11925 results for "cancer rna-seq"

in 137.69 milliseconds.

• Chip-exo and Chip-nexus for five TFs in three colorectal cancer cell lines

  Chip-exo and Chip-nexus for FOXA1, HNF4A, KLF5, MYC, and TCF7L2 in colorectal cancer cell lines LoVo, GP5D, COLO320DM

  Dataset EGAD00001004099

• Study of biomarkers implicated in radio-immunotherapy response in metastatic cancer

  RNA sequencing data of tumors from 53 patients with advanced or metastatic cancer

  Dataset EGAD50000001644

• Neoantigen study samples for prostate cancer

  Whole exome sequencing and RNA sequencing data from 30 patients with prostate cancer.

  Dataset EGAD00001005713

• Proteogenomic Landscape of Squamous Cell Lung Cancer

  To provide a detailed analysis on how genomic and transcriptomic alterations related to proteome level changes in squamous cell lung cancer (SCC), we performed an integrated analysis incorporating DNA copy number, somatic mutations, expression RNA-sequencing, and expression proteomics in 108 SCC nested within clinical outcome, tumor pathology, and other clinically relevant data.

  Study phs001781

• DAC for study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer."

  This is Data Access Committee will oversee data sharing for sequence data in the EGA study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer." This dataset includes 116 bam files from whole exome sequencing on the Illumina HiSeq2500, 102 fastq files from RNA sequencing on the Illumina NovaSeq 6000. The samples analyzed include tumor/normal DNA samples and tumor RNA samples from 72 individuals with non-small cell lung cancer treated with pembrolizumab and SBRT or pembrolizumab alone on the NCT02492568 trial.

  Dac EGAC50000000202

• Integrated Somatic and Germline Molecular Properties Dictating Biological and Clinical Phenotypes in Cancer

  We performed single-nuclei matched RNA- and ATAC-sequencing of frozen biopsies from normal adjacent tissue, primary and metastatic esophageal adenocarcinoma specimens. The data was then further stratified into a tumor microenvironment and malignant compartment and was computationally analyzed to reveal cancer cell subtypes and programs driving malignancy.

  Study phs003438

• RNA of peripheral blood for pancreatic cancer and chronic pancreatitis

  Samples of nucleated cells found in peripheral blood from over 300 patients suffering from resectable pancreatic ductal adenocarcinoma, non-resectable pancreatic cancer, chronic pancreatitis, or none of these. Please cite this article when using data: Al-Fatlawi, A.; Malekian, N.; García, S.; Henschel, A.; Kim, I.; Dahl, A.; Jahnke, B.; Bailey, P.; Bolz, S.N.; Poetsch, A.R.; Mahler, S.; Grützmann, R.; Pilarsky, C.; Schroeder, M. Deep Learning Improves Pancreatic Cancer Diagnosis Using RNA-Based Variants. Cancers 2021, 13, 2654. https://doi.org/10.3390/cancers13112654

  Dataset EGAD00001006915

• Somatic L1 retrotransposition dynamics in high-grade serous ovarian cancer

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from same patient were utilised to understand L1-mediated intrapatient heterogeneity.

  Study EGAS50000001198

• ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001231

• Fastq data for ChIP-Seq (H3K27ac) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27ac) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001403

• ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001233

• Fastq data for ChIP-Seq (Input) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (Input) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001409

• ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001229

• ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001232

• ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001234

• Fastq data for ChIP-Seq (H3K4me1) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me1) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001406

• ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001230

• Fastq data for ChIP-Seq (H3K27me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001404

• Fastq data for ChIP-Seq (H3K36me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K36me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001405

• Fastq data for ChIP-Seq (H3K9me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K9me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001408

• Fastq data for ChIP-Seq (H3K4me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001407

• March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies (Canadian Epigenetics, Environment and Health Research Consortium), Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001959

• RNA-seq of human iPSC-derived neurons to explore cellular phenotypes associated with schizophrenia.

