21136 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..6Xgd"

in 273.05 milliseconds.

• RNA-seq data from primary AML samples with t(3;8)

  RNA-seq was generated to investigate differences in gene expression between t(3;8) AML and other primary AMLs. Briefly, sample libraries were prepared using 500 ng of input RNA according to the KAPA RNA HyperPrep Kit with RiboErase (HMR) (Roche) using Unique Dual Index adapters (Integrated DNA Technologies, Inc.). Amplified sample libraries were paired-end sequenced (2x100 bp) on the Novaseq 6000 platform (Illumina

  Dataset EGAD00001006819

• VRK3 depletion in Pontine Diffuse Midline Glioma DMG-K27 altered cells

  In order to investigate possible mechanisms underlying the phenotype of cell fitness decline observed following decrease of VRK3 in pontine DMG-K27 altered cells 7, we examined differences in global gene expression. RNA-seq was performed 44h and 60h post-transduction with two distinct shRNAs targeting VRK3 to be able to evaluate the early impact of VRK3 knock-down (KD) in four independent in vitro models of DMG

  Dataset EGAD00001010097

• Distinct embryonic phylogenies and driver events of infant Wilms tumor - RNA

  Cancers of adults typically arise through progressive rounds of clonal diversification and intratumoral selective sweeps which generate a long mutational trunk with shorter subclonal branches. Here, we investigated whether tumors of young children exhibit the same phylogenetic configuration. We studied three infants, including two newborns, with the childhood kidney cancer, Wilms tumour, through whole genome sequencing of bulk tissues, of single cell derived organoids, and of microdissections. All three cancers exhibited unusual driver events, with tumours of newborns harbouring FOXR2 rearrangements, delineating a distinct variant of Wilms tumour. Phylogenetic analyses suggest that tumors were seeded in an early, possibly confined window of development. Unusually, following seeding there was extensive polyclonal diversification with little evidence of clonal sweeps, leading to a distinct phylogenetic configuration more reminiscent of normal tissues rather than of adult cancers. These findings indicate that some childhood cancers may diversify via unorthodox phylogenetic pathways.

  Dataset EGAD00001009813

• BLUEPRINT EpiVar RNA-seq for Naive naive CD4+ T-cells

  BLUEPRINT EpiVar RNA-seq for Naive naive CD4+ T-cells

  Study EGAS00001000752

• Fragment ends of circulating microbial DNA as signatures for infectious diseases

  Fragment ends of circulating microbial DNA as signatures for infectious diseases

  Study EGAS00001006321

• RNA-seq of granulosa cells from 8 IVF patients in two age groups

  This dataset contains raw sequencing data of mRNA from granulosa cell samples from 8 human patients undergoing in vitro fertilization. All patients were normal responders referred for male infertility and were grouped into two age groups (younger than 31 or older than 38 years old). Each sample contains all granulosa cells collected from one patient on one collection date. Raw sequencing fastq files are available in this dataset, count tables are available in ArrayExpress (E-MTAB-13496).

  Dataset EGAD50000001210

• Sequencing data for oesophageal and related samples - BOs release 4 (RNA)

  Dataset EGAD00001004023

• Sequencing data for oesophageal and related samples - Mourikis et al (WGS)

  Data supporting: "Patient-specific detection of cancer genes reveals recurrently perturbed processes in esophageal adenocarcinoma." Mourikis et al. WGS (BAM files) 521 samples

  Dataset EGAD00001004775

• RNA of peripheral blood for pancreatic cancer and chronic pancreatitis

  Samples of nucleated cells found in peripheral blood from over 300 patients suffering from resectable pancreatic ductal adenocarcinoma, non-resectable pancreatic cancer, chronic pancreatitis, or none of these. Please cite this article when using data: Al-Fatlawi, A.; Malekian, N.; García, S.; Henschel, A.; Kim, I.; Dahl, A.; Jahnke, B.; Bailey, P.; Bolz, S.N.; Poetsch, A.R.; Mahler, S.; Grützmann, R.; Pilarsky, C.; Schroeder, M. Deep Learning Improves Pancreatic Cancer Diagnosis Using RNA-Based Variants. Cancers 2021, 13, 2654. https://doi.org/10.3390/cancers13112654

  Dataset EGAD00001006915

• CHILD Study Dataset

  This data set contains the CRAM files for the samples in the CHILD cohort, sequenced on the Illumina HiSeq X platform.

