer." This dataset includes 116 bam files from whole exome sequencing on the Illumina HiSeq2500, 102 fastq files from RNA sequencing on the Illumina NovaSeq 6000. The samples analyzed include tumor/normal DNA samples and tumor RNA samples from 72 individuals with non-small cell lung cancer treated with pembrolizumab and SBRT or pembrolizumab alone on the NCT02492568 trial.

  Dac EGAC50000000202

• Integrated Somatic and Germline Molecular Properties Dictating Biological and Clinical Phenotypes in Cancer

  We performed single-nuclei matched RNA- and ATAC-sequencing of frozen biopsies from normal adjacent tissue, primary and metastatic esophageal adenocarcinoma specimens. The data was then further stratified into a tumor microenvironment and malignant compartment and was computationally analyzed to reveal cancer cell subtypes and programs driving malignancy.

  Study phs003438

• RNA of peripheral blood for pancreatic cancer and chronic pancreatitis

  Samples of nucleated cells found in peripheral blood from over 300 patients suffering from resectable pancreatic ductal adenocarcinoma, non-resectable pancreatic cancer, chronic pancreatitis, or none of these. Please cite this article when using data: Al-Fatlawi, A.; Malekian, N.; García, S.; Henschel, A.; Kim, I.; Dahl, A.; Jahnke, B.; Bailey, P.; Bolz, S.N.; Poetsch, A.R.; Mahler, S.; Grützmann, R.; Pilarsky, C.; Schroeder, M. Deep Learning Improves Pancreatic Cancer Diagnosis Using RNA-Based Variants. Cancers 2021, 13, 2654. https://doi.org/10.3390/cancers13112654

  Dataset EGAD00001006915

• Triple Negative Breast Cancer RNA Sequencing

  We propose to definitively characterise the somatic genetics of triple negative breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000390

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Dac EGAC00001000741

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• RNA-seq on patient-derived, stage II, CRC cell lines

  The gut microbiome is a key player in the immunomodulatory and pro-tumorigenic microenvironment in colorectal cancer (CRC). It is well established that Fusobacterium’s virulence factors are responsible for its pro-tumorigenic properties, however the role of its metabolic cross-talk with the tumor remains unexplored. Here we use in vitro, in vivo, and in silico methods to describe a novel microbe-host interaction keystone: formate. Omics data reveals molecular signatures, linking a metabolically driven CRC phenotype with Fusobacteria. We observed a metabolic shift towards increased F. nucleatum formate secretion in gut-on-chip model co-cultures with patient-derived CRC cells, along with an accelerated cancer glutamine metabolism. We show that high formate levels trigger AhR signaling, increase cancer stemness and cellular invasion. Finally, we observed an expansion of Th17 cells accompanying F. nucleatum-induced tumorigenesis. Moving beyond observational studies, we applied new experimental approaches for gaining ecosystem-level mechanistic understanding of F. nucleatum’s role in cancer pathogenesis.

  Study EGAS00001005948

• ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001231

• Fastq data for ChIP-Seq (H3K27ac) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27ac) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001403

• ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001233

• Fastq data for ChIP-Seq (Input) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (Input) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001409

• ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001232

• ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001234

• ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001229

• Fastq data for ChIP-Seq (H3K4me1) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me1) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001406

• ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001230

• Fastq data for ChIP-Seq (H3K27me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001404

• Fastq data for ChIP-Seq (H3K9me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K9me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001408

• Fastq data for ChIP-Seq (H3K36me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K36me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001405

• Fastq data for ChIP-Seq (H3K4me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001407

• March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies (Canadian Epigenetics, Environment and Health Research Consortium), Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001959

• RNA-Sequencing data of Fusobacterium nucleatum treated CAFs and HT-29 tumor spheroid exposed to Fusobacterium nucleatum treated CAFs conditioned medium.

  RNA-Sequencing data of CAFs (patient derived CAF180 and CAF181 as well as the CT5.3 CAF cell line) and HT-29 tumor spheroid samples performed in the context of the study of the interaction of Fusobacterium nucleatum with CRC CAFs. Fusobacterium nucleatum interacts with cancer-associated fibroblasts to enhance colorectal cancer progression

  Dataset EGAD50000001614

• Transcriptomic dataset from a phase II study of pembrolizumab and epigenetic modification with azacitidine in platinum-resistant epithelial ovarian cancer

  This dataset includes sequence files from bulk RNA sequencing of tissue biospecimens from a phase II study investigating epigenetic priming followed by immune checkpoint blockade in platinum-resistant epithelial ovarian cancer (NCT02900560). There are 48 bulk RNA sequencing files from 24 specimens included in this dataset.