  This dataset contains high-throughput RNA-sequencing of 12 samples, each sample comprising neural precursor cells derived from human induced pluripotent stem cells from individuals with and without the 16p13.11 microduplication (a copy number variant associated with a range of neurodevelopmental disorders). 4 samples derive from patients carrying the 16p13.11 microduplication, and 8 derive from unaffected family controls. RNA samples were processed to deplete rRNA using the TruSeq Stranded Total RNA with Ribo-Gold kit. Libraries were then sequenced using the NextSeq 500/550 High-Output v2 Kit on the Illumina NextSeq 550 platform, to produce 75 base pair paired-end sequencing reads at an average depth of around 100 million reads per sample. Raw sequencing reads data are stored in two FASTQ files per sample for these paired-end reads.

  Dataset EGAD00001004064

• Triple Negative Breast Cancer RNA Sequencing

  We propose to definitively characterise the somatic genetics of triple negative breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000390

• RNA-Sequencing data of Fusobacterium nucleatum treated CAFs and HT-29 tumor spheroid exposed to Fusobacterium nucleatum treated CAFs conditioned medium.

  RNA-Sequencing data of CAFs (patient derived CAF180 and CAF181 as well as the CT5.3 CAF cell line) and HT-29 tumor spheroid samples performed in the context of the study of the interaction of Fusobacterium nucleatum with CRC CAFs. Fusobacterium nucleatum interacts with cancer-associated fibroblasts to enhance colorectal cancer progression

  Dataset EGAD50000001614

• Transcriptomic dataset from a phase II study of pembrolizumab and epigenetic modification with azacitidine in platinum-resistant epithelial ovarian cancer

  This dataset includes sequence files from bulk RNA sequencing of tissue biospecimens from a phase II study investigating epigenetic priming followed by immune checkpoint blockade in platinum-resistant epithelial ovarian cancer (NCT02900560). There are 48 bulk RNA sequencing files from 24 specimens included in this dataset.

  Dataset EGAD50000001664

• NeoRhea Bulk RNA and Single nuclei RNA & ATAC

  The aim of this study is to compare baseline and surgery samples of ER+/HER2- early breast cancer patients. Patients have been treated with endocrine therapy in combination with palbociclib. Samples have been collected pre and post treatment.

  Study EGAS50000001403

• Illumina single-cell RNA sequencing of omentum biopsies of ovarian cancer patients

  Illumina Novaseq paired-end single-cell RNA sequencing samples prepared using 10X Genomics platform. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 HGSOC metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 paired fastq files per sample.

  Dataset EGAD00001009815

• Single-cell profiling maps the spectrum of crosstalk between glioma cells and tumor associated macrophages

  Tumor associated macrophages (TAMs) are a heterogeneous glioma infiltrate, implicated in cancer progression. We performed single-cell RNA-sequencing, to survey TAM response-patterns in glioma.

  Study EGAS00001002185

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Modulation of Lung Immune Responses to Viral Infection-Microbiome Interactions with Respiratory Organoids

  Here, we colonized bronchial epithelial air-liquid interface tissue cultures with 58 different individual microbes. Following 18 and 48 hours of colonization, we performed bulk RNA-seq of the host epithelial cells (n=3). Overall, we found significant microbial species-level and strain-level variation in host gene expression changes for innate immunity and epithelial barrier genes. Of particular interest, we found significant heterogeneity in stimulation of host interferon and antiviral interferon-stimulated genes.Study registered in ImmPort under accession # SDY2281.

  Study phs003627

• Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application

  We established hypoimmunogenic human induced pluripotent stem cells (iPSCs) to minimize the immune rejection caused by mismatches of HLA type. Here, we optimized the protocol for good manufacturing practice (GMP)-compatible CRISPR-Cas9 genome editing to deplete the three gene locus (HLA-A, HLA-B, and CIITA genes) simultaneously in HLA homozygous iPSCs. RNA-seq and flow cytometry analyses confirmed the successful depletion of HLAs, and lineage-specific differentiation into cardiomyocytes was verified.

  Study EGAS50000001194

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, various peripheral blood immune cell subsets from 136 systemic lupus erythematosus (SLE) and 89 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA, Naive_CD8, Naive_B, SM_B, USM_B, DN_B, Plasmablast, NK, CD16p_Mono, CL_Mono, Neu, mDC, pDC, TEMRA_CD8, CM_CD8, EM_CD8, NC_Mono, Int_Mono, LDG). RNA-seq was performed with each cell subset samples.

