21163 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The service is affordable and quick..JIZq"

in 44.93 milliseconds.

• Genome and transcriptome sequence data from an atypical chronic lymphocytic leukemia patient

  Genome and transcriptome sequence data from an atypical chronic lymphocytic leukemia patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001656

• Genome and transcriptome sequence data from a parotid gland cancer patient

  Genome and transcriptome sequence data from a parotid gland cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001657

• Genome and transcriptome sequence data from an odontogenic ghost cell carcinoma patient

  Genome and transcriptome sequence data from an odontogenic ghost cell carcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001658

• Trimmed bam-files from whole genome sequencing data from plasma DNA

  Single-end sequencing data (trimmed to 60bp) of 104 plasma samples from donors without tumors (male=50; female=54) were merged and used to establish coverage profiles around the TSS and to establish a gene expression prediction algorithm. Dataset includes merged alignements of low coverage whole genome sequencing from plasma DNA from 50 male, 54 female non-cancer donors. Furthermore, 2 patients with metastasized breast cancer were sequenced on a NextSeq with higher depth.

  Dataset EGAD00001002254

• Genome and transcriptome sequence data from a locally advanced breast cancer patient

  Genome and transcriptome sequence data from a locally advanced breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004897

• Genome and transcriptome sequence data from a metastatic rectal carcinoma patient

  Genome and transcriptome sequence data from a metastatic rectal carcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004898

• Genome and transcriptome sequence data from a invasive ductal carcinoma of right breast patient

  Genome and transcriptome sequence data from a invasive ductal carcinoma of right breast patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004899

• Genome and transcriptome sequence data from a metastatic pancreatic cancer patient

  Genome and transcriptome sequence data from a metastatic pancreatic cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004900

• Indonesian RNA-seq dataset

  This dataset contains 4 batches of Indonesian RNA-seq data from Mentawai, New Guinea and Sumba islands. One RNA-seq batch was prepared without Globin depletion, and three batches were Globin depleted using the Illumina Globin-Zero Gold Kit. There are 179 runs in total, including 119 unique samples. Dataset includes multiple batch control samples.

  Dataset EGAD00001005053

• Chromatin accessibility analysis of hepatocyte-like cell in vitro differentiation from iPSC in comparison to primary human hepatocytes

  Fastq files of ATAC-seq data of induced pluripotent stem cells (iPSC), definitive endoderm (DE), hepatocyte-like cells (HLC) and primary human hepatocytes (PHH). The dataset comprises data from two different in vitro differentiation protocols: Cellartis (Takara Bio, "CEL", n = 4) and as described by Wang et al. (PMID: 28287600, "HAY", n = 1), as well as from 3 PHH donors.

  Dataset EGAD00001005934

• Single cell transcriptomes of in vitro differentiated hepatocyte-like cells in comparison to primary human hepatocytes

  Fastq files of deeply sequenced single cell RNA-seq data (Smartseq2, approx. 2 million reads / sample) of hepatocyte-like cells (HLC) and primary human hepatocytes (PHH). The dataset comprises data from two different in vitro differentiation protocols: Cellartis (Takara Bio, "CEL", n = 3) and as described by Wang et al. (PMID: 28287600, "HAY", n = 1), as well as PHH from 3 donors. Each replicate comprises 96 single cells.

  Dataset EGAD00001005946

• Next Generation Sequencing Characterization of Tregs in Human Peripheral Blood during Autoimmunity

  Tregs were sorted as CD4+CD25+CD127- cells from peripheral blood of 14 healthy individuals, 8 patients with mild/severe rheumatoid arthritis, 1 patient with systemic lupus erythematosus/rheumatoid arthritis, 2 patients with ulcerative colitis and 2 patients with Chrohn's disease. RNA was extracted and polyA libraries were prepared using the Illumina Truseq sample preparation kit v.2. Single-end 75bp sequencing was performed on NextSeq500.

  Dataset EGAD00001005446

• Whole transcriptome profiling of liquid biopsies from tumour xenografted mouse models enables specific monitoring of tumour-derived extracellular RNA

  Total RNA sequencing (SMARTer Stranded Total RNA-Seq Kit v2) data of extracellular RNA (exRNA) from liquid biopsies of a BRC0004PR PDX and SK-N-BE(2C) CDX mouse model, and total RNA sequencing profiles of the matching PDX tumors.

