17084 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..xwWa"

in 34.90 milliseconds.

• Transcriptomic Profiling of an Anti-PD-L1 Treated Cohort of Newly Diagnosed GBM Patients

  Checkpoint inhibitor therapy has limited efficacy in glioblastoma patient outcomes. This study involves RNA sequencing (RNA-seq) of newly diagnosed GBM patients treated with concurrent atezolizumab, radiation therapy, and temozolomide. By analyzing RNA-seq data from 39 tumors, the study aims to explore tumor transcriptomic features, including immune-based transcriptomic programs and immune infiltration, to understand their influence on PD-L1 blockade treatment efficacy and to identify which patients may benefit more from such therapy.

  Study EGAS50000000784

• Single cell RNA-seq of two rare cases of human glioblastoma at multiple sampling points

  Glioblastoma is characterized by large cellular diversity whose complexity and organizing principles are only starting to be uncovered. Both neurodevelopment-like and mesenchymal-like cell states have been described in glioblastoma but the nature of the mesenchymal-like cell states remains unresolved. Here, we performed deep single-cell RNA sequencing of two rare glioblastoma cases where tissue could be sampled from tumor core to macroscopically normal cortex with the aim of understanding these tumor cell states.

  Study EGAS50000001030

• Single-cell RNA sequencing analysis of corneal and limbal epithelial cells derived from a patient with congenital aniridia

  Aniridia-associated keratopathy (AAK) is a progressive condition characterized by conjunctivalization of the cornea, yet its molecular mechanisms remain largely unknown. This study aims to elucidate the transcriptional landscape of AAK by characterizing the gene expression profiles of corneal epithelial cells in a patient with congenital aniridia. Corneal and limbal epithelial tissues were collected from the patient during the cultivated oral mucosal epithelial transplantation (COMET) surgery. The tissues were dissociated into single cells and subjected to single-cell RNA-seq.

  Study JGAS000790

• Multi-modal single-cell analysis of salivary glands from patients with Sjogren's syndrome collaboration

  Sjogren's syndrome (SS) is an autoimmune disease that causes salivary gland dysfunction due to immune-mediated destruction. While autoantibodies such as anti-SSA and anti-centromere (CENT) are associated with distinct clinical manifestations, the underlying mechanisms remain to be elucidated. In this study, we apply multi-modal single-cell technologies-single-cell RNA sequencing, T- and B-cell receptor sequencing, and spatial transcriptomics-to salivary gland lesions, aiming to uncover common and unique cellular and transcriptional signatures linked to different autoantibody profiles.

  Study JGAS000773

• Spatial Profiling of Patient-Matched HER2 Positive Gastric Cancer Reveals Resistance Mechanisms to Trastuzumab and Trastuzumab Deruxtecan Sequencing

  HER2-positive gastric cancer (HER2+ GC) exhibits significant intra-tumoral heterogeneity and frequent development of resistance to HER2-targeted therapies. This study aimed to characterize the spatial tumor microenvironment (TME) and identify mechanisms of resistance to HER2 blockade including trastuzumab and trastuzumab deruxtecan (T-DXd) in HER2+ GC, with the goal of informing novel therapeutic strategies. We performed spatial transcriptomics on pre- and post-treatment samples from patients with HER2+ metastatic GC who received trastuzumab-based therapy.

  Study EGAS50000000636

• Chromosomal instability shapes the tumor microenvironment of oesophageal adenocarcinoma via a cGAS–chemokine–myeloid axis

  This study employed whole-genome sequencing (WGS) to investigate genomic alterations in oesophagogastric adenocarcinoma, with a focus on mechanisms of chromosomal instability. Twelve tumour samples were analysed, including specimens obtained prior to neoadjuvant chemotherapy and at surgical resection. WGS was used to identify structural variants, quantify tumour mutational burden, and detect potential driver mutations across samples. The study aimed to correlate genomic measures of chromosomal instability with clinicopathological features to improve understanding of tumour biology.

  Study EGAS50000001561

• Khoe-San Genome Project

  The dataset contains BAM files of whole genome sequencing data of African Khoe-San population (n=169, 30X coverage) recruited from South Africa and Namibia. The population captured the true extent of human genetic diversity as represent the earliest diverged human population. The project described a detailed divergence of human population and identified positive selections associated forager lifestyles in Khoe-San population. These findings emphasise an inclusive catalogue with better representation of the earliest human genomic diversity to better advance biomedical research.