  Study JGAS000627

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, 24 peripheral blood immune cell subsets from 50 Systemic Sclerosis and 48 Healthy Controls were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono, Int_Mono, NC_Mono, mDC, pDC). RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000296

• Comprehensive molecular profiling of pulmonary pleomorphic carcinoma

  Information regarding the molecular features of pulmonary pleomorphic carcinoma (PPC) is insufficient. Here, we performed next-generation sequencing to determine the genomic and transcriptomic profiles of PPC. Whole exome sequencing (WES) of fresh-frozen tissue samples and target-capture sequencing of formalin-fixed-paraffin-embedded (FFPE) samples were performed. Fresh-frozen tissue samples and FFPE samples were subjected to WES and target-capture sequencing as normal control, respectively. Fresh-frozen tissue samples and 56 FFPE samples were subjected to RNA-seq.

  Study JGAS000297

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  Various peripheral blood immune cell subsets from 89 healthy volunteers and 136 systemic lupus erhythematosus (SLE) donors were collected (Naive_CD4, Mem_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, NK, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, Neu, LDG). 22 SLE donors were analyzed longitudinally. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000486

• Paired exome analysis in urothelial carcinoma

  In this study we characterized genomic alterations in two to five metachronous tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth), Ultra deep targeted sequencing (~6,809x mean read depth) and whole transcriptome RNA-seq was performed for all samples. In addition multiregional WES was performed on 8 adjacent regions from a single tumor.

  Study EGAS00001001686

• BAM files of total RNA-Seq data of POPS control samples (GRCh37)

  Placental biopsies (n = 64 female placentas, n = 67 male placentas) were selected from healthy pregnancies from the POPs cohort. A quality control process was also applied for the RNA-Seq datasets: reads were trimmed with Trim Galore!, which uses cutadapt internally and were mapped to the same version of human genome reference (hg19). TopHat2, a splice-aware mapper built on top of Bowtie2 short-read aligner, was used in the mapping process in which so-called two-pass (or two-scan) alignment protocol was applied to rescue unmapped reads from the initial mapping step. In the second mapping, previously unmapped reads were re-aligned to the exon-intron junctions detected in the first-mapping by TopHat2 and were combined across all 131 placenta samples. The initial and second mapped reads were merged by samtools

  Dataset EGAD00001003462

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• Single nuclei RNA-Seq from 5 regions of the human fetal brain

  Data generated through single nuclei RNA sequencing on 5 regions of the brain (frontal cortex, ganglionic eminence, hippocampus, thalamus and cerebellum) from 3 fetuses (two of 14 and one of 15 post-conception weeks, all female). Tissue was acquired from the MRC-Wellcome Trust Human Developmental Biology Resource (HDBR) with ethical approval. snRNA-seq libraries were prepared from ∼10,000 nuclei from each sample using Chromium Single Cell 3ʹ (v3) reagents (10X Genomics). Quality control of libraries was performed using the Agilent 5200 Fragment Analyzer before sequencing on an Illumina NovaSeq 6000 to a depth of at least 865 million (median = 1.01 billion) read pairs per library. Raw sequencing data were converted into FASTQ files. For a full description of data generation, please see Cameron et al, Biological Psychiatry 2022, https://doi.org/10.1016/j.biopsych.2022.06.033.

  Dataset EGAD00001009303

• The Landscape of Antisense Gene Expression in Human Cancers

  High throughput RNA Sequencing has revealed that the human genome is widely transcribed. However, the extent of natural antisense transcription, the molecular mechanisms by which natural antisense transcripts (NATs) might affect their cognate sense genes, and the role of NATs in cancer are less well understood. Here, we use strand-specific paired-end RNA sequencing (ssRNASeq) on a cohort of 376 cancer patients covering 9 tissue types to comprehensively characterize the landscape of antisense expression. Our results reveal that greater than 60% of annotated transcripts have measureable antisense expression and the expression of sense and antisense transcript pairs is in general positively correlated. Furthermore, by studying the expression of sense/antisense pairs across tissues we identify lineage-specific, ubiquitous and cancer-specific antisense loci. Our results raise the possibility that NATs participate in the regulation of well-known tumor suppressors and oncogenes. Finally, this study provides a catalogue of cancer related genes with significant antisense transcription (oncoNAT). This resource will allow researchers to investigate the molecular mechanisms of sense/antisense regulation and further advance our understanding of their role in cancer.