  Dataset EGAD50000001664

• NeoRhea Bulk RNA and Single nuclei RNA & ATAC

  The aim of this study is to compare baseline and surgery samples of ER+/HER2- early breast cancer patients. Patients have been treated with endocrine therapy in combination with palbociclib. Samples have been collected pre and post treatment.

  Study EGAS50000001403

• Single-cell profiling maps the spectrum of crosstalk between glioma cells and tumor associated macrophages

  Tumor associated macrophages (TAMs) are a heterogeneous glioma infiltrate, implicated in cancer progression. We performed single-cell RNA-sequencing, to survey TAM response-patterns in glioma.

  Study EGAS00001002185

• Illumina single-cell RNA sequencing of omentum biopsies of ovarian cancer patients

  Illumina Novaseq paired-end single-cell RNA sequencing samples prepared using 10X Genomics platform. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 HGSOC metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 paired fastq files per sample.

  Dataset EGAD00001009815

• Transcriptomic analysis of the NA-PHER2 clinical trial

  We performed whole transcriptome RNA sequencing on serial tumour biopsies collected at baseline, Day 14, and after completion of all neoadjuvant therapy from the NA-PHER2 trial. Patients received neoadjuvant treatment with the combined regimen of trastuzumab, pertuzumab, palbociclib with or without addition of fulvestrant. Transcriptomic profiles were generated from 143 samples (Baseline n = 53, Day 14 n = 49, Surgery n = 41) corresponding to 53 of the 58 patients enrolled in NA-PHER2 trial (91.4%). RNA sequencing was performed on total RNA samples derived from formalin-fixed, paraffin-embedded (FFPE) tissue sections. RNA-Seq libraries were produced using NEBNext® Ultra™ II Directional RNA Library Prep Kit. The capture was then performed on cDNA libraries with the Twist Human Core Exome Enrichment System according to supplier recommendations (Twist Bioscience). The obtained eluted-enriched DNA samples was then sequenced on an Illumina NovaSeq as paired-end 100bp reads. FASTQ files are provided.

  Dataset EGAD50000000363

• The Landscape of Antisense Gene Expression in Human Cancers

  High throughput RNA Sequencing has revealed that the human genome is widely transcribed. However, the extent of natural antisense transcription, the molecular mechanisms by which natural antisense transcripts (NATs) might affect their cognate sense genes, and the role of NATs in cancer are less well understood. Here, we use strand-specific paired-end RNA sequencing (ssRNASeq) on a cohort of 376 cancer patients covering 9 tissue types to comprehensively characterize the landscape of antisense expression. Our results reveal that greater than 60% of annotated transcripts have measureable antisense expression and the expression of sense and antisense transcript pairs is in general positively correlated. Furthermore, by studying the expression of sense/antisense pairs across tissues we identify lineage-specific, ubiquitous and cancer-specific antisense loci. Our results raise the possibility that NATs participate in the regulation of well-known tumor suppressors and oncogenes. Finally, this study provides a catalogue of cancer related genes with significant antisense transcription (oncoNAT). This resource will allow researchers to investigate the molecular mechanisms of sense/antisense regulation and further advance our understanding of their role in cancer.

  Study phs000937

• Djerroudi et al., E-cadherin inactivation shapes tumor microenvironment specificities in invasive lobular carcinoma

  Invasive lobular breast carcinoma (ILC) shows specific stromal features, T lymphocyte infiltration (TIL) being associated with poor prognosis. Here, we reveal the involved mechanism by performing single cell RNA sequencing, combined immunohistochemistry, deconvolution of bulk RNA sequencing from large retrospective ILC series, and functional assays using primary cells. We show that ILC accumulate FAP+ inflammatory cancer-associated fibroblasts (iCAF) through a previously undescribed mechanism mediated by E-cadherin/CDH1 on CAF plasticity. Indeed, CDH1 inactivation in ILC cancer cells prevents differentiation of iCAF into myofibroblastic CAF (myCAF), leading to iCAF accumulation. In turn, iCAF increase TIL infiltration and shape their spatial organization in ILC. Subsequently, CDH1-inactivated ILC cancer cells promote immune escape by lack of retention and activation of ITGAE-expressing resident memory CD8+ T lymphocytes (TRM). Hence, our study uncovers reciprocal interactions between CDH1-inactivated cancer cells, iCAF and CD8+ TRM, revealing why and how TILs have a poor prognosis in ILC patients, a mechanism extrapolated to other CDH1-mutated cancer types.