  Dataset EGAD00001009710

• Dataset for COPD human sputum 16S rRNA gene sequencing data

  Dataset for 16S rRNA gene sequencing data for sputum samples 61 COPD patients, generated using PacBio sequencing technology.

  Dataset EGAD00001009103

• WTCCC case-control study for Multiple Sclerosis - Combined controls

  WTCCC genome-wide accosication study for Multiple Sclerosis (MS) - Combined controls

  Study EGAS00000000023

• Container Study for ICGC Malignant Lymphoma Master Study (MMML)

  Master Container Study for Malignant Lymphoma data (ICGC - Germany)

  Study EGAS00001001600

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• Exome and RNA sequencing of pancreatic cancer biopsies and PDX models

  Pancreatic cancer biopsies and matching normal controls from 10 patients were exome sequenced. The same biopsies and PDX models derived from these were also subject to RNA sequencing.

  Dataset EGAD00001008113

• DIS3 licenses B cells for physiological plasma cell differentiation in humans

  DIS3 licenses B cells for physiological plasma cell differentiation in humans

  Study EGAS50000000853

• Single-cell transcriptional mapping reveals genetic and hierarchy-based determinants of aberrant differentiation in AML

  Therapeutic targeting of acute myeloid leukemia (AML) has in part been hampered by profound cell state heterogeneity among leukemia cells. To develop a more precise understanding of leukemia cell states in AML, we constructed a reference atlas of human hematopoiesis from 263,519 single cell transcriptomes spanning 55 cellular states. Using this atlas, we mapped over 1.2 million single-cell transcriptomes spanning 318 myeloid leukemia samples. This uncovered twelve recurrent patterns of aberrant differentiation in AML and additional leukemia cell states involving lymphoid and erythroid progenitors. Systematic mapping of genotype-to-phenotype associations revealed specific differentiation landscapes associated with >45 genetic drivers. Importantly, AML samples sharing common genetic driver alterations can have distinct cellular origins which inform the cellular identity of their disease-sustaining leukemia stem cell (LSC). Further, distinct LSC-driven hierarchies can co-exist within individual patients. Thus, precise mapping of malignant cell states provides insights into leukemogenesis, refines disease classification, and informs therapy development.

  Study EGAS50000000918

• RNAseq metadata

  Meta-data/patient information for the bulk RNAseq data

  Dataset EGAD00001008815

• WTCCC case-control study for Breast cancer - Combined Controls

  WTCCC genome-wide case-control association study for Breast cancer (BC) - Combined Controls.

  Study EGAS00000000025

• cfDNA dataset with expanded panel for cfDNA cohort

  Cell free DNA sequencing data for 9 samples with expanded panel across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000667

• PPGL RNA-Seq dataset 2

  Dataset includes fastq files for RNA-Seq experiments for tumor samples of PPGL patients. Single end reads fastq files are available for 81 different samples

  Dataset EGAD50000000019

• Genome and transcriptome sequence data from a metastatic high-grade adenocarcinoma of the fallopian tubes patient

  Genome and transcriptome sequence data from a metastatic high-grade adenocarcinoma of the fallopian tubes patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004709

• Genome and transcriptome sequence data from a metastatic sarcomatoid carcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic sarcomatoid carcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004933

• Esophageal adenocarcinoma plasma cfDNA samples - PERFECT cohort and nCRT cohort

  The dataset contains 295 plasma cfDNA samples from various stages of resectable esophageal adenocarcinoma from the PERFECT cohort and the nCRT cohort. Shallow WGS was performed on an Illumina Novaseq S4 PE150bp. Samples are provided as raw reads without any prior processing.