  Study phs000937

• Djerroudi et al., E-cadherin inactivation shapes tumor microenvironment specificities in invasive lobular carcinoma

  Invasive lobular breast carcinoma (ILC) shows specific stromal features, T lymphocyte infiltration (TIL) being associated with poor prognosis. Here, we reveal the involved mechanism by performing single cell RNA sequencing, combined immunohistochemistry, deconvolution of bulk RNA sequencing from large retrospective ILC series, and functional assays using primary cells. We show that ILC accumulate FAP+ inflammatory cancer-associated fibroblasts (iCAF) through a previously undescribed mechanism mediated by E-cadherin/CDH1 on CAF plasticity. Indeed, CDH1 inactivation in ILC cancer cells prevents differentiation of iCAF into myofibroblastic CAF (myCAF), leading to iCAF accumulation. In turn, iCAF increase TIL infiltration and shape their spatial organization in ILC. Subsequently, CDH1-inactivated ILC cancer cells promote immune escape by lack of retention and activation of ITGAE-expressing resident memory CD8+ T lymphocytes (TRM). Hence, our study uncovers reciprocal interactions between CDH1-inactivated cancer cells, iCAF and CD8+ TRM, revealing why and how TILs have a poor prognosis in ILC patients, a mechanism extrapolated to other CDH1-mutated cancer types.

  Study EGAS50000000761

• RoCK and ROI single-cell transcriptome of one acute lymphoblastic leukemia patient

  Whole-transcriptome single-cell RNA sequencing (scRNA-seq) was performed following the manufacturer’s protocol (BD Rhapsody, BD Biosciences). Targeted enrichment of BCR::ABL1 transcripts was conducted using the RoCK and ROI-seq approach, based on the barcoded bead technology of the BD Rhapsody platform. In the RoCK and ROI-seq workflow, the template-switch oligonucleotides (TSOs) attached to BD Rhapsody beads were modified with one or multiple capture sequences specific to transcripts of interest, enabling targeted transcript capture during reverse transcription. ROI primers that are added during library preparation to direct amplification and sequencing toward these defined regions of interest (ROIs). Resulting libraries were sequenced on an Illumina sequencer.

  Dataset EGAD50000001976

• Whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing data from nasal cells of COVID-19 patients

  Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dataset EGAD50000000398

• Sequencing data of the ampulla and fimbriae of the fallopian tube in pre-menopausal women

  A total of 10 pre-menopausal patients were recruited for this study. Sequencing of both the fimbriae and ampullary region of the fallopian tubes was performed using 10x Genomics single-cell RNA-seq and ATAC-seq. For one patient, data were sequenced across 4 lanes, while the remaining patients' data were sequenced in 2 lanes each, resulting in a total of 44 sequencing datasets for each platform.

  Dataset EGAD50000000889

• RIP-SeqRaw data

  This dataset contains 15 paired FASTQ files from the PTBP1 project. Sequencing data were generated using bulk directional RNA-seq and RIP-seq experiments performed on a NovaSeq 6000 platform (2×100 bp paired-end reads). The dataset comprises two groups of samples: controls and patients. For each group, both input and immunoprecipitated samples are available. Patient samples correspond to skin biopsies from individuals affected by a neurodevelopmental disorder associated with variable skeletal dysplasia and disproportionate short-limbed short stature.