  Study EGAS50000000761

• RNA sequencing on colonic biopsies from inflammatory bowel disease patients treated with vehicle control, MEK inhibitor, or infliximab

  This dataset consists of RNA sequencing data (FASTQs) from intestinal mucosal biopsies from 9 IBD patients. All patients endoscopically active disease and were not receiving immunosuppressive or biologic therapies. All biopsies (6 per donor) were collected from a single inflamed site. Biopsies were cultured for 18 hours at an air-liquid interface in media containing either DMSO (vehicle control), PD-0325901 (0.5uM) or infliximab (10ug/ml; MSD) - two biopsies per condition. Sequencing was performed on a NovaSeq 6000 (100bp, PE reads). After 18 hours, biopsies were harvested and snap frozen. After lysis, RNA was extracted using an AllPrep DNA/RNA Mini Kit (Qiagen). Sequencing libraries were prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions. The quality and molarity of all libraries was assessed using a BioAnalyzer 2100 and the libraries were sequenced on a NovaSeq 6000 (100bp, PE reads).

  Dataset EGAD00001011333

• Cell Type-Specific and Disease-Associated eQTL in the Human Lung

  This study was conducted to investigate the genetic control of gene expression in a cell-type and context-specific manner in the human lung. We performed single-cell RNA-sequencing (scRNA-seq) of lung tissue from 66 Interstitial Lung Disease (ILD) cases and 48 unaffected donors. Employing a pseudo-bulk approach, we mapped expression quantitative trait loci (eQTL) across 38 cell types. The scRNA-seq data presented here include previously published (PMID 34262047) and unpublished samples. ILD tissue samples were obtained from lungs removed at the time of lung transplantation at either Vanderbilt University Medical Center (VUMC) or the Norton Thoracic Institute (NTI). Control tissue samples were obtained from lungs declined for organ donation either at the Donor Network of Arizona (DNA) or VUMC. The self-reported ethnicities of donors were 66.7% European, 9.6% African American, 17.5% not available (N/A), and 6.1% other. The smoking history includes 46.5% ever smoker, 29.8% never smoker, 23.7% N/A. For genotyping, flash-frozen tissue in DNA/RNA shield was homogenized via a bullet blender. Genomic DNA was extracted using Zymo Quick DNA/RNA microprep plus kit. Library preparation and low-pass Whole Genome Sequencing (WGS) were carried out at TGen or by Gencove Inc. At TGen, libraries were prepared using PCR-free Watchmaker kits (Watchmaker Genomics) with 200 ng input. Genomes were sequenced on NovaSeq at low coverage (typically 0.4–1x). The resulting sequence data were processed and imputed using Gencove's imputation platform.

  Study phs003521

• Risk Factors for Asymptomatic Diverticulosis

  Data for this analysis came from a prospective study of colonic diverticulosis at the University of North Carolina Hospital in Chapel Hill, North Carolina (NIH R01DK094738). This is a case-control genetic and transcriptomic study to identify the genetic and cellular determinants underlying colonic diverticulosis and the relationship with other gastrointestinal disorders. The study inclusion and exclusion are described below. DNA and RNA sequencing were performed on colonic tissue from 404 patients with (N=172) and without (N=232) diverticulosis. We assessed variation in the transcriptome associated with diverticulosis and integrated this variation with human intestine single-cell RNA-seq data. We integrated our expression quantitative trait loci with GWAS using Mendelian Randomization. A polygenic risk score analysis examined associations between severity of diverticulosis and other gastrointestinal disorders. We identified 38 genes with differential expression and 17 genes with varied transcript usage linked to diverticulosis. Our results suggest tissue remodeling as a primary mechanism for diverticula formation. The presence of diverticulosis was linked to stromal and epithelial cells in the colon including endothelial cells, myofibroblasts, fibroblasts, goblet, tuft, enterocytes, neurons, and glia. MR highlighted five genes including CCN3, CRISPLD2, ENTPD7, PHGR1, and TNFSF13. In diverticulosis cases, ENTPD7 upregulation was confirmed. A greater burden of diverticula was positively correlated with genetic predisposition to diverticulitis. The data related to the study including total RNA-Seq, SNP array and imputed genotypes will be available through dbGaP.