  Dataset EGAD00001008318

• Genome and transcriptome sequence data from a poorly differentiated chordoma of C1-C2 spine patient

  Genome and transcriptome sequence data from a poorly differentiated chordoma of C1-C2 spine patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001008012

• Genome and transcriptome sequence data from a metastatic pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a metastatic pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010316

• Genome and transcriptome sequence data from a pancreatic ductal adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic ductal adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010317

• Comprehensive single-cell genome analysis at nucleotide resolution using the PTA Analysis Toolbox

  Whole genome sequencing data of 57 single (PTA), clonally expanded and bulk human cells. Cells were obtained from bone marrow samples of patients with Fanconi Anemia (PMCFANCNN) or pediatric AML (PBNNNNN), from a clonal intestinal organoid line (STE0072/D-ORGWTNISL), from human cord blood (PMCCB15) and from a human lymphoblastoid cell line (PMCAHH1). WGS libraries were sequenced to ~15-30x genomic coverage (paired-end) on an Illumina Novaseq.

  Dataset EGAD00001011126

• Targeted sequencing of vascular malformations tissues and paired blood samples

  In recent years, it has been clarified that various vascular malformations are caused by gene mutations. However, there remain vascular malformations of unknown etiology. In the present study, we investigated somatic mutations of three types of vascular malformations to identify novel gene mutations involved in their pathogenesis.

  Study JGAS000325

• Single-nucleus RNA sequencing (snRNA-seq) of seven human diffuse midline glioma (DMG) patient tumour samples.

  This dataset comprises 7 paired (14 total) FASTQ files of single-nucleus RNA sequencing (snRNA-seq) data generated from seven human diffuse midline glioma (DMG) patient tumour samples. snRNA-seq libraries were generated using the 10X Chromium Controller and Chromium Next GEM Single Cell 3’ kit version 3.1 in line with the manufacturer’s instructions. Generated libraries were sequenced on an Illumina NextSeq 2000 (P3 XLEAP-SBS chemistry) at targeted 20,000 reads per nucleus.

  Dataset EGAD50000002514

• RNA sequencing of tumor samples from patients with BPLL

  RNA-Seq was performed on 12 samples of sorted CD19+ tumor cells. RNA-Seq libraries were prepared using the SureSelect Automated Strand Specific RNA Library Preparation Kit as per manufacturer’s instructions (Agilent technologies) and subjected to paired-end (2 x 100 bp) sequencing on HiSeq2000 (Illumina). The files are in FASTQ format.

  Dataset EGAD00001004412

• Molecular profiling of DLBCL patients treated in the PETAL trial

  Shallow whole genome sequencing and targeted sequencing of DLBCL patients treated in the PETAL trial

  Dataset EGAD00001008386

• Genetic Effects on miRNA Expression During Mid-Gestation Neocortical Development

  In this study we aimed to find common genetic variants that influence miRNA expression during mid-gestation neocortical development. Small RNA-sequencing from 212 fetal cortical tissue samples between 14 and 21 weeks gestation were used to profile miRNA expression. Combined with donor genotypes, we were able to find miRNA-eQTLs during neocortical development. The dataset provided here includes 212 Small RNA-sequencing files in FASTQ format from cortical wall samples. Also provided here are 212 donor genotypes in PLINK format (hg19).

  Study phs003106

• Transcriptome analysis of human iPSC-derived microglia in a novel human 3D cortical tissue model

  scRNA-seq analysis of human iPSC-derived microglia in a novel, human in vitro 3D cortical tissue model. Samples include three distinct conditions (each as biological duplicates): wild-type microglia extracted from cultures after 1 month (WT_1mo) and 3 months (WT_3mo) of culturing, as well as knock-in microglia extracted from cultures carrying three familial AD mutations in the APP gene (Swedish, Iberian, Arctic; introduced by CRISPR/Cas9-mediated knock-in) after 3 months of culturing (KI_3mo).

  Study EGAS50000000469

• We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas.

  Schwannomas are common peripheral nerve sheath tumors that can cause significant debilitating morbidities. We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas. Exome sequence analysis with validation by targeted DNA-sequencing of 125 samples uncovered, in addition to expected NF2 disruption additional recurrent mutations. RNA sequencing identified a recurrent in-frame SH3PXD2A-HTRA1 fusion in 12/125 (10%) cases, and genomic analysis demonstrated the mechanism as resulting from a balanced 19Mb chromosomal inversion on chromosome 10q.