  Dataset EGAD50000001723

• Bell_activation_timecourse

  We purified human naive and memory B cells from PBMCs. We stimulated them with IgM cross-linker providing BCR stimulation, multimeric CD40L that engages costimulatory receptor CD40 on the B cell, and cytokines IL-2 and IL-21. To comprehensively characterise activation dynamics of naive and memory B cells, we performed single-cell RNA sequencing (scRNA-seq) and B cell receptor sequencing (BCR-seq) in resting cells (day 0), before the first division (day 1), at the time of the first division (day 3) and following the full B cell differentiation (day 6)

  Dataset EGAD50000002115

• scRNA-seq of a 3D human cortical tissue model from human iPSCs exploring 2D versus 3D co-culturing

  Single-cell RNA-seq analysis of human iPSC-derived microglia/astrocytes/neurons in a novel, human in vitro 3D cortical tissue model, as well as 2D co-cultures for comparison. Samples include distinct conditions as described in the Study section. The dataset was generated using the BD Rhapsody technology and sequenced paired-end with Illumina NovaSeq2000. Information on the multiplexing of samples is reported in the Analyses section.

  Dataset EGAD50000002021

• mRNA-Seq on single human MII oocytes collected from gonadotropin stimulated women

  This dataset contains 11 paired-end FASTQ sequences from mRNA-Seq on single human M-II stage oocytes that were collected from gonadotropin stimulated women undergoing fertility treatments. M-II stage oocytes were collected and flash frozen prior to lysis followed by RNA extraction, full length cDNA preparation and amplification using the Ultra-low-input SMART-Seq2 v4 kit from Takara Clonetech. Further, these cDNA were used to prepare libraries for sequencing according the Nextera XT DNA library preparation kit from Illumina.

  Dataset EGAD00001006863

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Dac EGAC00001000741

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• WTS and WES of Renal Cell Carcinoma Tumors From a Phase III Anti-Angiogenic Adjuvant Therapy Trial

  Archival de-identified formalin-fixed paraffin-embedded RCC tumor tissue blocks from nephrectomy or tumor biopsy were processed as per below and the same sections were used for both DNA and RNA extractions. For WES (ACE version 3; Illumina NovaSeq), samples were profiled using Personalis ACE Cancer Exome (Personalis, Inc, Menlo Park, CA) Whole-transcriptome profiles were generated by RNA-seq (Accuracy and Content Enhanced (ACE) version 3; Illumina NovaSeq) using Personalis ACE Cancer Transcriptome (Personalis, Inc, Menlo Park, CA ) Of the 615 patients in the intent-to-treat population in S-TRAC trial, 193 individual specimens were available for molecular profiling, of which 171 (27.8%) (sunitinib, n = 91; placebo, n = 80) returned results for the WES analysis, and 133 (21.6%) (sunitinib, n = 72; placebo, n = 61) returned results for the GES analysis. Of the 138 WTS samples with data, replicates for two patients were summarized by median expression, and three samples were excluded from the final analysis due to low counts.

  Dataset EGAD00001009294

• Genetic coupling of enhancer activity and connectivity in gene expression control

  In this study, we investigated whether the genetic effects of eQTLs on enhancer activity and enhancer-promoter contacts (connectivity) are inherently coupled or distinct. To address this, we performed Capture Hi-C targeting ~1100 eQTL loci, along with ATAC-seq and RNA-seq, in monocytes from 34 healthy male donors. Using single-modality and multi-modality Bayesian statistical approaches, we demonstrated that eQTL effects are predominantly shared across enhancer activity, connectivity, and gene expression. However, we also identified a locus where an eQTL disrupts a CTCF binding site at a putative insulator, facilitating contacts between the PCK2 gene promoter and downstream enhancers. To validate these findings, we used 4C-seq to confirm the allelic effects of eQTLs on enhancer-promoter connectivity at the PCK2 locus and another eQTL region associated with THBS1 expression, both of which showed consistent eQTL effects across all three modalities. Additionally, we conducted Hi-C on monocytes from two donors to map reference TADs and performed ChIP-seq to confirm the allelic effects of the PCK2 eQTL on CTCF binding. Together, these data provide comprehensive insights into the genetic coupling of enhancer activity, connectivity, and gene expression.