  Study phs003556

• Space Associated Stem Cell Hallmarks of Aging in Astronauts

  This study examined the effects of the stress of space, specifically low earth orbit, on hematopoietic stem and progenitor cells (HSPCs) that maintain lifelong hematopoiesis and immune responses. Enriched CD34+ HSPCs were derived from 7 astronauts before, during and after 10 and 21-day ISS missions on the International Space Station. The samples were used as input to whole transcriptome sequencing by bulk RNA-Seq performed at The Scripps Research Institute Next Generation Sequencing Core on Illumina NextSeq 2000 sequencer and single cell RNA-Seq performed at The Salk Institute for Biological Studies on Illumina NovaSeq X Plus sequencer. Subsequent expression, RNA editing, and retrotransposon analyses were performed to assess HSPC and immune subpopulation survival dynamics. Overall, these analyses revealed space-associated stem cell hallmarks of aging (SASHA), including spaceflight dependent alterations in HSPC survival and self-renewal, ADAR1, telomere maintenance, mobilization and cell cycle gene expression, combined with space-induced clonal hematopoietic mutations, APOBEC3C activation and retrotransposon deregulation to warrant countermeasure development to enable long-duration spaceflight. Post-spaceflight analysis revealed increased C-to-T and clonal hematopoiesis-associated mutations, repetitive element and base deaminase deregulation, decreased telomere maintenance gene expression, and decreased self-renewal capacity compared to ground controls. These results demonstrate the space-associated aging effects in HSPCs after month-long exposure to LEO, providing insights into utilizing the LEO environment to model space-accelerated aging and other age-related malignancies.

  Study phs004267

• T-ALL RNA-Seq raw data files

  Bone marrow or peripheral blood samples were collected of adult patients at first diagnosis of T-precursor acute lymphoblastic leukemia. RNA was isolated from mononuclear cells and subjected to mRNA library prep using Poly-A selection and sequencing on a NovaSeq 6000 system. Obtained gene expression profiles and gene fusion calls were used to allocate samples to molecular disease subtypes.

  Study EGAS50000000213

• Paired-end RNA-Seq Dataset of 72 Brain Organoid Samples: Sequencing and Gene Expression Analysis

  72 fastq sequencing files of 72 brain-organoid paired-end sequenced samples (R1/R2). RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina following the manufacturer’s instructions (New England Biolabs, USA). mRNAs were first enriched with Oligo(dT) beads. The samples were sequenced using a 2x150 Pair-End configuration (ver. 1.5) on an Illumina NovaSeq 6000 The raw sequence reads were aligned to the human reference genome GRCh38 using the STAR aligner (Dobin et al., 2013). Gene expression levels were quantified using the FeatureCounts tool (Liao et al., 2014) (file: "All_Counts_final.xlsx") For more information, see "Study Description"

  Dataset EGAD50000000935

• Comparison between b2m KO and US2 expressing iPSC lines

  This dataset contains bulk RNA-seq transcriptomic profiles from a human induced pluripotent stem cell (hiPSC) line and three engineered derivatives: B2M knockout, EGFP overexpression, and US2 overexpression, alongside the parental line. Total RNA integrity was assessed using the Experion RNA StdSens 1K Analysis Kit on the Bio-Rad Experion Automated Electrophoresis System prior to library preparation and sequencing. Libraries were sequenced on an Illumina NovaSeq 6000 generating ~20 million reads per sample. Raw read quality was assessed with FastQC, reads were aligned to the human reference genome hg38 (Ensembl release 109) using STAR, and alignment/library QC metrics (e.g., orientation, composition, coverage) were evaluated with Picard.

  Dataset EGAD50000002321

• RNAseq samples of patients with anti-PD-1 resistant HNSCC from a non-randomized, open-label phase 1b clinical trial

  Immune checkpoint blockade (ICB) is an effective treatment for a subset of patients with head and neck squamous cell carcinoma (HNSCC); however, the majority remain refractory. In a nonrandomized, open-label Phase 1b clinical trial, participants with recurrent and/or metastatic (R/M) HNSCC who had progressed on ICB were treated with low-dose 5-azacytidine (5-aza) daily for either 5 or 10 days, in combination with durvalumab and tremelimumab. The primary objective was to determine the biologically effective dose of 5-aza. In this study, RNA sequencing (RNA-seq) was performed on baseline and on-treatment samples from eight participants, and transcriptomic changes were analyzed to assess the impact of low-dose 5-aza treatment.

