11750 results for "cancer rna-seq"

in 31.73 milliseconds.

• Single-Cell Atlas of Human Liver and Blood Immune Cells Across Fatty Liver Disease Stages

  The goal of the study was to investigate immunological correlates of human fatty liver disease progression. We generated a single-cell RNA-seq (scRNA-seq) atlas of immune cells from liver fine needle aspirates (FNAs) and paired peripheral blood mononuclear cells (PBMCs) from a full-spectrum Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)/Metabolic Dysfunction-Associated Steatohepatitis (MASH) human cohort, using the 3' 10X Genomics platform. Using computational analyses to assess changes in cellular frequencies and function, we found heightened immunoregulatory programs with profibrotic potential alongside a shift from antigen-specific to natural killer cytotoxic functions in the liver with MASH progression. Available data include raw single-cell transcriptomic data (FASTQ files) for each sample type (PBMC, FNA) per patient alongside clinical and histological measurements of fatty liver disease.

  Study phs004044

• Ither2 RNA-Seq dataset - Implementation of pediatric precision oncology into clinical practice: The individualized Therapies for Children with cancer program “iTHER”

  iTHER is a prospective national precision oncology program aiming to define tumor molecular profiles in children and adolescents with primary very high-risk, relapsed, or refractory pediatric tumors in order to identify relevant aberrations to inform treatment.

  Dataset EGAD00001010179

• Kidney_tumour_DNA

  This is a bulk DNA and RNA sequencing study of human renal tumours

  Study EGAS00001002486

• Somatic L1 retrotransposition dynamics in high-grade serous ovarian cancer

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from same patient were utilised to understand L1-mediated intrapatient heterogeneity.

  Study EGAS50000001198

• ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001231

• ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001230

• Fastq data for ChIP-Seq (H3K27ac) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27ac) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001403

• Fastq data for ChIP-Seq (H3K9me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K9me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001408

• ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001233

• Fastq data for ChIP-Seq (Input) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (Input) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001409

• ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001229

• ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001232

• Fastq data for ChIP-Seq (H3K36me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K36me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001405

• ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001234

• Fastq data for ChIP-Seq (H3K4me1) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me1) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001406

• Fastq data for ChIP-Seq (H3K27me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001404

• Fastq data for ChIP-Seq (H3K4me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001407

• March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies (Canadian Epigenetics, Environment and Health Research Consortium), Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001959

• RNA-Sequencing data of Fusobacterium nucleatum treated CAFs and HT-29 tumor spheroid exposed to Fusobacterium nucleatum treated CAFs conditioned medium.

  RNA-Sequencing data of CAFs (patient derived CAF180 and CAF181 as well as the CT5.3 CAF cell line) and HT-29 tumor spheroid samples performed in the context of the study of the interaction of Fusobacterium nucleatum with CRC CAFs. Fusobacterium nucleatum interacts with cancer-associated fibroblasts to enhance colorectal cancer progression

  Dataset EGAD50000001614

• Transcriptomic dataset from a phase II study of pembrolizumab and epigenetic modification with azacitidine in platinum-resistant epithelial ovarian cancer

  This dataset includes sequence files from bulk RNA sequencing of tissue biospecimens from a phase II study investigating epigenetic priming followed by immune checkpoint blockade in platinum-resistant epithelial ovarian cancer (NCT02900560). There are 48 bulk RNA sequencing files from 24 specimens included in this dataset.

  Dataset EGAD50000001664

• NeoRhea Bulk RNA and Single nuclei RNA & ATAC

  The aim of this study is to compare baseline and surgery samples of ER+/HER2- early breast cancer patients. Patients have been treated with endocrine therapy in combination with palbociclib. Samples have been collected pre and post treatment.

  Study EGAS50000001403

• Single-cell profiling maps the spectrum of crosstalk between glioma cells and tumor associated macrophages

  Tumor associated macrophages (TAMs) are a heterogeneous glioma infiltrate, implicated in cancer progression. We performed single-cell RNA-sequencing, to survey TAM response-patterns in glioma.

  Study EGAS00001002185

• Illumina single-cell RNA sequencing of omentum biopsies of ovarian cancer patients

  Illumina Novaseq paired-end single-cell RNA sequencing samples prepared using 10X Genomics platform. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 HGSOC metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 paired fastq files per sample.