  Study EGAS00001001886

• Targeted sequencing of Human esophageal epithelium microbiopsies

  NOTCH1 mutant clones occupy the majority of normal human esophagus by middle age, but are comparatively rare in esophageal cancers, suggesting NOTCH1 mutations may promote clonal expansion but impede carcinogenesis. Here we test this hypothesis. Visualizing and sequencing NOTCH1 mutant clones in aging normal human esophagus, reveals frequent biallelic mutations that block NOTCH1 signaling.  In mouse esophagus, heterozygous Notch1 mutation confers a competitive advantage over wild type cells, an effect enhanced by loss of the second allele.  Notch1 loss alters transcription but has minimal effects on epithelial structure and cell dynamics. In a carcinogenesis model, Notch1 mutations were less prevalent in tumors than normal epithelium. Deletion of Notch1 reduced tumor growth, an effect recapitulated by anti-NOTCH1 antibody treatment.  We conclude that Notch1 mutations in normal epithelium are beneficial as wild type Notch1 promotes tumor expansion. NOTCH1 blockade has therapeutic potential in esophageal squamous tumors.

  Dataset EGAD00001006969

• Comprehensive investigation of genome architecture of papillary thyroid cancer with whole-exon sequencing in the Chinese population.

  In this study, we performed whole-exon sequencing (WES) of 50 paired PTC tumors and adjacent normal tissues to identify novel potential biomarkers. We extracted mutational signatures which induce somatic mutations. Moreover, we observed copy number changes frequently occurring in some cancer related genes. Our study covers a comprehensive genetic framework that can be used in clinical trials and treatment modalities in PTC.

  Study EGAS00001002402

• cfDNA dataset with whole genome sequencing for cfDNA cohort

  Cell free DNA sequencing data for 13samples with whole genome sequencing across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000666

• RNASeq files for Klco PanAML data

  RNASeq files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011294

• WGS files for Klco PanAML data

  WGS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011295

• WXS files for Klco PanAML data

  WXS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011296

• RNASeq files for Stewart-MATCH

  RNASeq files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015475

• WXS files for MATCH paper

  WXS files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015484

• Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Dataset EGAD00001012638

• Fecal WMS HV sequencing data

  Fecal WMS data from NCT02749630 healthy volunteers. Stool samples were collected at screening as well as on days 29, 43, and 64 and prepared for whole metagenomic sequencing.

  Dataset EGAD00001008841

• WTCCC case-control study for Ankylosing Spondylitis - Combined Controls

  WTCCC genome-wide case-control association study for Ankylosing Spondylitis (AS) - Combined Controls.

  Study EGAS00000000019

• WTCCC case-control study for Autoimmune Thyroid Disease - Combined Controls

  WTCCC genome-wide case-control association study for Autoimmune Thyroid Disease (ATD) - Combined Controls.

  Study EGAS00000000021

• Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Study EGAS00001003876

• raw RNA-seq data from patients infected with COVID-19 or influenza

  Dataset consists of fastq files from bulk RNA-seq done on peripheral blood acquired from two well characterised hospitalised cohorts, a cohort of patients infected with influenza and a cohort of patients infected with SARS-CoV-2 during the first wave of the pandemic and prior to availability of COVID-19 treatments and vaccines.

  Dataset EGAD00001008505

• Distinct embryonic phylogenies and driver events of infant Wilms tumor - DNA

  Cancers of adults typically arise through progressive rounds of clonal diversification and intratumoral selective sweeps which generate a long mutational trunk with shorter subclonal branches. Here, we investigated whether tumors of young children exhibit the same phylogenetic configuration. We studied three infants, including two newborns, with the childhood kidney cancer, Wilms tumour, through whole genome sequencing of bulk tissues, of single cell derived organoids, and of microdissections. All three cancers exhibited unusual driver events, with tumours of newborns harbouring FOXR2 rearrangements, delineating a distinct variant of Wilms tumour. Phylogenetic analyses suggest that tumors were seeded in an early, possibly confined window of development. Unusually, following seeding there was extensive polyclonal diversification with little evidence of clonal sweeps, leading to a distinct phylogenetic configuration more reminiscent of normal tissues rather than of adult cancers. These findings indicate that some childhood cancers may diversify via unorthodox phylogenetic pathways.