  Dataset EGAD00001008316

• DAC: LUMC NeuroD AON off target analysis

  In this study, we used three different splice-switching AONs targeting three different human transcripts to study their transcriptome-wide, hybridization-dependent off-target effects with short read RNAseq. Using the computational tools rMATS and Whippet, in control human induced pluripotent stem cells

  Dac EGAC50000000726

• scRNAseq data of primary and metastatic melanoma samples

  Paired-end 10x single-cell RNA sequencing data from 13 melanoma samples. Sequencing was performed on the Illumina NovaSeq 6000 using 10xGenomics Chromium Next GEM Single-Cell 5 Reagent Kits v2.

  Dataset EGAD50000000665

• 200PT : CNA vcf files

  200PT : CNA vcf files. Copy Number Abberation calls generated using TITAN and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004073

• Her2 BC WGS dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001334

• BAM files

  DNA sequencing reads of human adult stem cell cultures from liver, colon and small intestine. Including biopsy or blood samples of the donors.

  Dataset EGAD00001001900

• Triple Negative Breast Cancer RNA Sequencing

  We propose to definitively characterise the somatic genetics of triple negative breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000390

• An Interim Report on the Investigator-initiated Phase 2 Study of Pembrolizumab Immunological Response Evaluation (INSPIRE)

  Whole exome sequencing BAM files of 50 metastatic solid tumour and matched blood germline DNA prior to pembrolizumab treatment.

  Dataset EGAD00001004873

• Whole genome sequence of Primary-recurrent HCC study

  This dataset contains whole genome sequence data from 24 samples, including 16 tumors and 8 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005451

• mt-scATAC-seq data and analysis

  Data and analysis of mt-scATAC-seq assay of Lin- CD34+ sorted live cells from bone marrow tissue of 4 patients with AML (before treatment with decitabine). Data files are paired-end reads in FASTQ format from the NextSeq 2000 sequencer. Analysis files are outputs from Cellranger ATAC: .h5 peak matrix file, atac_fragments.tsv.gz file and its index.

  Dataset EGAD50000001375

• RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells

  RNAseq on 20 samples of multiple myeloma patients and 3 normal plasma cells. RNAseq was performed using 200 ng of total RNA by GATC Biotech. Directional libraries were performed after mRNA selection by polyA selection using UTP method. RNA-seq libraries were sequenced on HiSeq2500 Illumina machine using 100bp paired-end reads. Reads alignment was performed using the STAR aligner (version 2.4.0f1) and human genome hg19 as reference.

  Dataset EGAD00001007813

• Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Dataset EGAD00001012638

• cfDNA dataset with whole genome sequencing for cfDNA cohort

  Cell free DNA sequencing data for 13samples with whole genome sequencing across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000666

• RNASeq files for Klco PanAML data

  RNASeq files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011294

• WGS files for Klco PanAML data

  WGS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011295

• WXS files for Klco PanAML data

  WXS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011296

• RNASeq files for Stewart-MATCH

  RNASeq files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015475

• WXS files for MATCH paper

  WXS files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015484

• Fecal WMS HV sequencing data

  Fecal WMS data from NCT02749630 healthy volunteers. Stool samples were collected at screening as well as on days 29, 43, and 64 and prepared for whole metagenomic sequencing.