  Dataset EGAD00001009815

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• 'KOREAN' never-smoker female adenocarcinoma RNA-seq

  Multi-layered genomic studies such as the TCGA project have greatly advanced our understanding on molecular pathogenesis of lung cancer. For Asian nonsmoker patients, however, majority of studies have been limited to mutational analyses, emphasizing ethnic differences in driver mutations (e.g. more frequent EGFR mutations and ALK fusions). In essence, a comprehensive multi-layered characterization that could lead to molecular etiology and patient stratification scheme to be translated into clinical applications for this patient group is still missing. Here we report molecular profiling of tumor and matched normal tissues from 114 non-small-cell lung adenocarcinoma patients using whole exome sequencing, transcriptome sequencing, and array comparative genomic hybridization (CGH).

  Study EGAS00001003789

• Chip-exo and Chip-nexus for five TFs in three colorectal cancer cell lines

  Chip-exo and Chip-nexus for FOXA1, HNF4A, KLF5, MYC, and TCF7L2 in colorectal cancer cell lines LoVo, GP5D, COLO320DM

  Dataset EGAD00001004099

• Study of biomarkers implicated in radio-immunotherapy response in metastatic cancer

  RNA sequencing data of tumors from 53 patients with advanced or metastatic cancer

  Dataset EGAD50000001644

• Neoantigen study samples for prostate cancer

  Whole exome sequencing and RNA sequencing data from 30 patients with prostate cancer.

  Dataset EGAD00001005713

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: LIRI-JP.

  Dataset EGAD00001003547

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: CLLE-ES.

  Dataset EGAD00001003548

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: CLLE-ES.

  Dataset EGAD00001003549

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: RECA-EU.

  Dataset EGAD00001003559

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: PACA-AU.

  Dataset EGAD00001003410

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: PACA-AU.

  Dataset EGAD00001003411

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: MALY-DE.

  Dataset EGAD00001003560

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: MALY-DE.

  Dataset EGAD00001003561

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: RECA-EU.

  Dataset EGAD00001003558

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: OV-AU.

  Dataset EGAD00001003415

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: OV-AU.

  Dataset EGAD00001003416

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: LIRI-JP.

  Dataset EGAD00001003546

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Triple Negative Breast Cancer RNA Sequencing

  We propose to definitively characterise the somatic genetics of triple negative breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000390

• RNA, ATAC, ChIP datasets from iPSC Derived Macrophages with and without TNFRSF1A intronic deletion using CRISPR

  This dataset consists of functional genomic data from iPSC derived Macrophages with or without CRISPR deletions and controls. It contains 21 paired end fastq files consisting of 6 total RNA-seq samples and 9 ATAC samples, for ChIP there are 2 H3K4me3 samples, 2 H3K27ac samples along with 2 paired input samples. The samples were sequenced on the Illumina HiSeq4000 amd Illumina NextSeq500 platforms.

  Dataset EGAD50000000984

• Transcriptional data of human isogenic iPSCs

  This dataset contains bulk RNA-seq data from 12 autosomally isogenic human iPSCs. Three biological replicas from XXY (sample ID 419295-7), XX (sample ID 419298-419300), XY (sample ID 419302, 419305-6), and XO (sample ID 419308, 419310, 419312) hiPSC. RNA for this dataset was collected using Trizol method, and polyA library type was implemented. The libraries were sequenced using Illumina device. The sample reads are deposited as fastq files. Analysis have been done using reference alignment to GRCh38 reference genome.

  Dataset EGAD50000001361

• Long-read single-cell RNA-seq in COVID-19

  We report the first application of long-read single-cell RNA sequencing on nasopharyngeal swabs from COVID-19 patients and healthy controls to resolve transcript-level changes across cell types. Samples were collected from three patients with moderate COVID-19, six patients with critical COVID-19, and three healthy controls. Single-cell libraries were generated using the 10x Genomics Chromium 3' protocol, producing unfragmented cDNA. Libraries were sequenced on the Oxford Nanopore Technologies PromethION platform. Basecalling was performed with Guppy (v1.6), generating a single FASTQ file per sample.

  Dataset EGAD50000001836

• Integrated Exome-seq analysis of tumor thrombus

  We prospectively enrolled 83 patients with a renal mass and TT scheduled to undergo surgical resection. To accurately integrate genomic and transcriptomic findings and enable histological co-registration, simultaneous isolation of DNA and RNA was performed from individual samples characterized histologically through immediately flanking sections

  Study EGAS00001005511

• The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk RNA-seq)

  RNA was isolated from purified human CD8 cells that were incubated with anti-HER2/CD3 TDB in the presence of SK-BR-3 cells. Sequencing libraries were generated and submitted for transcriptome profiling by high-throughput sequencing. Experiments were performed in triplicates for anti-HER2/CD3 TDB treatment and control. This Dataset is associated with the following ArrayExpress Experiment: E-MTAB-8211 - The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk)