  Dataset EGAD00001009812

• Patient-Parent trio sequencing for 100 sporadic ID patients

  Single end short-read (50 bp) SOLiD 4 sequencing data for 300 individuals, constituting 100 patient-parent trios. For more details please read; http://www.nejm.org/doi/full/10.1056/NEJMoa1206524

  Dataset EGAD00001000680

• DAC for Melanoma Exome Dataset for Identification of Mutated Epitopes

  Dac EGAC00001000546

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002208

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002844

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003086

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003058

• Whole genome and RNA-sequencing in T-cell acute lymphoblastic leukemia

  Dataset includes whole genome and transcriptomic sequencing data from five T-cell acute lymphoblastic leukemia (T-ALL) patients. Whole genome sequencing has performed from both diagnostic (T-ALL sample) and control (remission sample) samples. RNA-sequencing has performed from diagnostic samples. Samples has been taken from the bone marrow or peripheral blood.

  Dataset EGAD00001008658

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002303

• DAC for Sarcopenia HNSCC

  Data access committee for Sarcopenia HNSCC study

  Dac EGAC50000000420

• ChIP-Seq (H3K4me3, H3K4me1, H3K9me3, H3K27ac, H3K27me3, H3K36me3, Input) data for HL60 cell line generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency.

  ChIP-Seq (H3K4me3, H3K4me1, H3K9me3, H3K27ac, H3K27me3, H3K36me3, Input) data for HL60 cell line generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency.

  Dataset EGAD00001002238

• DAC for study Screening for abnormal CGI methylation in primary colorectal tumours

  Dac EGAC00001000069

• Data Access Committee for German Consortium for Translational Cancer Research (DKTK)

  Dac EGAC00001000217

• Data Access Committee for COLO829 Somatic reference standard for cancer genome sequencing

  Dac EGAC00001000408

• ATACseq

  ATACseq data for this study.

  Study EGAS00001007166

• SNParray

  SNP array study for UTUC

  Study EGAS00001004979

• Sequencing data for oesophageal and related samples - OACs release 4 (RNA)

  Dataset EGAD00001004021

• Leukemia WGS data

  Whole-genome sequencing data from 38 leukemia patients and 12 leukemia cell lines; Containing 100 fastq files; Two files for each sample.

  Dataset EGAD00001008659

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Acute Myeloid Leukemia peripheral blood ATAC data

  ATAC-seq was used to profile the accessible chromatin landscape of 29 (12 LSC17 high, 17 LSC17 low) peripheral blood AML bulk samples. 50,000 cells from each sample were processed and libraries were sequenced with 50 bp paired-end reads.

  Dataset EGAD00001006776

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Longitudinal tracking of CRC patients

  Heatrich-BS was performed on 14 patients monitored across 5-8 timepoints each. The predicted tumor fraction trend was compared with CEA values and tumor measurements from CT scans.

  Dataset EGAD00001008714

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• Paired whole genome sequencing of tumor-control pairs of Thymic epithelial tumors

  Paired whole genome sequencing of tumor-control pairs of Thymic epithelial tumors, 25 samples with paired fastq files, sequenced on Illumina-HiSeq_X_Ten and using the Illumina_TruSeq_Nano_DNA kit.

  Dataset EGAD00001009094

• whole exome sequencing of 8 tumor-control pairs of Thymic epithelial tumors

  Paired whole exome sequencing of 8 tumor-control pairs of Thymic epithelial tumors, sequenced on Illumina HiSeq 4000 and using the Agilent SureSelect V5+UTRs Kit.

  Dataset EGAD00001009095

• cfDNA dataset for cfDNA cohort

  Cell free DNA sequencing data for 233 samples across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000104

• Targeted sequencing analysis for MDS with HSCT

  Targeted capture sequencing for cases with MDS who were subjected to unrelated bone marrow transplantation via Japan marrow donor program

  Study EGAS00001001949

• Single cell RNA-sequencing (scRNA-seq) of the human hematopoietic stem cell compartment (CD34+CD38-CD45RA-)

  To identify a trajectory of human hematopoietic stem cell (HSC) activation single cell gene expression profiling of RNA from human HSC was performed by flow cytometry-based single cell deposition of CD34+CD38—CD45RA—cells from G-CSF-mobilized peripheral blood from 3 individual donors and 1 bone marrow donor in concert with single cell index-sorting (signals indexed: CD34, CD38, CD45RA, CD90, CD49f) and followed by SMARTseq2 based protocol. We show that INKA1 and CDK6/PAK4 expressing single cells segregate across alternative states of quiescence.

