21136 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..6Xgd"

in 84.24 milliseconds.

• Signatures of mismatch repair deficiency in cancer genomes

  DNA replication errors occurring in mismatch repair (MMR) deficient cells persist as mismatch mutations and predispose to a range of tumors. Here, we sequenced the first whole-genomes from MMR-deficient endometrial tumors.

  Dataset EGAD00001000641

• In vitro mutational load

  Clonally expanded human pluripotent and adult (liver + intestine) stem cell clones were subjected to whole genome sequencing to determine the mutational impact of in vitro culture

  Dataset EGAD00001004104

• Hepatocellular adenomas samples

  Whole exome sequencing data from 30 donors (46 tumors and 30 non-tumoral whole exome sequencing, paired-end, HiSeq 2000, Illumina) collected by the Inserm U674, PI Jessica Zucman-Rossi - Institut National du Cancer (INCa), PI Fabien Calvo, France.

  Dataset EGAD00001000737

• Human normal brain single-cell

  We profiled two human fetal brainstem specimens at 17 and 19 post-conception weeks by single-cell RNA-seq using 10X Chromium Single Cell 3'. The BAM files are provided.

  Dataset EGAD00001005128

• Whole genome sequence of intratumor heterogeneity study

  This dataset contains whole genome sequence data from 12 samples from 1 patient, including 8 tumor sectors and 4 normal samples. All the experiments were performed on Illumina HiSeq platform with raw reads stored in fastq format.

  Dataset EGAD00001005452

• 5hmC enrichment in human monocyte differentiation

  This dataset consists of 5hmC capture-seq data from human monocytes, monocyte-derived dendritic cells. It includes two biological replicates and three time points. Including controls, the dataset comprises 10 samples in total.

  Dataset EGAD00001006603

• Cam_121 RNA-Seq data

  This dataset contains RNA-Seq data from 204 primary melanomas and 177 regional lymph nodes. More details can be found in the manuscript: "Tumour gene expression signature in primary melanoma predicts long-term outcomes: A prospective multicentre study"

  Dataset EGAD00001006401

• RNA-seq assessment of the impact of fasting-mimicking diet on tumor tissue specimens from early-stage breast cancer patients

  RNA-seq data (44 samples) from tumor tissue specimens pre and post fasting-mimicking diet from 22 early-stage breast cancer patients.

  Dataset EGAD00001006860

• 6_RNAseq_NOVA1_KO_vs_wt

  iPSC-derived motor neurons from 5 NOVA1 knock out and 5 NOVA1 wt lines in the CVB background.

  Dataset EGAD00001008427

• Mutation analysis AVENIO of NSCLC patients

  Mutation analysis of 77 frequently mutated genes in NSCLC in plasma DNA and corresponding PBMCs of NSCLC patients under ICI using the AVENIO Expanded Kit.

  Dataset EGAD00001007930

• Genomic data of acute myeloid leukemia from the NGS-PTL european consortium

  Whole exome sequencing (WES) data of paired (germline and leukemic) samples of 60 adult patients affected by acute myeloid leukemia.

  Dataset EGAD00001007940

• ATAC-seq

  ATAC-seq data. Dataset includes FASTQ files, BAM files, and analysis files with the ATAC-seq peaks determined using MACS2.

  Dataset EGAD00001008962

• 9 samples variant calling data

  This dataset comprise results of mutect2 variant calling in vcf format on 9 samples of rosette forming brain tumors (5 with paired normal tissue and 4 without). Only variants specific to the tumor where kept to comply with patients consent.

  Dataset EGAD00001009266

• Characterization of Arabian Peninsula whole exomes

  We conducted whole exome sequencing (using the SureSelect Human All Exon V5 + UTRs target enrichment kit) of 90 individuals from AP (23 from Saudi Arabia, 24 from Yemen, 24 from Oman and 19 from UAE).