  Dataset EGAD00001008841

• Single-Cell and Bulk RNA Sequencing of Oncolytic Measles Virus Treatment in Pediatric Medulloblastoma and ATRT

  This dataset includes single-cell RNA sequencing profiles from five mice bearing Group 3 medulloblastoma (CSCG) treated with oncolytic measles virus (MV-NIS) and three mice treated with MV-NIS combined with anti-PD1 therapy. Additionally, bulk RNA sequencing data were generated from 12 samples across PBS control, heat-inactivated (HI) control, MV mid-treatment, and treatment resistance conditions. Pediatric patient data were collected from the PNOC005 trial, which enrolled patients into three strata: Stratum A (focal recurrence, local MV-NIS administration post-surgical resection), Stratum B (disseminated recurrence, single MV-NIS dose via lumbar puncture), and Stratum C (disseminated recurrence, two consecutive MV-NIS doses via lumbar puncture on Day 0 and Day 7). Whole blood and PBMC samples were collected from 17 patients across all strata, generating 72 bulk RNA-seq datasets at multiple time points. All datasets are provided as raw sequencing data in FASTQ format.

  Dataset EGAD50000001197

• WTCCC case-control study for Ankylosing Spondylitis - Combined Controls

  WTCCC genome-wide case-control association study for Ankylosing Spondylitis (AS) - Combined Controls.

  Study EGAS00000000019

• WTCCC case-control study for Autoimmune Thyroid Disease - Combined Controls

  WTCCC genome-wide case-control association study for Autoimmune Thyroid Disease (ATD) - Combined Controls.

  Study EGAS00000000021

• Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Study EGAS00001003876

• Mutational landscape and patterns of clonal evolution in relapsed pediatric acute lymphoblastic leukemia

  Relapse of acute lymphoblastic leukemia (ALL) remains a leading cause of childhood death. Prior studies have shown clonal mutations at relapse often arise from relapse-fated subclones that exist at diagnosis. However, the genomic landscape, evolutionary trajectories and mutational mechanisms driving relapse are incompletely understood. In an analysis of 92 cases of relapsed childhood ALL, incorporating multimodal DNA and RNA sequencing, deep digital mutational tracking and xenografting to formally define clonal structure, we identify 50 significant targets of mutation with distinct patterns of mutational acquisition or enrichment. CREBBP, NOTCH1, and Ras signaling mutations rose from diagnosis subclones, whereas variants in NCOR2, USH2A and NT5C2 were exclusively observed at relapse. Evolutionary modeling and xenografting demonstrated that relapse-fated clones were minor (50%), major (27%) or multiclonal (18%) at diagnosis. Putative second leukemias, including those with lineage shift, were shown to most commonly represent relapse from an ancestral clone rather than a truly independent second primary leukemia. A subset of leukemias prone to repeated relapse exhibited hypermutation driven by at least three distinct mutational processes, resulting in heightened neoepitope burden and potential vulnerability to immunotherapy. Finally, relapse-driving sequence mutations were detected prior to relapse using deep digital PCR at levels comparable to orthogonal approaches to monitor levels of measurable residual disease. These results provide a genomic framework to anticipate and circumvent relapse by earlier detection and targeting of relapse-fated clones.

  Study EGAS00001003975

• WES_dataset2

  Twenty-six EATLs and 22 additional cases of MEITLs (among which 5 had only tumoral tissue available) were sequenced using the xgen research panels v1.0 and v2.0 from IDT DNA (Newark, New Jersey, USA).

  Dataset EGAD50000001621

• Indonesian Genome Diversity Project 3

  Low coverage whole genome sequences (1-3x) were collected to study human genetic history across Wallacea archipelago and West Papuan Region of Indonesia . We collected 254 newly sequenced genomes mostly from previously undocumented populations including 9 communities in Wallacea and 3 in West Papuan regions. Out of 254, there are 8 high coverage whole genome sequences were produce in the study (L4).

  Dataset EGAD50000000647

• Comparison clinical recommendation MASTER and panel sequencing: RNA data

  This dataset contains 19 case/control samples of RNA sequencing data. Sequencing was performed on Illumina HiSeq 4000 and NovaSeq 6000 using TruSeq Stranded mRNA Kit. The sequencing was always paired.