  Dataset EGAD00001005187

• Bam files from Whole exome sequencing (WES, ~50x mean read depth) of metachronous bladder tumors

  In this study we characterized genomic alterations in two to five metachronous bladder tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth and whole transcriptome RNA-seq was performed (RNA was not advalible for 4 tumors) Data provided here consist of 122 Bam files for WES (83 Tumors and 39 blood)

  Dataset EGAD00001002716

• Single nucleus RNA Seq of LUAD patient derived lung samples

  Fastq files of single nucleus RNA Sequencing data from 26 patients including 26 lung adenocarcioma and 12 matched healthy tissue samples for 8 young female never smokers, 8 young female smokers, 7 elderly female never smokers and 3 male never smokers.

  Dataset EGAD00001008955

• RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells

  RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells. RNAseq was performed using 200 ng of total RNA by GATC Biotech. Directional libraries were performed after mRNA selection by polyA selection using UTP method. RNA-seq libraries were sequenced on HiSeq2500 Illumina machine using 100bp paired-end reads. Reads alignment was performed using the STAR aligner (version 2.4.0f1) and human genome hg19 as reference.

  Dataset EGAD00001007813

• RNAseq of human fetal pancreas development

  The dataset comprises RNA-seq information of 4 subpopulations sorted from human fetal pancreas of 3 different donors. Low input libraries were generated using the Smart-seq2 protocol after Ampure XP cleanup of the total RNA extracted from the sorted cells. Libraries were multiplexed and sequenced paired-end over 2 lanes of HiSeq4000 each. Raw data was aligned to the human genome refernence GRCh37 using STAR v2.5.1b with GENCODE v19 as transcriptome reference, and unaligned reads were folded into the final uploaded bams.

  Dataset EGAD00001004210

• 1. Identidication of molecular biological mechanism associated with the development and prognosis of uterine cancer, uterine sarcoma, and endometrial hyperplasia / 2. Identification of molecular biological mechanism associated with the development of endometriosis and malignant transformation, ovarian cancer, fallopian tubal cancer, peritoneal cancer, and other malignant tumors in gynecological organs

  To identify molecular subtypes and carcinogenesis in clear cell ovarian carcinomas by whole-exome sequencing, RNA-sequencing, and methylation array, and to characterize high-grade serous carcinomas by NGS-based, integrative genomic analyses, with focus on homologous recombination deficiency, molecular subtypes and prognositic factors.

  Study JGAS000560

• Whole Exome and RNA sequencing of synchronous female bilateral breast cancers

  Study EGAS00001006910

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• RNA-Seq analysis of cocaine use disorder in Brodmann Area 9

  We aimed to identify cocaine use disorder associated changes in gene expression in the Brodmann Area 9 subregion of the human prefrontal cortex. RNA-sequencing was performed in N=13 individuals with and N=12 individuals without CUD. The individuals are originating from a cohort of N=42 individuals where DNA methylation (DNAm) levels were previously analyzed using the EPIC array.

  Study EGAS50000000150

• RNA-Seq of human longitudinal whole blood samples from PCR-positive and PCR-negative adults following controlled inoculation with Influenza A H3N2 virus.

  Understanding of the transcriptomic profile of individuals in early influenza infection is limited. To investigate this, longitudinal whole-blood samples (n=178) were taken from adult participants following controlled inoculation with Influenza A H3N2 virus (sampling at baseline (0) and days 1, 2, 3, 7, 10 and 14 post-challenge). Most participants became influenza PCR-positive; a minority remained PCR-negative. Total RNA was extracted from PAXgene tubes before undergoing globin and rRNA depletion. DNA libraries were constructed using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina. All samples were then sequenced using Illumina NovaSeq 6000.

  Dataset EGAD50000000956

• Ribosomal profiling on Epstein-Barr virus transformed B-lymphoblastoid cell lines.

  This dataset contains Ribo-seq BAM files of Epstein-Barr virus-transformed B-lymphoblastoid cell lines from six individuals (HG00114, HG00282, NA12005, NA12044, NA12717 and NA12751) of the GEUVADIS Project. For each EBV-LCL, 20 million cells were treated with 2 μg/ml harringtonine and 100 μg/ml cycloheximide. After lysing cells in lysis buffer supplemented with 100 μg/ml cycloheximide, ribosome complexes were purified by density purification. Small RNA molecules were isolated using the NucleoSpin miRNA Kit (Bioke, Leiden, Netherlands), followed by RNA PAGE gel separation. Universal linkers were added after dephosphorylation. After reverse transcription, the cDNA was circularized and, after ribosomal RNA depletion, barcoded and sequenced on Illumina NextSeq 500.