  Study EGAS50000001408

• Barcelona_kids_with_melanoma

  This set of samples is composed of eight young people (7-16 years old) that have developed melanoma with first-degree relatives that have also developed cancer, which suggests a genetic component to their disease. Here we want to sequence these samples in order to find the causative mutations. As these samples do not carry any of the high-penetrance mutations known to date, finding the genes(s) responsible will offer new insights into the genetic mechanisms underlying predisposition to melanoma.

  Study EGAS00001000733

• AML_targeted_resequencing_study

  Genomic libraries will be generated from whole genome amplified genomic DNA derived from 3,000 myeloid neoplasms. Targeted capture will be performed by multiplexing 16 barcoded samples in each library. Pools of 96 DNA samples will be subjected to 1-2 lanes of HiSeq 75bp sequencing. Reads will be mapped to the current build of the human reference genome to facilitate the generation of a comprehensive catalog of somatic mutations associated with 116 known myeloid and cancer driver genes.

  Study EGAS00001000275

• Genetic landscape of relapsed DLBCL

  Diffuse large B-cell lymphoma is a heterogenous malignancy that can arise de novo or can result from histologic transformation from indolent lymphomas. Considerable sequencing effort has been placed on determining the mutations that are common at the time of diagnosis in DLBCL but little is known about the nature of relapsed disease. We have sequenced tumour and matched normal exomes of 38 rrDLBCL patients including 25 de novo DLBCLs and 13 transformed lymphomas to identify somatic mutations and copy number alterations associated with relapse.

  Study EGAS00001001553

• WGS of breast cancer diagnosed during pregnancy and matched control

  The aim of this study was to compare the mutational landscape of breast cancer diagnosed during pregnancy (BCP) and breast cancer from age/stage non-pregnant patients (controls). We present whole genome sequencing data (Illumina HiSeq X ten platform) of tumor and matched normal tissues from 35 BCP patients and 20 controls. This work provides important novel biological insights and a unique resource to study the biology of breast cancer in young women and how pregnancy could modulate tumor biology.

  Study EGAS00001002685

• Celiac disease-specific intestinal T cells analyzed with HLA-class II tetramers, RNA-seq and mass cytometry have a narrow, autoimmune-associated phenotype

  Celiac disease (CD) is an HLA-DQ2/8-associated autoimmune enteropathy driven by activation of gluten-specific CD4+ T lymphocytes upon gluten consumption. Much less is known about the phenotype and function of these cells or their correlation, if any, to disease-relevant cells in other autoimmune disorders. Here we use mass cytometry and RNA seq to show that gluten-specific blood and gut T cells occupy a small and phenotypically distinct T-cell subset.

  Study EGAS00001003017

• Genomic profiling of paediatric glioma cell lines

  Although paediatric gliomas resemble their adult counterparts in many ways, there appear to be distinct clinical and biological differences. One important factor hampering the development of new targeted therapies is the relative lack of cell lines derived from childhood glioma patients, as it is unclear whether the well-established adult lines commonly used are representative of the underlying molecular genetics of childhood tumours. We have carried out a detailed molecular profiling of paediatric glioma cell lines KNS42, SF188, UW479, RES259 and RES186.

  Study EGAS00001003006

• Exploring_the_landscape_of_somatic_mutations_in_normal_tissue___BD___WGS

  The aim of this project is to investiagte somatic mutations, including rates of mutations and signatures, and clonal dynamics in normal (non-cancerous) human tissues from the biliary tree. The project will involve the studyof normal tissues from healthy individuals and those with specific candidate diseases. We are utilising laser capture microscopy to idnetifiy and isolate specific cell populations which are then subjected to whole genome sequencing to estimate mutational burdens and begin to understand clonal structures across the normal tissues.

  Study EGAS00001003014

• Exploring_the_landscape_of_somatic_mutations_in_normal_tissue___GI___TPS___WGS

  The aim of this project is to investigate somatic mutations, including rates of mutations and signatures, and clonal dynamics in normal (non-cancerous) human tissues from the gastrointestinal tract. The project will involve the study of normal tissues from healthy individuals and those with specific candidate diseases. We are utilising laser capture microscopy to identify and isolate specific cell populations which are then subjected to whole genome sequencing to estimate mutational burdens and begin to understand clonal structures across the normal tissues.

  Study EGAS00001003089

• Whole genome sequencing of multiple myeloma identifies novel structural and non-coding mutations.

  The coding region of the myeloma genome is well understood with key mutations having been identified. However, the non-coding regions of the myeloma genome are yet to be analyzed. Here we have performed whole genome sequencing of myeloma patient samples to identify structural abnormalities including chromothripsis and chromoplexy, as well as gene dysregulation through super-enhancer juxtaposition with key oncogenes. We have also identified non-coding region hotspots of mutation, especially in promoter regions, that affect gene expression.