  Dataset EGAD50000000625

• Genome and transcriptome sequence data from an appendix cancer patient

  Genome and transcriptome sequence data from an appendix cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001309

• Genome and transcriptome sequence data from a peritoneal mesothelioma patient

  Genome and transcriptome sequence data from a peritoneal mesothelioma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001310

• Genome and transcriptome sequence data from a peritoneal mesothelioma patient

  Genome and transcriptome sequence data from a peritoneal mesothelioma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001311

• Genome and transcriptome sequence data from an atypical teratoid rhabdoid tumor patient

  Genome and transcriptome sequence data from an atypical teratoid rhabdoid tumor patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001655

• Genome and transcriptome sequence data from an atypical chronic lymphocytic leukemia patient

  Genome and transcriptome sequence data from an atypical chronic lymphocytic leukemia patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001656

• Genome and transcriptome sequence data from a parotid gland cancer patient

  Genome and transcriptome sequence data from a parotid gland cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001657

• Genome and transcriptome sequence data from an odontogenic ghost cell carcinoma patient

  Genome and transcriptome sequence data from an odontogenic ghost cell carcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001658

• Trimmed bam-files from whole genome sequencing data from plasma DNA

  Single-end sequencing data (trimmed to 60bp) of 104 plasma samples from donors without tumors (male=50; female=54) were merged and used to establish coverage profiles around the TSS and to establish a gene expression prediction algorithm. Dataset includes merged alignements of low coverage whole genome sequencing from plasma DNA from 50 male, 54 female non-cancer donors. Furthermore, 2 patients with metastasized breast cancer were sequenced on a NextSeq with higher depth.

  Dataset EGAD00001002254

• Genome and transcriptome sequence data from a locally advanced breast cancer patient

  Genome and transcriptome sequence data from a locally advanced breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004897

• Genome and transcriptome sequence data from a metastatic rectal carcinoma patient

  Genome and transcriptome sequence data from a metastatic rectal carcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004898

• Genome and transcriptome sequence data from a invasive ductal carcinoma of right breast patient

  Genome and transcriptome sequence data from a invasive ductal carcinoma of right breast patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004899

• Genome and transcriptome sequence data from a metastatic pancreatic cancer patient

  Genome and transcriptome sequence data from a metastatic pancreatic cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004900

• Indonesian RNA-seq dataset

  This dataset contains 4 batches of Indonesian RNA-seq data from Mentawai, New Guinea and Sumba islands. One RNA-seq batch was prepared without Globin depletion, and three batches were Globin depleted using the Illumina Globin-Zero Gold Kit. There are 179 runs in total, including 119 unique samples. Dataset includes multiple batch control samples.

  Dataset EGAD00001005053

• Chromatin accessibility analysis of hepatocyte-like cell in vitro differentiation from iPSC in comparison to primary human hepatocytes

  Fastq files of ATAC-seq data of induced pluripotent stem cells (iPSC), definitive endoderm (DE), hepatocyte-like cells (HLC) and primary human hepatocytes (PHH). The dataset comprises data from two different in vitro differentiation protocols: Cellartis (Takara Bio, "CEL", n = 4) and as described by Wang et al. (PMID: 28287600, "HAY", n = 1), as well as from 3 PHH donors.

  Dataset EGAD00001005934

• Single cell transcriptomes of in vitro differentiated hepatocyte-like cells in comparison to primary human hepatocytes

  Fastq files of deeply sequenced single cell RNA-seq data (Smartseq2, approx. 2 million reads / sample) of hepatocyte-like cells (HLC) and primary human hepatocytes (PHH). The dataset comprises data from two different in vitro differentiation protocols: Cellartis (Takara Bio, "CEL", n = 3) and as described by Wang et al. (PMID: 28287600, "HAY", n = 1), as well as PHH from 3 donors. Each replicate comprises 96 single cells.

  Dataset EGAD00001005946

• Next Generation Sequencing Characterization of Tregs in Human Peripheral Blood during Autoimmunity

  Tregs were sorted as CD4+CD25+CD127- cells from peripheral blood of 14 healthy individuals, 8 patients with mild/severe rheumatoid arthritis, 1 patient with systemic lupus erythematosus/rheumatoid arthritis, 2 patients with ulcerative colitis and 2 patients with Chrohn's disease. RNA was extracted and polyA libraries were prepared using the Illumina Truseq sample preparation kit v.2. Single-end 75bp sequencing was performed on NextSeq500.