  Dataset EGAD50000000465

• CMML Collection of WES, WGS, RNA-Seq and ERRBS data

  We first performed a comprehensive analysis of the genome of 66 chronic myelomonocytic leukemia cases using whole exome (N=49) or whole genome (N=17) sequencing for paired leukemic-control DNA. Then, we realized serial analysis of whole exome sequence in 17 cases, completed with serial RNA sequencing and DNA methylation analysis in 9 cases, including patients treated or not with hypomethylating agents.

  Study EGAS00001001264

• Preferential infiltration of distinct Vγ9δ2 T cells into Glioblastoma multiforme

  Glioblastoma multiforme (GBM), the most fatal CNS cancer, is highly infiltrative as a result of phenotypic alteration of cancer cells mainly driven by a mutual interaction among cancer cells, tumor-associated macrophages (TAMs) and other stromal cells. This work aims at characterizing GBM-infiltrating γδ T cells that may regulate the GBM tumor microenvironment and cancer cell gene expression. V(D)J repertoires of tumor-infiltrating and blood circulating γδ T cells from 4 patients were analyzed by NGS-based TCR sequencing. RNA gene expression profiling and immunostaining of cancer tissues were performed as well.

  Study EGAS00001002790

• RNA Sequencing of ECOG-E1308

  This study reports the RNA sequencing of HPV positive oropharyngeal squamous cell carcinoma samples from patients with HPV-associated stage III or stage IV cancer of the oropharynx that was surgically resectible. These patients participated in the ECOG-E1308 trial, a phase II trial that studied paclitaxel, cisplatin, and cetuximab followed by cetuximab and two different doses of intensity-modulated radiation therapy.

  Study phs003320

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• Cross-tissue transcriptomic analysis of human secondary lymphoid organ residing ILC3 reveals a default quiescent state in the absence of inflammation

  A cross tissue transcriptional comparison of human ILC3 isolated from non-inflamed lymph nodes (LN) and spleens, inflamed tonsils and the peripheral blood (PB). Using uniform gating and high-purity cell-sorting, ILC3 were sorted as Lineage(CD3,CD19,CD34,CD14,CD94)-CD45intCD127+CRTH2-CD117+. From LN, spleen, tonsils and PB, NKp44- ILC3 were isolated and, in addition, NKp44+ ILC3 were sorted from spleen and tonsils. RNA quality was measured on a RNA 6000 Pico Kit (Agilent Technologies) using a 2100 Bioanalyzer (Agilent Technologies). 100 pg high-quality RNA was isolated and cDNA was generated using the SMART-Seq (v3) Ultra Low Input RNA Kit (Clontech) with 15 cycles of amplification. Amplified and Covaris-fragmented cDNA was quality-checked on a High Sensitivity DNA chip (Agilent Technologies) and further processed according the TruSeq Nano DNA Library Preparation Kit (Illumina). Data was processed as follows: SMARTer adapters were trimmed with cutadapt and the resulting sequences were aligned to the human RefSeq transcriptome using 14 TopHat2 (Kim et al., 2013). Normalization and quantification was performed using Cufflinks (Trapnell et al., 2012). FPKM counts were determined per gene with HTSeq-count.

  Study EGAS00001002636

• The evolutionary dynamics of human colorectal cancer using single-gland spatial multi-omic profiling of DNA, RNA and chromatin.

  Deciphering the mechanisms of colorectal cancer growth, progression and dissemination in each individual patient.

  Study EGAS00001005230

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Dac EGAC00001000741

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• NCI Laboratory of Translational Genomics (LTG) Human Pancreas QTL study

  We created a human histologically normal pancreas eQTL resource using 91 fresh frozen tissue samples from patients diagnosed with pancreatic cancer (Mayo Clinic and Memorial Sloan Kettering Cancer Center) or from organ donors without a history of pancreatic cancer (Penn State University) by RNA-Sequencing. Genome wide genotyping was done using blood derived DNA samples or normal derived tissue samples. An average of ~369,4 million reads (paired end, stranded, 101 bp) and 724981 genotypes (per sample) were generated.