  Study EGAS50000000756

• Single Cell RNA-Sequencing in Adenoid Cystic Carcinoma

  This study of salivary adenoid cystic carcinoma aimed to profile individual malignant and stromal cells in treatment-naive head and neck adenoid cystic carcinoma, with or without metastatic cervical lymph nodes. Clinical and pathologic information was collected on all patients, in addition to a fresh biopsy sample from the primary tumor and/or metastatic lymph node at the time of initial surgery. A fresh biopsy sample from a matched local recurrence was also collected for a single unique patient. Biopsy specimens were processed for single cell RNA-seq. A total of ~1,700 single cells from seven participants were included in the final dataset.

  Study phs003070

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• Onco-exaptation of an Endogenous Retroviral LTR Drives IRF5 Expression in Hodgkin Lymphoma

  The transcription factor interferon regulatory factor 5 (IRF5) is upregulated in Hodgkin lymphoma (HL) and a key regulator of the aberrant transcriptome characteristic of this disease. Here we show that IRF5 upregulation in HL is driven by transcriptional activation of a normally dormant endogenous retroviral LOR1a long terminal repeat (LTR) upstream of IRF5. Specifically, through screening of RNA-seq libraries, we detected LTR-IRF5 chimeric transcripts in multiple HL cell lines but not in normal B-cell controls. In HL, the LTR was in an open and hypomethylated epigenetic state and we further show the LTR is the site of transcriptional initiation. Among HL cell lines, usage of the LTR promoter strongly correlates with overall levels of IRF5 mRNA and protein, indicating that LTR transcriptional awakening is a major contributor to IRF5 upregulation in HL. Taken together, oncogenic IRF5 overexpression in HL is the result of a specific LTR transcriptional activation. We propose that such LTR derepression is a distinct mechanism of oncogene activation (“onco-exaptation”) and that such a mechanism warrants further investigation in molecular and cancer research.

  Study EGAS00001001205

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: LIRI-JP.

  Dataset EGAD00001003547

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: CLLE-ES.

  Dataset EGAD00001003548

• ICGC PCAWG Dataset: CLLE-ES_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: CLLE-ES.

  Dataset EGAD00001003549

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: RECA-EU.

  Dataset EGAD00001003559

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: PACA-AU.

  Dataset EGAD00001003411

• ICGC PCAWG Dataset: PACA-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: PACA-AU.

  Dataset EGAD00001003410

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: MALY-DE.

  Dataset EGAD00001003560

• ICGC PCAWG Dataset: MALY-DE_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: MALY-DE.

  Dataset EGAD00001003561

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• ICGC PCAWG Dataset: RECA-EU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: RECA-EU.

  Dataset EGAD00001003558

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_Star

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using Star. Project: OV-AU.

  Dataset EGAD00001003415

• ICGC PCAWG Dataset: OV-AU_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: OV-AU.

  Dataset EGAD00001003416

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_RNA-Seq_TopHat2

  ICGC PCAWG Dataset for RNA-Seq BAM aligned using TopHat2. Project: LIRI-JP.

  Dataset EGAD00001003546

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• The evolutionary dynamics of human colorectal cancer using single-gland spatial multi-omic profiling of DNA, RNA and chromatin.

  Deciphering the mechanisms of colorectal cancer growth, progression and dissemination in each individual patient.

  Study EGAS00001005230

• Single cell RNA sequencing of 33 primary colorectal cancer

  Study EGAS00001003779

• 1. Identidication of molecular biological mechanism associated with the development and prognosis of uterine cancer, uterine sarcoma, and endometrial hyperplasia / 2. Identification of molecular biological mechanism associated with the development of endometriosis and malignant transformation, ovarian cancer, fallopian tubal cancer, peritoneal cancer, and other malignant tumors in gynecological organs

  To identify molecular subtypes and carcinogenesis in clear cell ovarian carcinomas by whole-exome sequencing, RNA-sequencing, and methylation array, and to characterize high-grade serous carcinomas by NGS-based, integrative genomic analyses, with focus on homologous recombination deficiency, molecular subtypes and prognositic factors.