  Study EGAS00001003164

• Transcriptome profiling of three giant cell tumour of bone cell lines

  Transcriptome profiling of three established giant cell tumour of bone (GCTB) cell lines on the BGISEQ-500 platform (PE100). Cell lines consist of neoplastic "stromal" cells harboring a heterozygous H3F3A p.G34W mutation. Data was used in a study (Venneker et al., Histone deacetylase inhibitors as a therapeutic strategy to eliminate neoplastic “stromal” cells from giant cell tumors of bone, 2022) to determine H3F3A-WT/MT expression ratios, to identify pathogenic variants, and to examine the expression levels of epigenetic modifiers and regulators.

  Study EGAS00001006441

• Human pan-cancer plasma cfRNA study - raw data

  This study contains mRNA capture sequencing data from plasma of 266 different human donors. The first, pan-cancer, cohort covers 25 high-grade to metastatic cancer types (8 cancer patients per type) and a control group (8 healthy donors). The validation cohort comprises additional plasma samples from ovarian, prostate and uterine cancer patients (12 per type) as well as additional samples from controls (22 new and 8 repeated). Samples were sequenced on a NovaSeq 6000 and are provided in FASTQ format.

  Study EGAS00001006755

• Whole Genome Sequencing Data of High Grade Serous Ovarian Cancer

  Longitudinal whole genome sequencing data to study chemoresponse in ovarian cancer. These samples belong to an ongoing sample collection and the data already includes hundreds of samples from over 200 patients. Samples are from primary and metastatic tissues and ascites. All patients have been treated with platinum-taxane based chemotherapy and majority of them are diagnosed with high-grade serous ovarian cancer.

  Study EGAS00001006775

• Targeted DNA panel sequencing analysis of PanNEN tumors of varying grades using custom and commercial panels

  Targeted panel sequencing data from PanNEN samples. Sample ID is annotated in the following manner: each patient is given a number and "P" is appended to the patient number if it is a primary tumor, "M” if it is metastasis and "N" if it is normal (healthy tissue) sample. All NETG1 and NETG2 samples underwent panel sequencing using a custom panel (in-house PanNEN panel). All NEC and NETG3 samples (except PNET2, PNET77P and PNET77M) underwent panel sequencing using a commercial CCP panel.

  Dataset EGAD00001008432

• Cold Ischemia Study

  This study aimed to evaluate the impact of cold ischemia time on the expression of cancer-related genes, particularly those involved in hypoxia, apoptosis, and epithelial-to-mesenchymal transition (EMT). We performed RNA sequencing on 54 normal colon mucosa samples from nine patients undergoing colorectal cancer surgeries, freezing samples at predefined intervals ranging from 0 to 60 minutes. A total of 44 differentially expressed genes (DEGs) (p < 0.05) were identified when comparing samples frozen immediately (T0) with those frozen after 60 minutes (T5).

  Study EGAS00001008233

• Massive Genomic Rearrangment Acquired in a Single Catastrophic Event During Cancer Development

  Cancer is driven by mutation. Using Agilent exome hybridisation capture and Illumina GA massively parallel sequencing technology, we aim to sequence ~1600 microRNAs plus the protein coding genome of 25 matched human renal cancer samples. Bespoke algorithms are being developed to identify the somatically acquired point mutations, insertions and deletions in these samples. This project will give unprecedented insights into mutational processes, cellular repair pathways and gene networks associated with renal cancer development.Agilent whole exome hybridisation capture will be performed on genomic DNA derived from 25 renal cancers and matched normal DNA from the same patients. Three lanes of Illumina GA sequencing will be performed on the resulting 50 exome libraries and mapped to build 37 of the human reference genome to facilitate the identification of novel cancer genes.

  Study EGAS00000000029

• Single-nucleus brain transcriptomics reveals microglia dysfunction in Multiple System Atrophy

  Multiple System Atrophy (MSA) is a rare, age-related neurodegenerative disease that shares clinical and pathological features with Parkinson’s disease (PD) but presents a more devastating disease course. To elucidate the distinct cellular pathophysiology underlying multiple system atrophy (MSA) or Parkinson's disease (PD), we performed single-nucleus RNA sequencing on postmortem striatal brain tissue from 7 MSA and 12 PD patients, and 10 non-neurological cases. Using 10x Genomics Chromium Next GEM Single Cell 3' Reagent Kits v3.1, we isolated 130k nuclei covering all major cell types of the striatum. We performed state-of-the-art bioinformatic analyses on the data followed by orthogonal analyses to validate our findings. We identified a disease-specific activation of microglia cells distinguishing the two diseases and possibly explaining some of the detrimental effects observed in both.