  Dataset EGAD00001005446

• Whole transcriptome profiling of liquid biopsies from tumour xenografted mouse models enables specific monitoring of tumour-derived extracellular RNA

  Total RNA sequencing (SMARTer Stranded Total RNA-Seq Kit v2) data of extracellular RNA (exRNA) from liquid biopsies of a BRC0004PR PDX and SK-N-BE(2C) CDX mouse model, and total RNA sequencing profiles of the matching PDX tumors.

  Dataset EGAD00001008318

• Genome and transcriptome sequence data from a poorly differentiated chordoma of C1-C2 spine patient

  Genome and transcriptome sequence data from a poorly differentiated chordoma of C1-C2 spine patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001008012

• Genome and transcriptome sequence data from a metastatic pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a metastatic pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010316

• Genome and transcriptome sequence data from a pancreatic ductal adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic ductal adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010317

• Comprehensive single-cell genome analysis at nucleotide resolution using the PTA Analysis Toolbox

  Whole genome sequencing data of 57 single (PTA), clonally expanded and bulk human cells. Cells were obtained from bone marrow samples of patients with Fanconi Anemia (PMCFANCNN) or pediatric AML (PBNNNNN), from a clonal intestinal organoid line (STE0072/D-ORGWTNISL), from human cord blood (PMCCB15) and from a human lymphoblastoid cell line (PMCAHH1). WGS libraries were sequenced to ~15-30x genomic coverage (paired-end) on an Illumina Novaseq.

  Dataset EGAD00001011126

• Genetic Effects on miRNA Expression During Mid-Gestation Neocortical Development

  In this study we aimed to find common genetic variants that influence miRNA expression during mid-gestation neocortical development. Small RNA-sequencing from 212 fetal cortical tissue samples between 14 and 21 weeks gestation were used to profile miRNA expression. Combined with donor genotypes, we were able to find miRNA-eQTLs during neocortical development. The dataset provided here includes 212 Small RNA-sequencing files in FASTQ format from cortical wall samples. Also provided here are 212 donor genotypes in PLINK format (hg19).

  Study phs003106

• Transcriptome analysis of human iPSC-derived microglia in a novel human 3D cortical tissue model

  scRNA-seq analysis of human iPSC-derived microglia in a novel, human in vitro 3D cortical tissue model. Samples include three distinct conditions (each as biological duplicates): wild-type microglia extracted from cultures after 1 month (WT_1mo) and 3 months (WT_3mo) of culturing, as well as knock-in microglia extracted from cultures carrying three familial AD mutations in the APP gene (Swedish, Iberian, Arctic; introduced by CRISPR/Cas9-mediated knock-in) after 3 months of culturing (KI_3mo).

  Study EGAS50000000469

• We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas.

  Schwannomas are common peripheral nerve sheath tumors that can cause significant debilitating morbidities. We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas. Exome sequence analysis with validation by targeted DNA-sequencing of 125 samples uncovered, in addition to expected NF2 disruption additional recurrent mutations. RNA sequencing identified a recurrent in-frame SH3PXD2A-HTRA1 fusion in 12/125 (10%) cases, and genomic analysis demonstrated the mechanism as resulting from a balanced 19Mb chromosomal inversion on chromosome 10q.