  Study JGAS000560

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• HuBMAP: Single-Cell Data from Human Tissues

  The small bowel and colon are organs critical for maintaining homeostasis of the human body by mediating nutritional absorption upon the ingestion of food. Though both organs are extensive in length, there are known differences in function and cellular heterogeneity within different portions of each. Also, a cross section anywhere in the bowel reveals a complex layering of components involved in absorption and secretion, motility of gut contents, circulation, and immunity. We are mapping the complexity of the the small bowel and colon with cell-to-cell resolution in histologic sections, both along their lengths and across multiple individuals. Our molecular data consist of single cell ATAC-seq and RNA-seq. These profiles are spatially mapped to histologic sections using CO-Detection by indEXing (CODEX), a highly multiplexed system of antibody-tagged target epitopes.

  Study phs002272

• Dysregulation of Naive T Cell Quiescence during Aging

  TEA-seq (novel trimodal single-cell analysis of mRNA transcripts, surface protein epitopes, and chromatin accessibility) was performed on CD3+ T cells isolated from peripheral blood of healthy pediatric (11–13 yrs, n = 8) and older adult (55–65 yrs, n = 8) female donors. Single-cell RNA sequencing (scRNA-seq) was additionally performed on peripheral blood mononuclear cells (PBMCs) from a healthy cohort of 16 pediatric, 16 young adult (25–35 yrs), and 16 older adult donors with equal sex distribution. Using these data, we dissected the compositional and molecular alterations within the T cell compartment across the spectrum of healthy age, showing broad transcriptional and epigenetic alterations within the T cell compartment of older adults compared to children, as well as a novel population of pediatric-specific CD8aa T cells.

  Study phs003400

• Developing Targeted Therapy for Patients with Multiple Myeloma and Gain or Amplification of Chr1q (1q+)

  Multiple myeloma (MM) frequently presents with gain or amplification of chr1q (1q+), which is associated with inferior response to treatment and poor outcomes. To develop targeted therapy for MM with 1q+, we leveraged external and in-house dependency screens and drug screens, along with single-cell sequencing of patient tumors with subclonal 1q+. We demonstrated that MM with 1q+ exhibits higher sensitivity to MCL1 and PI3K inhibitors, which may be synergistic and act through established and novel mechanisms. Two human MM cell lines with 1q+, KMS12BM and KMS11, were profiled with either single-cell RNA-sequencing (scRNA-seq) alone (KMS12BM, KMS11) or both scRNA-seq and whole-genome sequencing (WGS; KMS12BM) to understand the factors that determine response to MCL1 and PI3K inhibitors and how these inhibitors work.

  Study phs003886

• Single-Cell Atlas of Human Liver and Blood Immune Cells Across Fatty Liver Disease Stages

  The goal of the study was to investigate immunological correlates of human fatty liver disease progression. We generated a single-cell RNA-seq (scRNA-seq) atlas of immune cells from liver fine needle aspirates (FNAs) and paired peripheral blood mononuclear cells (PBMCs) from a full-spectrum Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)/Metabolic Dysfunction-Associated Steatohepatitis (MASH) human cohort, using the 3' 10X Genomics platform. Using computational analyses to assess changes in cellular frequencies and function, we found heightened immunoregulatory programs with profibrotic potential alongside a shift from antigen-specific to natural killer cytotoxic functions in the liver with MASH progression. Available data include raw single-cell transcriptomic data (FASTQ files) for each sample type (PBMC, FNA) per patient alongside clinical and histological measurements of fatty liver disease.

  Study phs004044

• Differential Presence of Exons in Cell-Free DNA Reveals Different Patterns in Colorectal Cancer Between Metastatic and Non-Metastatic Patients