  Study EGAS50000000728

• PCa-LINES

  PCa-LINES: Ribo-minus RNA-seq of 4 patient samples and 2 PCa cell lines ---- Detection of fusion transcripts and their genomic breakpoints from RNA sequencing data Youri Hoogstrate, Malgorzata A. Komor, René Böttcher, Job van Riet, Harmen J. G. van de Werken, Stef van Lieshout, Ralf Hoffmann, Evert van den Broek, Anne S. Bolijn, Natasja Dits, Daoud Sie, David van der Meer, Floor Pepers, Chris H. Bangma, Geert J. L. H. van Leenders, Marcel Smid, Pim French, John W.M. Martens, Wilbert van Workum, Peter J. van der Spek, Bart Janssen, Eric Caldenhoven, Christian Rausch, Mark de Jong, Andrew P. Stubbs, Gerrit A. Meijer, Remond J.A. Fijneman, Guido Jenster bioRxiv 2021.05.17.441778; doi: https://doi.org/10.1101/2021.05.17.441778 https://www.biorxiv.org/content/10.1101/2021.05.17.441778v1

  Study EGAS00001004613

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• Single cell RNA sequencing of 33 primary colorectal cancer

  Study EGAS00001003779

• The evolutionary dynamics of human colorectal cancer using single-gland spatial multi-omic profiling of DNA, RNA and chromatin.

  Deciphering the mechanisms of colorectal cancer growth, progression and dissemination in each individual patient.

  Study EGAS00001005230

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• RNA-seq of human iPSC-derived neurons to explore cellular phenotypes associated with schizophrenia.

  This dataset contains high-throughput RNA-sequencing of 12 samples, each sample comprising neural precursor cells derived from human induced pluripotent stem cells from individuals with and without the 16p13.11 microduplication (a copy number variant associated with a range of neurodevelopmental disorders). 4 samples derive from patients carrying the 16p13.11 microduplication, and 8 derive from unaffected family controls. RNA samples were processed to deplete rRNA using the TruSeq Stranded Total RNA with Ribo-Gold kit. Libraries were then sequenced using the NextSeq 500/550 High-Output v2 Kit on the Illumina NextSeq 550 platform, to produce 75 base pair paired-end sequencing reads at an average depth of around 100 million reads per sample. Raw sequencing reads data are stored in two FASTQ files per sample for these paired-end reads.

  Dataset EGAD00001004064

• RoCK and ROI single-cell transcriptome of one acute lymphoblastic leukemia patient

  Whole-transcriptome single-cell RNA sequencing (scRNA-seq) was performed following the manufacturer’s protocol (BD Rhapsody, BD Biosciences). Targeted enrichment of BCR::ABL1 transcripts was conducted using the RoCK and ROI-seq approach, based on the barcoded bead technology of the BD Rhapsody platform. In the RoCK and ROI-seq workflow, the template-switch oligonucleotides (TSOs) attached to BD Rhapsody beads were modified with one or multiple capture sequences specific to transcripts of interest, enabling targeted transcript capture during reverse transcription. ROI primers that are added during library preparation to direct amplification and sequencing toward these defined regions of interest (ROIs). Resulting libraries were sequenced on an Illumina sequencer.

  Dataset EGAD50000001976

• Whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing data from nasal cells of COVID-19 patients

  Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dataset EGAD50000000398

• Sequencing data of the ampulla and fimbriae of the fallopian tube in pre-menopausal women

  A total of 10 pre-menopausal patients were recruited for this study. Sequencing of both the fimbriae and ampullary region of the fallopian tubes was performed using 10x Genomics single-cell RNA-seq and ATAC-seq. For one patient, data were sequenced across 4 lanes, while the remaining patients' data were sequenced in 2 lanes each, resulting in a total of 44 sequencing datasets for each platform.