  Study phs001776

• BrainSpan Atlas of the Human Brain

  The NIH-funded BrainSpan (www.brainspan.org) and PsychENCODE (www.psychencode.org). Consortia sought to generate and analyze multi-dimensional genomics data from the developing and adult human brain in healthy and disease states. One of the main goals has been to perform large-scale and integrated analysis of the genome, transcriptome, and epigenome of the human brain to broaden our understanding of human neurodevelopment. This dataset consists of sixteen regions, including eleven neocortical areas, of human donors of both sexes and various ethnic groups. In the first stage of this project, we provide the genome-wide exon-level transcriptome data generated using the Affymetrix GeneChip Human Exon 1.0 ST Arrays, and the genome-wide genotyping data for 2.5 million markers using the Illumina Human Omni 2.5-Quad Bead Chips. In the second stage of this project, we provide whole-genome sequencing data, transcriptome data by mRNA-Seq, small RNA data by smRNA-seq, DNA cytosine methylation by Infinium HumanMethylation450 BeadChip, and epigenomic/epigenetic data by ChIP-Seq for H3K4me3, H3K27me3, H3K27ac and CTCF.

  Study phs000755

• Systemic Inflammation and Lymphocyte Activation Precede Rheumatoid Arthritis

  The Allen Institute for Immunology-University of California, San Diego-University of Colorado Transition to Rheumatoid Arthritis (ALTRA) project is a prospective longitudinal cohort study to understand the pre-clinical development of rheumatoid arthritis (RA). We performed cross-sectional and longitudinal multi-omics analyses of peripheral immunity in the anti-citrullinated protein autoantibody-positive (ACPA+) at-risk for RA period. We provide FASTQ files from (1) single-cell RNA sequencing (scRNA-seq) of ACPA+ at-risk (n=45), ACPA+ early RA (n=11), and site-matched ACPA- controls (n=38); (2) scRNA-seq of longitudinal samples from ACPA+ at-risk who developed clinically active RA during our study (n=16 participants, n=75 samples) and ACPA- controls (n=29 subjects, n=89 samples); (3) trimodal TEA-seq of a subset of ACPA+ at-risk (n=7) and ACPA- controls (n=5). Using these data, we characterize pathogenesis prior to clinical RA diagnosis and suggest the at-risk state exhibits substantial immune alterations that could potentially be targeted for early intervention to delay or prevent autoimmunity.

  Study phs003944

• Single-nuclei gene-expression analysis of pheochromocytoma and paraganglioma links tumor subtypes with tumor microenvironment

  Pheochromocytomas and paragangliomas (PCPG) are rare neuroendocrine tumors associated with autonomic nerves. We used single nuclei-RNA-seq (snRNA-seq) for analysis of 30 PCPG representing 13 known driver genes, plus two normal adrenal medullas to dissect cell composition, refine PCPG subtypes and compare PCPG and normal tissue expression. Incorporating bulk-tissue and snRNA-seq data we identified seven PCPG gene-expression subtypes with genotype and cell type associations. The tumor microenvironment reflected HIF pathway activation and neovascularization by detection of abundant tip-like endothelial cells and pericytes concordant with VEGFA expression in neoplastic cells with mutations in VHL, genes encoding SDH subunits and MAML3-fusions. Macrophages were abundant in PCPG with distinct tumor-associated features. Schwann-cell-like cells were also enriched in some subtypes. The transcriptional profile of neoplastic PCPG cells resembled normal chromaffin cells but early chromaffin and neuroblast cell markers were expressed in some subtypes including GPR139, a putative therapeutic target for a subset of pseudohypoxic PCPG.

  Study EGAS00001005861

• Single-cell RNA sequencing of human omental tissue in benign and metastatic ovarian cancer

  To elucidate the cellular and molecular mechanisms underlying omental homeostasis and its transformation during ovarian cancer metastasis, a human omental cell atlas was generated encompassing both benign and metastatic conditions. Single-cell RNA sequencing was performed on freshly dissociated omental tissue samples from patients with newly diagnosed benign and malignant disease. Samples collected during diagnostic surgery covered distinct anatomical regions, enabling comparison between non-metastasized omentum and sites along the metastatic gradient, including distant, peritumoral, and tumor core areas.

  Study EGAS50000001465

• mRNA-seq of paired Follicular Lymphoma (FL) patient samples before and after high-grade transformation to DLBCL (FL vs. tFL) from FFPE tissues

  The aim of this study was to analyze transcriptional changes in paired samples of follicular lymphoma (FL) and its histological transformation (tFL). Transformation of FL is an adverse event in the course of the disease and is associated with poor outcome. Several genetic aberrations have been linked to tFL pathogenesis, but gene expression changes and microenvironmental interactions have not been well characterized. We performed RNA profiling of FL and paired tFL samples transformed to DLBCL (n=11 pairs). For RNA profiling, we utilized libraries prepared using RNA isolated from archival FFPE tissues.