  Tumor genotyping during disease follow-up is gaining an increasing interest for monitoring and clinical management in colorectal cancer (CRC). Growing evidences suggest that single biopsies are inefficient for molecular profiling, due to clonal evolution and intratumoral heterogeneity of primary tumors and/or metastasis. Circulating free DNA (cfDNA) has emerged as an alternative source of genetic material that seems to be representative of the continuously changing tumor molecular features. Thus, the so-called 'liquid biopsy' also offers the additional advantages of accessibility and non-invasiveness for the patient. Novel strategies based on next-generation sequencing (NGS) of cfDNA are being currently developed, with most studies focusing on targeted deep sequencing panels of potential clinically actionable genes. Here we describe an alternative approach, consisting of exome-sequencing in cfDNA at a relatively shallower depth to provide a more general overview of the circulating genome. In this study, two groups of colorectal cancer patients, with either disseminated (M) or localized disease (N), were compared using whole-exome sequencing and a RNA-seq bioinformatics analysis pipeline. Thus, a set of 379 exons present at different levels in cfDNA from both groups were identified, giving rise to a completely new concept in this field, termed as 'Differential Presence of Exons'. Differentially present exons (DPEs) were subsequently used for M and N patients clustering and classification, allowing for the design of a predictive algorithm with encouraging preliminary results in a small subset of patients that could not be initially classified attending to the selection criteria (U group, unassignable).

  Study EGAS00001002687

• RNA, ATAC, ChIP datasets from iPSC Derived Macrophages with and without TNFRSF1A intronic deletion using CRISPR

  This dataset consists of functional genomic data from iPSC derived Macrophages with or without CRISPR deletions and controls. It contains 21 paired end fastq files consisting of 6 total RNA-seq samples and 9 ATAC samples, for ChIP there are 2 H3K4me3 samples, 2 H3K27ac samples along with 2 paired input samples. The samples were sequenced on the Illumina HiSeq4000 amd Illumina NextSeq500 platforms.

  Dataset EGAD50000000984

• Transcriptional data of human isogenic iPSCs

  This dataset contains bulk RNA-seq data from 12 autosomally isogenic human iPSCs. Three biological replicas from XXY (sample ID 419295-7), XX (sample ID 419298-419300), XY (sample ID 419302, 419305-6), and XO (sample ID 419308, 419310, 419312) hiPSC. RNA for this dataset was collected using Trizol method, and polyA library type was implemented. The libraries were sequenced using Illumina device. The sample reads are deposited as fastq files. Analysis have been done using reference alignment to GRCh38 reference genome.

  Dataset EGAD50000001361

• Long-read single-cell RNA-seq in COVID-19

  We report the first application of long-read single-cell RNA sequencing on nasopharyngeal swabs from COVID-19 patients and healthy controls to resolve transcript-level changes across cell types. Samples were collected from three patients with moderate COVID-19, six patients with critical COVID-19, and three healthy controls. Single-cell libraries were generated using the 10x Genomics Chromium 3' protocol, producing unfragmented cDNA. Libraries were sequenced on the Oxford Nanopore Technologies PromethION platform. Basecalling was performed with Guppy (v1.6), generating a single FASTQ file per sample.

  Dataset EGAD50000001836

• Bam files from Whole exome sequencing (WES, ~50x mean read depth) of metachronous bladder tumors

  In this study we characterized genomic alterations in two to five metachronous bladder tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth and whole transcriptome RNA-seq was performed (RNA was not advalible for 4 tumors) Data provided here consist of 122 Bam files for WES (83 Tumors and 39 blood)

  Dataset EGAD00001002716

• RNAseq of human fetal pancreas development

  The dataset comprises RNA-seq information of 4 subpopulations sorted from human fetal pancreas of 3 different donors. Low input libraries were generated using the Smart-seq2 protocol after Ampure XP cleanup of the total RNA extracted from the sorted cells. Libraries were multiplexed and sequenced paired-end over 2 lanes of HiSeq4000 each. Raw data was aligned to the human genome refernence GRCh37 using STAR v2.5.1b with GENCODE v19 as transcriptome reference, and unaligned reads were folded into the final uploaded bams.

  Dataset EGAD00001004210

• The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk RNA-seq)

  RNA was isolated from purified human CD8 cells that were incubated with anti-HER2/CD3 TDB in the presence of SK-BR-3 cells. Sequencing libraries were generated and submitted for transcriptome profiling by high-throughput sequencing. Experiments were performed in triplicates for anti-HER2/CD3 TDB treatment and control. This Dataset is associated with the following ArrayExpress Experiment: E-MTAB-8211 - The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk)

  Dataset EGAD00001005187