  Dataset EGAD00001009162

• Human tumor single-cell RNA-seq

  We profiled 16 patient tumor samples by single-cell or single-nuclei RNA-seq using 10X Chromium 3'. It includes 4 low-grade gliomas and 12 ependymomas. The raw fastqs are provided.

  Dataset EGAD00001011315

• Comprehensive investigation of genome architecture of papillary thyroid cancer with whole-exon sequencing in the Chinese population.

  In this study, we performed whole-exon sequencing (WES) of 50 paired PTC tumors and adjacent normal tissues to identify novel potential biomarkers. We extracted mutational signatures which induce somatic mutations. Moreover, we observed copy number changes frequently occurring in some cancer related genes. Our study covers a comprehensive genetic framework that can be used in clinical trials and treatment modalities in PTC.

  Study EGAS00001002402

• Patient-Parent trio sequencing for 100 sporadic ID patients

  Single end short-read (50 bp) SOLiD 4 sequencing data for 300 individuals, constituting 100 patient-parent trios. For more details please read; http://www.nejm.org/doi/full/10.1056/NEJMoa1206524

  Dataset EGAD00001000680

• DAC for Melanoma Exome Dataset for Identification of Mutated Epitopes

  Dac EGAC00001000546

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002208

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002844

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003086

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003058

• ChIP-Seq (H3K4me3, H3K4me1, H3K9me3, H3K27ac, H3K27me3, H3K36me3, Input) data for HL60 cell line generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency.

  ChIP-Seq (H3K4me3, H3K4me1, H3K9me3, H3K27ac, H3K27me3, H3K36me3, Input) data for HL60 cell line generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency.

  Dataset EGAD00001002238

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002303

• DAC for Sarcopenia HNSCC

  Data access committee for Sarcopenia HNSCC study

  Dac EGAC50000000420

• raw RNA-seq data from patients infected with COVID-19 or influenza

  Dataset consists of fastq files from bulk RNA-seq done on peripheral blood acquired from two well characterised hospitalised cohorts, a cohort of patients infected with influenza and a cohort of patients infected with SARS-CoV-2 during the first wave of the pandemic and prior to availability of COVID-19 treatments and vaccines.

  Dataset EGAD00001008505

• Distinct embryonic phylogenies and driver events of infant Wilms tumor - DNA

  Cancers of adults typically arise through progressive rounds of clonal diversification and intratumoral selective sweeps which generate a long mutational trunk with shorter subclonal branches. Here, we investigated whether tumors of young children exhibit the same phylogenetic configuration. We studied three infants, including two newborns, with the childhood kidney cancer, Wilms tumour, through whole genome sequencing of bulk tissues, of single cell derived organoids, and of microdissections. All three cancers exhibited unusual driver events, with tumours of newborns harbouring FOXR2 rearrangements, delineating a distinct variant of Wilms tumour. Phylogenetic analyses suggest that tumors were seeded in an early, possibly confined window of development. Unusually, following seeding there was extensive polyclonal diversification with little evidence of clonal sweeps, leading to a distinct phylogenetic configuration more reminiscent of normal tissues rather than of adult cancers. These findings indicate that some childhood cancers may diversify via unorthodox phylogenetic pathways.

  Dataset EGAD00001009812

• Sequencing data for oesophageal and related samples - OACs release 4 (RNA)

  Dataset EGAD00001004021

• Leukemia WGS data

  Whole-genome sequencing data from 38 leukemia patients and 12 leukemia cell lines; Containing 100 fastq files; Two files for each sample.

  Dataset EGAD00001008659

• DAC for study Screening for abnormal CGI methylation in primary colorectal tumours

  Dac EGAC00001000069

• Data Access Committee for German Consortium for Translational Cancer Research (DKTK)

  Dac EGAC00001000217

• Data Access Committee for COLO829 Somatic reference standard for cancer genome sequencing

  Dac EGAC00001000408

• ATACseq

  ATACseq data for this study.