  Dataset EGAD50000000889

• RIP-SeqRaw data

  This dataset contains 15 paired FASTQ files from the PTBP1 project. Sequencing data were generated using bulk directional RNA-seq and RIP-seq experiments performed on a NovaSeq 6000 platform (2×100 bp paired-end reads). The dataset comprises two groups of samples: controls and patients. For each group, both input and immunoprecipitated samples are available. Patient samples correspond to skin biopsies from individuals affected by a neurodevelopmental disorder associated with variable skeletal dysplasia and disproportionate short-limbed short stature.

  Dataset EGAD50000001723

• Bell_activation_timecourse

  We purified human naive and memory B cells from PBMCs. We stimulated them with IgM cross-linker providing BCR stimulation, multimeric CD40L that engages costimulatory receptor CD40 on the B cell, and cytokines IL-2 and IL-21. To comprehensively characterise activation dynamics of naive and memory B cells, we performed single-cell RNA sequencing (scRNA-seq) and B cell receptor sequencing (BCR-seq) in resting cells (day 0), before the first division (day 1), at the time of the first division (day 3) and following the full B cell differentiation (day 6)

  Dataset EGAD50000002115

• scRNA-seq of a 3D human cortical tissue model from human iPSCs exploring 2D versus 3D co-culturing

  Single-cell RNA-seq analysis of human iPSC-derived microglia/astrocytes/neurons in a novel, human in vitro 3D cortical tissue model, as well as 2D co-cultures for comparison. Samples include distinct conditions as described in the Study section. The dataset was generated using the BD Rhapsody technology and sequenced paired-end with Illumina NovaSeq2000. Information on the multiplexing of samples is reported in the Analyses section.

  Dataset EGAD50000002021

• mRNA-Seq on single human MII oocytes collected from gonadotropin stimulated women

  This dataset contains 11 paired-end FASTQ sequences from mRNA-Seq on single human M-II stage oocytes that were collected from gonadotropin stimulated women undergoing fertility treatments. M-II stage oocytes were collected and flash frozen prior to lysis followed by RNA extraction, full length cDNA preparation and amplification using the Ultra-low-input SMART-Seq2 v4 kit from Takara Clonetech. Further, these cDNA were used to prepare libraries for sequencing according the Nextera XT DNA library preparation kit from Illumina.

  Dataset EGAD00001006863

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Modulation of Lung Immune Responses to Viral Infection-Microbiome Interactions with Respiratory Organoids

  Here, we colonized bronchial epithelial air-liquid interface tissue cultures with 58 different individual microbes. Following 18 and 48 hours of colonization, we performed bulk RNA-seq of the host epithelial cells (n=3). Overall, we found significant microbial species-level and strain-level variation in host gene expression changes for innate immunity and epithelial barrier genes. Of particular interest, we found significant heterogeneity in stimulation of host interferon and antiviral interferon-stimulated genes.Study registered in ImmPort under accession # SDY2281.

  Study phs003627

• Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application

  We established hypoimmunogenic human induced pluripotent stem cells (iPSCs) to minimize the immune rejection caused by mismatches of HLA type. Here, we optimized the protocol for good manufacturing practice (GMP)-compatible CRISPR-Cas9 genome editing to deplete the three gene locus (HLA-A, HLA-B, and CIITA genes) simultaneously in HLA homozygous iPSCs. RNA-seq and flow cytometry analyses confirmed the successful depletion of HLAs, and lineage-specific differentiation into cardiomyocytes was verified.

  Study EGAS50000001194

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, various peripheral blood immune cell subsets from 136 systemic lupus erythematosus (SLE) and 89 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA, Naive_CD8, Naive_B, SM_B, USM_B, DN_B, Plasmablast, NK, CD16p_Mono, CL_Mono, Neu, mDC, pDC, TEMRA_CD8, CM_CD8, EM_CD8, NC_Mono, Int_Mono, LDG). RNA-seq was performed with each cell subset samples.

  Study JGAS000627

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, 24 peripheral blood immune cell subsets from 50 Systemic Sclerosis and 48 Healthy Controls were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono, Int_Mono, NC_Mono, mDC, pDC). RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000296

• Comprehensive molecular profiling of pulmonary pleomorphic carcinoma

  Information regarding the molecular features of pulmonary pleomorphic carcinoma (PPC) is insufficient. Here, we performed next-generation sequencing to determine the genomic and transcriptomic profiles of PPC. Whole exome sequencing (WES) of fresh-frozen tissue samples and target-capture sequencing of formalin-fixed-paraffin-embedded (FFPE) samples were performed. Fresh-frozen tissue samples and FFPE samples were subjected to WES and target-capture sequencing as normal control, respectively. Fresh-frozen tissue samples and 56 FFPE samples were subjected to RNA-seq.