  Study EGAS50000000941

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• Clonal Evolution and Heterogeneity of Osimertinib Acquired Resistance Mechanisms in EGFR Mutant Lung Cancer

  Current understanding of acquired resistance to osimertinib in EGFR-mutant lung cancer is largely based on the use of targeted sequencing platforms and cell-free DNA. In this study we examined the clonal evolution and heterogeneity of acquired resistance mechanisms to osimertinib through whole exome and RNA-sequencing of prospectively collected pre-and post-osimertinib resistant tumors and metastases at rapid autopsy. We enrolled 34 patients with histologically confirmed EGFR mutant advanced lung adenocarcinoma in a prospective Phase II clinical trial to evaluate osimertinib treatment and the use of local ablative therapy (LAT) for oligoprogressive disease (NCT02759835) in EGFR mutant NSCLC from April 2016 until data cutoff in September 2019. Patients were not selected based on oligometastatic status, rather 32/34 patients had multiple organ involvement, including lung, liver, adrenal, brain and bone. Biopsies or surgeries were performed pre-osimertinib treatment and at first progression on osimertinib. A subset of patients also underwent biopsies at second progression on osimertinib, and following end of life in-patient hospice and rapid autopsy upon death. 63% (n=15/24) of first-line osimertinib and 50% (n=5/10) of second-line osimertinib treated patients had RECIST defined partial response. Overall, 21 patients had RECIST defined first progression on osimertinib. Two patients on this trial discontinued treatment and were lost to follow up. Of the 21 patients who had RECIST defined progression, 14 patients underwent LAT (8 first-line and 6 second-line). Twelve patients had paired pre- and post-osimertinib resistant tumors and three had post-osimertinib resistant tumors available for analysis. Four patients (LAT002, LAT006, LAT014 and LAT021) consented for a rapid autopsy protocol and underwent rapid autopsy after deatH. To elucidate acquired osimertinib resistance mechanisms, we performed whole-exome (WES), targeted sequencing and RNA-seq on 66 tumors and matched germline DNA from tumor tissue obtained from a total of 15 patients.

  Study phs002001

• Single cell RNA sequencing of 33 primary colorectal cancer

  Study EGAS00001003779

• RNA sequencing in primary human macrophages overexpressing ETS2

  This dataset consists of RNA sequencing data from an ETS2 overexpression experiment in M0 macrophages. Controlled overexpression of ETS2 mRNA or control mRNA (an equivalent amount of mRNA encoding the reverse complement of ETS2 – thereby controlling for the quantity, length and purine/pyrimidine composition of the transfected RNA but with a transcript that would not be translated) was induced in resting, non-activated (M0) macrophages by transfecting predefined amounts of in vitro transcribed mRNA. To minimise non-specific activation due to the transfected RNA, in vitro transcription was performed using co-transcriptional capping (to minimise uncapped products), and incorporating modified, minimally immunogenic nucleotides (replacing uridine with N1-methyl-pseudouridine and cytidine with methylcytidine). After 18 hours, transfected cells were were activated with low dose LPS and harvested for RNA-sequencing 6 hours later. Sequencing libraries were prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions. The quality and molarity of all libraries was assessed using a BioAnalyzer 2100 and the libraries were sequenced on a NovaSeq6000. Raw data are provided as 100 bp paired-end Illumina reads from n = 8 donors.

  Dataset EGAD00001011341

• GBM-ZEB1: RNA sequencing of parental tumors used for cell line generation

  This dataset contains RNA sequencing raw data from four parental tumors that were used for classification of gene expression subtypes (Verhaak, Cancer Cell 2010) using ssGSEA.

  Dataset EGAD00001001627

• RIP-SeqRaw data

  This dataset contains the raw count matrix generated in the PTBP1 project. Sequencing data were obtained from bulk directional RNA-seq and RIP-seq experiments performed on a NovaSeq 6000 platform (2×100 bp paired-end reads). Read counts were computed using HTSeq-count, without normalization. The dataset comprises two groups of samples: controls and patients. For each group, both input and immunoprecipitated samples are available. Patient samples correspond to skin biopsies from individuals affected by a neurodevelopmental disorder associated with variable skeletal dysplasia and disproportionate short-limbed short stature.

  Dataset EGAD50000001722

• miRNA-seq data for Molecular Characterization of ETMR

  This dataset contains miRNA-seq data from 10 patients. Small RNAs were isolated as described previously57,58 from fresh-frozen tumour material. In brief, total RNA was extracted using guanidinium isothiocyanate/phenol extraction followed by 3′-adaptor ligation of barcoded adenylated adaptors. Samples were pooled in two sets of five samples. Subsequently, gel electrophoresis was used to isolate small RNAs (19–35 nt) and purified using ethanol precipitation. Fragments were then amplified using standard PCR, isolated using gel electropho- resis and purified using ethanol precipitation. Samples were sequenced on a HiSeq 2000 v.4 machine resulting in 10 Fastq files.