  Study EGAS00001007166

• SNParray

  SNP array study for UTUC

  Study EGAS00001004979

• cfDNA dataset for cfDNA cohort

  Cell free DNA sequencing data for 233 samples across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000104

• Targeted sequencing analysis for MDS with HSCT

  Targeted capture sequencing for cases with MDS who were subjected to unrelated bone marrow transplantation via Japan marrow donor program

  Study EGAS00001001949

• monozygotic twin discordant for schizophrenia

  monozygotic twin discordant for schizophrenia

  Dataset EGAD00001000048

• Whole genome and RNA-sequencing in T-cell acute lymphoblastic leukemia

  Dataset includes whole genome and transcriptomic sequencing data from five T-cell acute lymphoblastic leukemia (T-ALL) patients. Whole genome sequencing has performed from both diagnostic (T-ALL sample) and control (remission sample) samples. RNA-sequencing has performed from diagnostic samples. Samples has been taken from the bone marrow or peripheral blood.

  Dataset EGAD00001008658

• Data access committee for RNA-seq as a tool for evaluating human embryo competence

  Dac EGAC00001001215

• DKFZ-St.Jude Medulloblastoma - 41 MB germline cases, exome data

  Germline exome tumor/control pairs for 41 medulloblastoma cases, MBG cohort sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006658

• DKFZ-St.Jude Medulloblastoma - 70 PAN-GATC control exomes

  Exome controls for 70 individuals, PAN-GATC cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006661

• Dataset for breast_cancer-WHOLE_GENOME

  Rare cancer sequencing data of 12 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008867

• Dataset for cancer_of_unknown_primary-WHOLE_GENOME

  Rare cancer sequencing data of 46 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008869

• Dataset for synovial_sarcoma-WHOLE_GENOME

  Rare cancer sequencing data of 6 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008899

• APL nanopore sequencing

  Nanopore sequencing for an APL patient

  Study EGAS00001005618

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Acute Myeloid Leukemia peripheral blood ATAC data

  ATAC-seq was used to profile the accessible chromatin landscape of 29 (12 LSC17 high, 17 LSC17 low) peripheral blood AML bulk samples. 50,000 cells from each sample were processed and libraries were sequenced with 50 bp paired-end reads.

  Dataset EGAD00001006776

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Longitudinal tracking of CRC patients

  Heatrich-BS was performed on 14 patients monitored across 5-8 timepoints each. The predicted tumor fraction trend was compared with CEA values and tumor measurements from CT scans.

  Dataset EGAD00001008714

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• Single cell RNA-sequencing (scRNA-seq) of the human hematopoietic stem cell compartment (CD34+CD38-CD45RA-)

  To identify a trajectory of human hematopoietic stem cell (HSC) activation single cell gene expression profiling of RNA from human HSC was performed by flow cytometry-based single cell deposition of CD34+CD38—CD45RA—cells from G-CSF-mobilized peripheral blood from 3 individual donors and 1 bone marrow donor in concert with single cell index-sorting (signals indexed: CD34, CD38, CD45RA, CD90, CD49f) and followed by SMARTseq2 based protocol. We show that INKA1 and CDK6/PAK4 expressing single cells segregate across alternative states of quiescence.

  Study EGAS00001004769

• Longitudinal multi-omics support immunotrhrombosis as the molecular force behind increased post-acute complication risk

  Whole blood transcriptome profiles in severe COVID-19 patients (n=81) across three timepoints: A) 1st day of hospital admission, B) one month (38.46 ± 12.89 days) post-hospitalization, and C) three months post-infection (96.29 ± 13.81 days post-hospitalization). 62 patients had blood collected at all three timepoints (19 patients have transcriptome data from two timepoints (acute phase (timepoint A) and recovery phase (timepoint B or C)), 224 blood transcriptomes in total.