  Study JGAS000297

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  Various peripheral blood immune cell subsets from 89 healthy volunteers and 136 systemic lupus erhythematosus (SLE) donors were collected (Naive_CD4, Mem_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, NK, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, Neu, LDG). 22 SLE donors were analyzed longitudinally. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000486

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• Paired exome analysis in urothelial carcinoma

  In this study we characterized genomic alterations in two to five metachronous tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth), Ultra deep targeted sequencing (~6,809x mean read depth) and whole transcriptome RNA-seq was performed for all samples. In addition multiregional WES was performed on 8 adjacent regions from a single tumor.

  Study EGAS00001001686

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• Single nuclei RNA-Seq from 5 regions of the human fetal brain

  Data generated through single nuclei RNA sequencing on 5 regions of the brain (frontal cortex, ganglionic eminence, hippocampus, thalamus and cerebellum) from 3 fetuses (two of 14 and one of 15 post-conception weeks, all female). Tissue was acquired from the MRC-Wellcome Trust Human Developmental Biology Resource (HDBR) with ethical approval. snRNA-seq libraries were prepared from ∼10,000 nuclei from each sample using Chromium Single Cell 3ʹ (v3) reagents (10X Genomics). Quality control of libraries was performed using the Agilent 5200 Fragment Analyzer before sequencing on an Illumina NovaSeq 6000 to a depth of at least 865 million (median = 1.01 billion) read pairs per library. Raw sequencing data were converted into FASTQ files. For a full description of data generation, please see Cameron et al, Biological Psychiatry 2022, https://doi.org/10.1016/j.biopsych.2022.06.033.

  Dataset EGAD00001009303

• BAM files of total RNA-Seq data of POPS control samples (GRCh37)

  Placental biopsies (n = 64 female placentas, n = 67 male placentas) were selected from healthy pregnancies from the POPs cohort. A quality control process was also applied for the RNA-Seq datasets: reads were trimmed with Trim Galore!, which uses cutadapt internally and were mapped to the same version of human genome reference (hg19). TopHat2, a splice-aware mapper built on top of Bowtie2 short-read aligner, was used in the mapping process in which so-called two-pass (or two-scan) alignment protocol was applied to rescue unmapped reads from the initial mapping step. In the second mapping, previously unmapped reads were re-aligned to the exon-intron junctions detected in the first-mapping by TopHat2 and were combined across all 131 placenta samples. The initial and second mapped reads were merged by samtools

  Dataset EGAD00001003462

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• 1. Identidication of molecular biological mechanism associated with the development and prognosis of uterine cancer, uterine sarcoma, and endometrial hyperplasia / 2. Identification of molecular biological mechanism associated with the development of endometriosis and malignant transformation, ovarian cancer, fallopian tubal cancer, peritoneal cancer, and other malignant tumors in gynecological organs

  To identify molecular subtypes and carcinogenesis in clear cell ovarian carcinomas by whole-exome sequencing, RNA-sequencing, and methylation array, and to characterize high-grade serous carcinomas by NGS-based, integrative genomic analyses, with focus on homologous recombination deficiency, molecular subtypes and prognositic factors.

  Study JGAS000560

• 5' Single cell RNA sequencing of pre-treatment tissues from lung cancer patients receiving immunotherapy

  Study EGAS00001006188

• Fresh vs. frozen cell preparations of colorectal cancer single-cell RNA sequencing

  Study EGAS00001003769

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• WTS and WES of Renal Cell Carcinoma Tumors From a Phase III Anti-Angiogenic Adjuvant Therapy Trial

  Archival de-identified formalin-fixed paraffin-embedded RCC tumor tissue blocks from nephrectomy or tumor biopsy were processed as per below and the same sections were used for both DNA and RNA extractions. For WES (ACE version 3; Illumina NovaSeq), samples were profiled using Personalis ACE Cancer Exome (Personalis, Inc, Menlo Park, CA) Whole-transcriptome profiles were generated by RNA-seq (Accuracy and Content Enhanced (ACE) version 3; Illumina NovaSeq) using Personalis ACE Cancer Transcriptome (Personalis, Inc, Menlo Park, CA ) Of the 615 patients in the intent-to-treat population in S-TRAC trial, 193 individual specimens were available for molecular profiling, of which 171 (27.8%) (sunitinib, n = 91; placebo, n = 80) returned results for the WES analysis, and 133 (21.6%) (sunitinib, n = 72; placebo, n = 61) returned results for the GES analysis. Of the 138 WTS samples with data, replicates for two patients were summarized by median expression, and three samples were excluded from the final analysis due to low counts.