  Dataset EGAD00001006218

• Dataset for identification of the dismal subtype of B-ALL with dysregulation of CDX2 and UBTF

  WGS (tumor and germline samples) was performed to identify structural variants in the UBTF/CDX2 subgroup. RNA-seq was performed to detect gene fusion in the UBTF/CDX2 subgroup. HiChIP was performed to investigate 3D chromatin architecture and enhancer landscapes of representative patient samples and cell lines harboring Type I and II FLT3-PAN3 deletions and amplifications.

  Dataset EGAD00001008416

• Single-cell RNA sequencing of pediatric Hodgkin Lymphoma to study the inhibition of T cell subtypes

  Here, we applied single-cell RNA-sequencing (scRNA-seq) on isolated HRS cells and the immune cells from the same cHL tumors. This allowed us to identify genes of cell surface proteins that are consistently overexpressed in HRS cells and can potentially be used as targets for antibody-drug conjugates or CAR T cells. Finally, we identify potential interactions by which HRS cells inhibit T cells, among which the Galectin-1/CD69 and HLA-DRA/LAG3 interactions. However, high levels of inter-patient heterogeneity of the interaction strength were observed. In conclusion, this study identifies new potential therapeutic targets for cHL and highlights the importance of studying heterogeneity when identifying therapy targets.

  Study EGAS50000000432

• RNA-Sequencing of cervical cancers

  We used RNA sequencing of 81 cervical cancer specimens to developed an immune-based gene expression signature to predict distant metastasis in cervical cancer patients treated with RT/cisplatin. Our 55-gene risk score, validated across independent cohorts, was strongly linked to higher rates of metastasis and lower survival. The score also correlated with higher copy-number alteration and a less immune-responsive tumor microenvironment, indicating its potential in identifying high-risk patients and informing targeted therapies.

  Dataset EGAD50000000120

• Upcycling and merging data to challenge the dogma and identify new therapeutic targets for Glioblastoma

  Glioblastoma is the most common brain tumour. Characterised by a poor prognosis and its recurrence after multimodal treatments, the search for preventable risk factors has been mainly inconclusive up to date. Recently, the data merge from datasetsdeposited at the EGA allowed Aaron Diaz’s team to discover that the glioblastoma cells shift toward a mesenchymal phenotype when the tumour is recurring. Challenges in glioblastoma research As for virtually all cancer types, many efforts have been made to unveil the molecular features responsible of the disease, and several cellular pathways have indeed been identified as being frequently mutated in glioblastoma. Nonetheless, targeted therapies based on identified genes have so far failed to improve outcome, thus survival mostly relies on a standard treatment unchanged since 2005. This is a frustrating situation for both the scientific and medical communities, and above all for the patients, still facing a dreadful path. Some researchers hypothesised that this may be due to the inability to efficiently target cancer stem cells, the originators of the other cell types, thus inducing cancer relapse. In 2019 Charles P. Couturier and colleagues sequenced RNA from single cells of freshly excised glioblastomas of 16 patients, and demonstrated that glioblastoma cells replicate normal brain cell development with a conserved neural cancer cell hierarchy centered around glial progenitor-like cells. In this way, they helped identify the possible target cells to improve efficacy and durability of treatment. Data upcycling at the EGA: the glioblastoma case study Single cell RNA sequencing is generated with a laborious and expensive protocol. The quality of the starting material is crucial (cells sample freshly extracted from the patients) and often several attempts are needed before producing reliable quality sequencing results. Collecting big numbers of patients is also challenging. The sequencing data produced by Kevin Petrecca’s group in Montreal, Canada and deposited at the EGA (EGAS00001004422) was recently upcycled by Lin Wang in San Francisco, California and pooled with their freshly produced ones, and then deposited at the EGA as Dataset EGAS00001004909 The data merge allowed Aaron Diaz’s team to discover that the glioblastoma cells shift toward a mesenchymal phenotype when the tumour is recurring. They profiled 86 primary-recurrent patient-matched paired glioblastoma samples with single-nucleus RNA, among other techniques. These very comprehensive results lead the team to challenge the findings from several other cancer fields where chemotherapy standard chemo-radiation therapy selection pressure at the level of genomic alterations; this is indeed not the case for glioblastoma, where the pressure results in phenotypic transition between cellular states. Several technical controls were made to ensure that the merge of the data was not introducing a bias in the results, and an Inter-table analysis demonstrated nearly equal contribution to overall variance from each of the studies included, indicating that the findings were not due to inter-laboratory technical effect. A novel principal-component analysis showed that the largest contribution to variation in primary glioblastoma neoplastic cells was an axis between MES (mesenchymal) and proneural expression programs. In summary, treating glioblastoma often makes a MES, as commented by Lucy Stead about this remarkable work. Check Aaron Diaz’s team Nature Cancer paper, with strong technical tools, state of the art analysis and data from different sources converging to the same outcomes that made possible a significant step toward a better handling of a frightful cancer. References Couturier, C.P., Ayyadhury, S., Le, P.U. et al. Single-cell RNA-seq reveals that glioblastoma recapitulates a normal neurodevelopmental hierarchy. Nat Commun 11, 3406 (2020). Stead, L.F. Treating glioblastoma often makes a MES. Nat Cancer 3, 1446–1448 (2022). Wang, L., Jung, J., Babikir, H. et al. A single-cell atlas of glioblastoma evolution under therapy reveals cell-intrinsic and cell-extrinsic therapeutic targets. Nat Cancer 3, 1534–1552 (2022). Related links: Kevin Petrecca’s group dataset deposited at the EGA: EGAS00001004422 Lin Wang dataset deposited at the EGA: EGAS00001004909