  Study EGAS50000001430

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003606

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003612

• Genome and transcriptome sequence data from an adenocarcimona of the lung patient

  Genome and transcriptome sequence data from an adenocarcimona of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003616

• Genome and transcriptome sequence data from a mucinous colloid carcinoma of the pancreas patient

  Genome and transcriptome sequence data from a mucinous colloid carcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004598

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004627

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004619

• Genome and transcriptome sequence data from a metastatic mmmt of the endometrium patient

  Genome and transcriptome sequence data from a metastatic mmmt of the endometrium patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004618

• Genome and transcriptome sequence data from a ganglioglioma of the left temporal lobe patient

  Genome and transcriptome sequence data from a ganglioglioma of the left temporal lobe patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004615

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004634

• Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the breast patient

  Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the breast patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004921

• Genome and transcriptome sequence data from a squamous cell carcinoma of the alveolar ridge patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the alveolar ridge patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004934

• Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx tumor patient

  Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015307

• Deep_sequencing_of_melanoma_for_driver_mutations

  Deep sequencing of melanoma for driver mutations

  Study EGAS00001000857

• Single-nucleus Transcriptome of Down Syndrome Brains (short-read)

  29 DS and Control brain samples were prepared using the 10X Genomics Single Cell 3' v3 kit. The cDNA libraries were sequenced on an Illumina Novaseq 6000.

  Dataset EGAD00001008287

• Whole-exome sequencing laser capture micro-dissected biopsies of human renal cell carcinoma

  The dataset comprises whole exome sequences from laser capture micro-dissected biopsies of 10 patients diagnosed with clear cell renal cell carcinoma. In total over 100 regions are sampled to allow 'focally exhaustive' sequencing and explore the limits of intra-tumoural heterogeneity.

  Dataset EGAD00001008029

• Concatenated long-read single-cell RNA sequencing of momentum biopsies of ovarian cancer patients

  Concatenated long-read single-cell RNA sequencing samples prepared using 10X and the HIT-scIsoSeq protocol. The sequencing was performed on Sequel II Pacbio machine. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 bam files per metastasis sample, 2 bam files per healthy sample.

  Dataset EGAD00001009814

• snRNA-seq BAM files from 10x Multiome profiling of human fetal liver hematopoiesis

  This dataset provides snRNA-seq BAM files from a single-nucleus multiome study of 53 human fetal liver samples (5–18 post-conception weeks). Live CD45+CD235- cells were sorted from dissociated tissue, and isolated nuclei were processed using the Chromium Next GEM Single Cell Multiome ATAC + Gene Expression kit. Raw sequencing data were processed and aligned to GRCh38-2020-A-2.0.0 using Cell Ranger ARC v2.0.2.

  Dataset EGAD50000002337

• Genome and transcriptome sequence data from a metastatic colorectal carcinoma patient

  Genome and transcriptome sequence data from a metastatic colorectal carcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001307

• Genome and transcriptome sequence data from a primary unknown cancer patient

  Genome and transcriptome sequence data from a primary unknown cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001308

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002534

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002531

• Genome and transcriptome sequence data from an ovarian cancer patient

  Genome and transcriptome sequence data from an ovarian cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002533

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002532

• Genome and transcriptome sequence data from a uterine sarcoma patient

  Genome and transcriptome sequence data from a uterine sarcoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002538

• Genome and transcriptome sequence data from a cholangiocarcinoma patient

  Genome and transcriptome sequence data from a cholangiocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002537

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002536

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002535

• Targeted gene panel sequencing of matched diagnosis-remission-relapse B cell precursor acute lymphoblastic leukemia samples

  Bone marrow mononuclear cells from patients diagnosed with B cell precursor acute lymphoblastic leukemia were obtained at three sequential time points: first diagnosis, remission after chemotherapy and relapse. Genomic DNA was isolated and targeted gene panel sequencing was performed using a customized biotinylated RNA oligo pool (SureSelect, Agilent, Santa Clara, California) to hybridize the target regions comprising 362 kbp on a HiSeq2000. Target regions were selected to validate mutations previously identified in these samples using whole exome sequencing.