  Dataset EGAD00001009294

• Genetic coupling of enhancer activity and connectivity in gene expression control

  In this study, we investigated whether the genetic effects of eQTLs on enhancer activity and enhancer-promoter contacts (connectivity) are inherently coupled or distinct. To address this, we performed Capture Hi-C targeting ~1100 eQTL loci, along with ATAC-seq and RNA-seq, in monocytes from 34 healthy male donors. Using single-modality and multi-modality Bayesian statistical approaches, we demonstrated that eQTL effects are predominantly shared across enhancer activity, connectivity, and gene expression. However, we also identified a locus where an eQTL disrupts a CTCF binding site at a putative insulator, facilitating contacts between the PCK2 gene promoter and downstream enhancers. To validate these findings, we used 4C-seq to confirm the allelic effects of eQTLs on enhancer-promoter connectivity at the PCK2 locus and another eQTL region associated with THBS1 expression, both of which showed consistent eQTL effects across all three modalities. Additionally, we conducted Hi-C on monocytes from two donors to map reference TADs and performed ChIP-seq to confirm the allelic effects of the PCK2 eQTL on CTCF binding. Together, these data provide comprehensive insights into the genetic coupling of enhancer activity, connectivity, and gene expression.

  Study EGAS50000000756

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: CLLE-ES.

  Dataset EGAD00001003548

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: LIRI-JP.

  Dataset EGAD00001003547

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: CLLE-ES.

  Dataset EGAD00001003549

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: RECA-EU.

  Dataset EGAD00001003559

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: PACA-AU.

  Dataset EGAD00001003411

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: PACA-AU.

  Dataset EGAD00001003410

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: MALY-DE.

  Dataset EGAD00001003560

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: MALY-DE.

  Dataset EGAD00001003561

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: RECA-EU.

  Dataset EGAD00001003558

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: OV-AU.

  Dataset EGAD00001003415

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: OV-AU.

  Dataset EGAD00001003416

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: LIRI-JP.

  Dataset EGAD00001003546

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Single Cell RNA-Sequencing in Adenoid Cystic Carcinoma

  This study of salivary adenoid cystic carcinoma aimed to profile individual malignant and stromal cells in treatment-naive head and neck adenoid cystic carcinoma, with or without metastatic cervical lymph nodes. Clinical and pathologic information was collected on all patients, in addition to a fresh biopsy sample from the primary tumor and/or metastatic lymph node at the time of initial surgery. A fresh biopsy sample from a matched local recurrence was also collected for a single unique patient. Biopsy specimens were processed for single cell RNA-seq. A total of ~1,700 single cells from seven participants were included in the final dataset.

  Study phs003070

• Preferential infiltration of distinct Vγ9δ2 T cells into Glioblastoma multiforme

  Glioblastoma multiforme (GBM), the most fatal CNS cancer, is highly infiltrative as a result of phenotypic alteration of cancer cells mainly driven by a mutual interaction among cancer cells, tumor-associated macrophages (TAMs) and other stromal cells. This work aims at characterizing GBM-infiltrating γδ T cells that may regulate the GBM tumor microenvironment and cancer cell gene expression. V(D)J repertoires of tumor-infiltrating and blood circulating γδ T cells from 4 patients were analyzed by NGS-based TCR sequencing. RNA gene expression profiling and immunostaining of cancer tissues were performed as well.

  Study EGAS00001002790

• RNA Sequencing of ECOG-E1308

  This study reports the RNA sequencing of HPV positive oropharyngeal squamous cell carcinoma samples from patients with HPV-associated stage III or stage IV cancer of the oropharynx that was surgically resectible. These patients participated in the ECOG-E1308 trial, a phase II trial that studied paclitaxel, cisplatin, and cetuximab followed by cetuximab and two different doses of intensity-modulated radiation therapy.

  Study phs003320