  Study EGAS50000001406

• Translational analyses from a phase II study of pembrolizumab and epigenetic modification with azacitidine in platinum-resistant epithelial ovarian cancer

  Epigenetic modulators may sensitize platinum-resistant ovarian cancer (PROC) to immune checkpoint inhibition by reprogramming the tumor microenvironment. We report clinical and translational findings from a phase II non-randomized study of pembrolizumab and oral azacytidine in 34 women with PROC (NCT02900560). The effect of combined epigenetic and immunotherapy was evaluated by transcriptomic analyses of serially biopsied tumors. Differential gene expression analyses revealed an upregulation of inflammatory and cytolytic genes and co-inhibitory checkpoints 6 weeks on-therapy. Upregulation of interferon signaling, antigen presentation and immune cell adhesion and migration gene sets was prominent on-therapy, together with an increased density of CD8+ T -cells. Patients with a CA-125 and/or clinical response showed an enrichment of adaptive and conserved immune response gene sets on-therapy.

  Study EGAS50000001165

• Erythroid/megakaryocytic differentiation confers BCL-XL dependency and venetoclax resistance in acute myeloid leukemia

  Myeloid neoplasms with erythroid or megakaryocytic differentiation include pure erythroid leukemia (PEL), myelodysplastic syndrome (MDS) with erythroid features, and acute megakaryoblastic leukemia (FAB M7) and are characterized by poor prognosis and limited treatment options. Here, we investigate the drug sensitivity landscape of these rare malignancies. We show that acute myeloid leukemia (AML) cells with erythroid or megakaryocytic differentiation depend on the anti-apoptotic protein BCL-XL, rather than BCL-2, using combined ex vivo drug sensitivity testing, genetic perturbation, and transcriptomic profiling. Single-cell and bulk transcriptomics of patient samples with erythroid and megakaryoblastic leukemias identified high BCL2L1 expression compared to other subtypes of AML and other hematological malignancies, where BCL2 and MCL1 were more prominent. Our results suggest targeting BCL-XL as a potential therapy option in erythroid/megakaryoblastic leukemias and highlight an AML subgroup with potentially reduced sensitivity to venetoclax-based treatments.

  Study EGAS00001006819

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• Genomic profiling of patient-derived xenografts and organoids in prostate cancer

  Dataset contains genomic sequencing of 87 samples (blood germline, normal prostate tissues, human tumors, PDOs and PDXs). Sequencing was performed by whole-exome sequencing or targeted sequencing of prostate cancer genes.

  Dataset EGAD00001006403

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• Transcriptome-wide gene expression analysis of cocaine use disorder in postmortem human brain tissue

  Dataset contains raw fastq-files from RNA-sequencing analysis of total RNA extracted from Brodmann Area 9 human postmortem brain tissue samples.

  Dataset EGAD50000000212

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Whole-genome-sequencing and Whole-exome-sequencing in Spastic paraplegia

  To identify the genetic cause and modifiers of Spastic paraplegia, we performed Whole-genome-sequencing and Whole-exome-sequencing of Spastic paraplegia patients.

  Study JGAS000494

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• DKFZ-St.Jude Medulloblastoma - 218 CEF control exomes

  218 control exomes, CEF cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006659

• Sporadic and endemic Burkitt lymphoma have frequent FOXO1 mutations but distinct hotspots in the AKT recognition motif

  Sample set of 74 whole-exome sequencing samples from sporadic Burkitt lymphoma patients from the UK. 33 of these samples have matched constitutional data, giving a total number of 107 samples

  Dataset EGAD00001005105

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Phenotypic characterisation of LRRN4CL over-expression

  This study aims to use RNAseq to identify differentially expressed transcripts in human melanoma cells that over-express the cell surface protein, LRRN4CL, relative to empty-vector control cells, to provide mechanistic insight into how LRRN4CL over-expression confers enhanced pulmonary metastatic colonisation abilities.

  Dataset EGAD00001006249

• Primary tumor/metastatic/germline DNA trios equences files

  Exome sequences of primary tumor/metastatic/germline DNA trios. Tumoral and germline samples were sequenced to an expected depth of respectively 150M and 50M reads in order to obtain differential depth (>100X versus >30X). Submitted data are paired-end fastq files.

  Dataset EGAD00001006324

• Non-small cell lung cancer targeted sequencing

  Targeted sequencing of non-small cell lung cancer samples. BAM files of paired end reads aligned to hg19 using BWA MEM v0.7.1573. This targeted panel covers 370 genes of clinical relevance in non-small cell lung cancer.

  Dataset EGAD00001007918