  Dataset EGAD00001004977

• Genomic profiling of Follicular thyroid adenomas and carcinomas using exome-sequencing analyses

  This dataset was conceived to characterize the genomic differences among different types of follicular-like thyroid lesions. To do so, we performed whole exome sequencing experiments on human biopsies corresponding to nodular hyperplasias, follicular thyroid adenomas, follicular thyroid carcinomas and Follicular Variant Thyroid Gland Papillary Carcinomas.

  Dataset EGAD00001008022

• Candidate diagnostic variants reported into DECIPHER, Wright NEJM 2023

  Candidate diagnostic variants reported into DECIPHER by 4 April 2022, annotated with clinical and automated pathogenicity assertions (see DOI: 10.1056/NEJMoa2209046). Genomic Diagnosis of Rare Pediatric Disease in the United Kingdom and Ireland, Wright et al, NEJM 2023.

  Dataset EGAD00001010137

• Development of Computational Approaches for Cell Hashing in scRNA-Seq

  As a test of cell overloading after cell hashing, a sample of peripheral blood mononuclear cells (PBMC) from a single subject was separated into naive T cells, memory T cells, and non-T cell PBMC populations using fluorescence activated cell sorting (FACS). Each population was separated into two technical replicates, then stained with BioLegend TotalSeq-A antibodies. All 6 samples were pooled, then loaded into 6 wells of a 10X Genomics Chromium 3' RNA-seq v3 chip at increasing cell counts: 16,000 (k), 24k, 32k, 48k, 64, and 80k cells per well. We also included a single sample that was not hashed or pooled, as well as a single sample that was stained with hashing antibodies, but not pooled in two separate wells.

  Study phs002695

• BLUEPRINT September 2016, ATAC-seq for osteoclast from venous blood, on Genome GRCh38

  ATAC-seq data for 2 sample(s) for osteoclast from venous blood, on Genome GRCh38. 2 run(s), 2 experiment(s), 2 alignment(s). Part of BLUEPRINT (September 2016).

  Dataset EGAD00001002907

• BLUEPRINT September 2016, ATAC-seq Multiple Myeloma for plasma cell from bone marrow, on Genome GRCh38

  ATAC-seq data for 4 sample(s) Multiple Myeloma for plasma cell from bone marrow, on Genome GRCh38. 4 run(s), 4 experiment(s), 4 alignment(s). Part of BLUEPRINT (September 2016).

  Dataset EGAD00001002920

• BLUEPRINT September 2016, ATAC-seq for plasma cell from tonsil, on Genome GRCh38

  ATAC-seq data for 2 sample(s) for plasma cell from tonsil, on Genome GRCh38. 2 run(s), 2 experiment(s), 2 alignment(s). Part of BLUEPRINT (September 2016).

  Dataset EGAD00001002912

• BLUEPRINT September 2016, ATAC-seq for naive B cell from tonsil, on Genome GRCh38

  ATAC-seq data for 3 sample(s) for naive B cell from tonsil, on Genome GRCh38. 3 run(s), 3 experiment(s), 3 alignment(s). Part of BLUEPRINT (September 2016).

  Dataset EGAD00001002903

• WGS minibam files for SJLIFE

  WGS minibam files for SJLIFE

  Dataset EGAD00001003396

• dataset for BGI bladder cancer project

  dataset for BGI bladder cancer project

  Dataset EGAD00001000758

• KiCS WGS data for academic and for-profit use

  Data from samples that are marked for both academic and for-profit use.

  Dataset EGAD00001009699

• IYDP Indonesian Y chromosome Diversity Project

  The IYDP dataset includes BAM files of 126 Y chromosomes extracted from whole genome sequences. These are from individuals from a broad range of Indonesian islands - communities close to mainland Asia through to New Guinea. The original whole genome sequencing libraries were prepared using TruSeq DNA PCR-Free and TruSeq Nano DNA HT kits depending on DNA quantity. 150 bp paired-end sequencing was performed on the Illumina HiSeq X sequencer. Individuals were sequenced to expected mean depth of 30x, with an achieved median depth of raw reads across samples of 43x.

  Dataset EGAD00001008573