  Blog upcycling-and-merging-data-to-challenge-glioblastoma

• Multimodal Epigenetic Sequencing Analysis (MESA) of Cell-free DNA for Non-invasive Cancer Detection

  Multimodal characterization of cell-free DNA (cfDNA) in the blood can enable the sensitive and non-invasive detection of human cancers but remains technically challenging and costly. Here, we developed Multimodal Epigenetic Sequencing Analysis (MESA), a flexible and sensitive method of capturing and integrating multimodal epigenetic information of cfDNA using a single experimental assay, i.e., non-disruptive bisulfite-free methylation sequencing, such as Enzymatic Methyl-seq (EM-seq) and TET-assisted pyridine borane sequencing (TAPS). MESA can simultaneously infer cfDNA methylation, nucleosome occupancy, nucleosome fuzziness, and fragmentation profile for regions surrounding the promoters and polyadenylation sites (PASs). MESA’s integrated analysis of multimodal epigenetic features significantly improved the performance of cancer detection models compared to the usage of any single modality alone. MESA captures additional and highly complementary epigenetic information from cfDNA without additional experimental assays, highlighting the importance and clinical prospect of using multimodal epigenetic features for non-invasive cancer detection

  Study EGAS00001006462

• Advanced Genetic and Molecular Analysis of Solid Tumors

  This study is designed to understand the role of immunosuppressive regulatory B cells (Breg) in pancreatic cancer. Breg and conventional B cells (Bcon) from patients are compared by RNA sequencing analysis. Bregs and Bcon were isolated from freshly isolated PBMCs in peripheral blood. These data represent the examination of differentially expressed genes in these two blood-derived B cell subsets from both healthy and pancreatic cancer patients.

  Study phs001999

• ATAC-seq of metastatic prostate tumors

  This dataset includes Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq) data, in FASTQ format, from 70 metastatic castration-resistant prostate cancer tumor samples from the SU2C/PCF West Coast Dream Team (WCDT) project. The sequencing data is paired-end, 150 bp sequencing data from an Illumina NovaSeq 6000 machine. ATAC-seq libraries were prepared following the protocol described in Buenrostro et al. Nature Methods. 2013 (PMID: 24097267) and Corces et al. Nature Methods. 2017 (PMID: 28846090).

  Dataset EGAD00001009654

• Hepatitis B virus integrations promote local and distant oncogenic driver alterations in hepatocarcinogenesis

  This study contain the WGS and WEX aligned bam files and RNA-seq fastq files for human liver tumors.

  Dataset EGAD00001006426

• SARS-CoV2 mRNA-vaccination-induced Immunological Memory in Human Non-Lymphoid and Lymphoid Tissues

  This dataset includes combined single-cell RNA-Seq and T cell receptor profiling data for SARS-CoV-2 spike protein-reactive CD4+ T cells and NK cells from blood, liver, lungs, and bone marrow of human donors.

  Dataset EGAD50000000062

• Oxidative DNA damage and ubiquitin proteasome system dysfunction underpins neurodegeneration in young adults with a DNA repair disorder

  Deposited here are time series bulk RNA-seq data generated from XP patients and controls as well as rescued patient hiPSC cells during cortical neuronal differentiation.

  Dataset EGAD50000000230