  Study EGAS00001001886

• Targeted sequencing of Human esophageal epithelium microbiopsies

  NOTCH1 mutant clones occupy the majority of normal human esophagus by middle age, but are comparatively rare in esophageal cancers, suggesting NOTCH1 mutations may promote clonal expansion but impede carcinogenesis. Here we test this hypothesis. Visualizing and sequencing NOTCH1 mutant clones in aging normal human esophagus, reveals frequent biallelic mutations that block NOTCH1 signaling.  In mouse esophagus, heterozygous Notch1 mutation confers a competitive advantage over wild type cells, an effect enhanced by loss of the second allele.  Notch1 loss alters transcription but has minimal effects on epithelial structure and cell dynamics. In a carcinogenesis model, Notch1 mutations were less prevalent in tumors than normal epithelium. Deletion of Notch1 reduced tumor growth, an effect recapitulated by anti-NOTCH1 antibody treatment.  We conclude that Notch1 mutations in normal epithelium are beneficial as wild type Notch1 promotes tumor expansion. NOTCH1 blockade has therapeutic potential in esophageal squamous tumors.

  Dataset EGAD00001006969

• Targeted sequencing of vascular malformations tissues and paired blood samples

  In recent years, it has been clarified that various vascular malformations are caused by gene mutations. However, there remain vascular malformations of unknown etiology. In the present study, we investigated somatic mutations of three types of vascular malformations to identify novel gene mutations involved in their pathogenesis.

  Study JGAS000325

• Single-nucleus RNA sequencing (snRNA-seq) of seven human diffuse midline glioma (DMG) patient tumour samples.

  This dataset comprises 7 paired (14 total) FASTQ files of single-nucleus RNA sequencing (snRNA-seq) data generated from seven human diffuse midline glioma (DMG) patient tumour samples. snRNA-seq libraries were generated using the 10X Chromium Controller and Chromium Next GEM Single Cell 3’ kit version 3.1 in line with the manufacturer’s instructions. Generated libraries were sequenced on an Illumina NextSeq 2000 (P3 XLEAP-SBS chemistry) at targeted 20,000 reads per nucleus.

  Dataset EGAD50000002514

• RNA sequencing of tumor samples from patients with BPLL

  RNA-Seq was performed on 12 samples of sorted CD19+ tumor cells. RNA-Seq libraries were prepared using the SureSelect Automated Strand Specific RNA Library Preparation Kit as per manufacturer’s instructions (Agilent technologies) and subjected to paired-end (2 x 100 bp) sequencing on HiSeq2000 (Illumina). The files are in FASTQ format.

  Dataset EGAD00001004412

• Molecular profiling of DLBCL patients treated in the PETAL trial

  Shallow whole genome sequencing and targeted sequencing of DLBCL patients treated in the PETAL trial

  Dataset EGAD00001008386

• The Pathogenesis and Genetics of Disseminated Coccidioidomycosis

  Whole exome sequencing on patients > 2 years of age with confirmed disseminated coccidioidomycosis, not undergoing active immunosuppressive therapy, negative HIV status. 

  Study phs002881

• NHLBI TOPMed: Characterizing the Response to a Leukotriene Receptor Antagonist and an Inhaled Corticosteroid (CLIC)

  Within-subject clinical responses to either inhaled corticosteroids or Montelukast were compared in 126 children with mild to moderate asthma.

  Study phs001729

• bulk RNAseq from metastatic uveal melanoma tumour biopsies

  Tumour biopsies were obtained from uveal melanoma patients (n = 35) pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Dac EGAC50000000519

• Sutherland Nine Raw Sequencing Data

  These Fastq-files contain the raw sequencing output from our two sequencing experiments (Shotgun and Capture). All libraries with "*SG*" refer to Shotgun genomes, while all files containing "*TF*" refer to 1240K capture data.

  Dataset EGAD50000001417

• Active-Seq of CRC patients

  This dataset contains 48 fastq files of samples derived from CRC patients, including colorectal cancer tissue, normal adjacent tissue and cfDNA samples, processed with the Illumina platform NovaSeq6000.

  Dataset EGAD50000001746

• Paired-end RNA-seq FASTQ files from amniotic fluid samples

  Paired-end RNA-seq FASTQ files from amniotic fluid samples of 49 extreme premature births, affected and unaffected by the fetal inflammatory response.

  Dataset EGAD50000001260