  Study EGAS00001004769

• Longitudinal multi-omics support immunotrhrombosis as the molecular force behind increased post-acute complication risk

  Whole blood transcriptome profiles in severe COVID-19 patients (n=81) across three timepoints: A) 1st day of hospital admission, B) one month (38.46 ± 12.89 days) post-hospitalization, and C) three months post-infection (96.29 ± 13.81 days post-hospitalization). 62 patients had blood collected at all three timepoints (19 patients have transcriptome data from two timepoints (acute phase (timepoint A) and recovery phase (timepoint B or C)), 224 blood transcriptomes in total.

  Study EGAS50000001430

• monozygotic twin discordant for schizophrenia

  monozygotic twin discordant for schizophrenia

  Dataset EGAD00001000048

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003606

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003612

• Genome and transcriptome sequence data from an adenocarcimona of the lung patient

  Genome and transcriptome sequence data from an adenocarcimona of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003616

• Genome and transcriptome sequence data from a mucinous colloid carcinoma of the pancreas patient

  Genome and transcriptome sequence data from a mucinous colloid carcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004598

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004627

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the stomach patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004619

• Genome and transcriptome sequence data from a metastatic mmmt of the endometrium patient

  Genome and transcriptome sequence data from a metastatic mmmt of the endometrium patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004618

• Genome and transcriptome sequence data from a ganglioglioma of the left temporal lobe patient

  Genome and transcriptome sequence data from a ganglioglioma of the left temporal lobe patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004615

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004634

• Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the breast patient

  Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the breast patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004921

• Genome and transcriptome sequence data from a squamous cell carcinoma of the alveolar ridge patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the alveolar ridge patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004934

• Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx tumor patient

  Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015307

• Data access committee for RNA-seq as a tool for evaluating human embryo competence

  Dac EGAC00001001215

• Single-nucleus Transcriptome of Down Syndrome Brains (short-read)

  29 DS and Control brain samples were prepared using the 10X Genomics Single Cell 3' v3 kit. The cDNA libraries were sequenced on an Illumina Novaseq 6000.

  Dataset EGAD00001008287

• Whole-exome sequencing laser capture micro-dissected biopsies of human renal cell carcinoma

  The dataset comprises whole exome sequences from laser capture micro-dissected biopsies of 10 patients diagnosed with clear cell renal cell carcinoma. In total over 100 regions are sampled to allow 'focally exhaustive' sequencing and explore the limits of intra-tumoural heterogeneity.

  Dataset EGAD00001008029

• Concatenated long-read single-cell RNA sequencing of momentum biopsies of ovarian cancer patients

  Concatenated long-read single-cell RNA sequencing samples prepared using 10X and the HIT-scIsoSeq protocol. The sequencing was performed on Sequel II Pacbio machine. 3 ovarian cancer patients, 5 omentum biopsies samples: 3 metastasis samples (one per patient), 2 healthy samples (one per patient except Patient2). 4 bam files per metastasis sample, 2 bam files per healthy sample.

  Dataset EGAD00001009814

• snRNA-seq BAM files from 10x Multiome profiling of human fetal liver hematopoiesis

  This dataset provides snRNA-seq BAM files from a single-nucleus multiome study of 53 human fetal liver samples (5–18 post-conception weeks). Live CD45+CD235- cells were sorted from dissociated tissue, and isolated nuclei were processed using the Chromium Next GEM Single Cell Multiome ATAC + Gene Expression kit. Raw sequencing data were processed and aligned to GRCh38-2020-A-2.0.0 using Cell Ranger ARC v2.0.2.

  Dataset EGAD50000002337

• Genome and transcriptome sequence data from a metastatic colorectal carcinoma patient

  Genome and transcriptome sequence data from a metastatic colorectal carcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001307

• Genome and transcriptome sequence data from a primary unknown cancer patient

  Genome and transcriptome sequence data from a primary unknown cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001001308

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002534

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002531

• Genome and transcriptome sequence data from an ovarian cancer patient

  Genome and transcriptome sequence data from an ovarian cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002533

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002532