14977 results for "cancer studies using rna-seq"

in 114.26 milliseconds.

• PCA Atlas Chromium scRNA-seq and demultiplexing support (FASTQs, BAMs, capture-level VCFs and mapping tables)

  This dataset contains Chromium single-cell RNA-seq data and demultiplexing support for the PCA Atlas study EGAS00001008332. Included data objects: - 16 Chromium scRNA-seq FASTQ runs (EGAR accessions) for captures PCa1–PCa16. - 16 aligned BAM analyses (one Cell Ranger possorted_genome_bam.bam per capture). - 16 capture-level genotype VCF analyses derived from the Axiom UK Biobank array, used as demultiplexing panels. - demux_map.csv (EGAZ00001945520): donor–capture–sample mapping for genotype-based demultiplexing. - chromium.csv (EGAZ00001945537): run-level mapping linking captures, EGA samples, runs (EGAR), experiments (EGAX) and BAM analyses. Together these objects provide a complete view of the Chromium scRNA-seq data and the genotype-based demultiplexing support needed to reproduce donor assignment and downstream analyses.See also https://zenodo.org/records/17372603

  Dataset EGAD00001015795

• The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) Genetics of Genetic Epidemiology of Metabolic Syndrome in an Island Population

  The major objective of this study was to conduct a systematic genetic study of metabolic traits involved in metabolic syndrome through collection and analysis of epidemiological, demographic, environmental, and relevant biological and clinical data from a relatively isolated island population of the eastern Adriatic coast of Croatia. The population was chosen for the following reasons: 1) in spite of practicing a largely traditional life style and dietary habits, high rates of obesity, arterial hypertension, dyslipidemia and related metabolic abnormalities were found in previous studies; 2) the population was established by a relatively small number of founders, predominantly of Slavic descent from the mainland during 15th to 18th century AD, a genetically homogeneous population living in a homogeneous environment; 3) sharing a common European ancestry, a relevant population for study in the context of the general US population; 4) Croatian collaborators have been conducting anthropological and genetic studies in these communities for over three decades. There were two major aims of the study: 1) to recruit ~1200 adult participants and collect blood samples together with demographic, anthropometric, environmental and clinical data from the island of Hvar; to perform biochemical tests to measure glucose, insulin, uric acid and lipid levels; 2) conduct a genome-wide association analysis of metabolic traits and phenotypes using genome-wide SNP arrays (Affymetrix Genome-Wide Human SNP Array 5.0).

  Study phs000737

• GENETIC HISTORY OF ITALY

  Recent scientific literature has highlighted the relevance of population genetic studies both for disease association-mapping in admixed populations and for understanding the history of human migrations. Deeper insight into the history of Italian population is critical for understanding the peopling of Europe. Because of its crucial position at the centre of the Mediterranean basin, the Italian peninsula has experienced a complex history of colonization and migration, whose genetic signatures are still present in contemporary Italians. In this study, we investigated genomic variation in the Italian population using 2.5 million single nucleotide polymorphisms (SNPs) in a sample of more than 300 unrelated Italian subjects with well-defined geographical origins. We combined several analytical approaches to interpret genome-wide data on 1,272 individuals from European, Middle Eastern, and North African populations. We detected three major ancestral components contributing different proportions across the Italian peninsula, and signatures of continuous gene flow within Italy, which has produced remarkable genetic variability among contemporary Italians. In addition, we have extracted novel details about the Italian population’s ancestry: we identified genetic signatures of major historical events in Europe and the Mediterranean basin from the Neolithic (e.g., peopling of Sardinia) to recent times (e.g., ‘barbarian invasion’ of Northern and Central Italy). These results are valuable for further genetic, epidemiological and forensic studies in Italy and in Europe.

  Study EGAS00001001458

• Targeted_replication_of_LVOTO_genes

  Non-syndromic cases of congenital heart defects (CHD) exhibit variable modes of inheritance (Mendelian and non-Mendelian). Several studies have identified strong candidates in humans by taking a candidate gene approach as well as by using whole exome next generation sequencing (NGS). So far these studies could only explain a minor fraction of the observed phenotype in humans, most of them in syndromic cases and no single study has focused on the subset of cases with left ventricular outflow tract obstruction (LVOTO). To discover novel disease-causing genes a large cohort of patients with LVOTO, approximately 100 cases, 25 families and 100 trios have been exome sequenced. This study based on NGS sequencing data yielded several known and novel compelling candidate genes, such as MYH6, NR2F2 and MYH11, but also novel ones, such as ITGB4. To evaluate the significance of our findings in a replication cohort we assembled another 1614 cases with an LVOTO phenotype from our collaborators in Toronto, Berlin and Amsterdam. Targeted resequencing in this additional cohort will help to find additional cases with mutations in the identified candidate genes to strengthen genotype-phenotype association. We will use control data from the INTERVAL project for case/control analyses The pulldowns will be performed as 24-plex ISC with 192 or greater indexes, and the sequencing will be performed with 192 samples per lane, requiring 9 lanes of sequencing.

  Study EGAS00001001238

• Cerebral organoid model reveals excessive proliferation of human caudal late interneuron progenitors in Tuberous Sclerosis Complex

  Although the intricate and prolonged development of the human brain critically distinguishes it from other mammals, our current understanding of neurodevelopmental diseases is largely based on work using animal models. Recent studies revealed that neural progenitors in the human brain are profoundly different from those found in rodent animal models. Moreover, post-mortem studies revealed extensive migration of interneurons into the late-gestational and post-natal human prefrontal cortex that does not occur in rodents. Here, we use cerebral organoids to show that overproduction of mid-gestational human interneurons causes Tuberous Sclerosis Complex (TSC), a severe neuro-developmental disorder associated with mutations in TSC1 and TSC2. We identify a previously uncharacterized population of caudal late interneuron progenitors, the CLIP-cells. In organoids derived from patients carrying heterozygous TSC2 mutations, dysregulation of mTOR signaling leads to CLIP-cell over-proliferation and formation of cortical tubers and subependymal tumors. Surprisingly, second-hit events resulting from copy-neutral loss-of-heterozygosity (cnLOH) are not causative for but occur during the progression of tumor lesions. Instead, EGFR signaling is required for tumor proliferation, opening up a promising approach to treat TSC lesions. Our study demonstrates that the analysis of developmental disorders in organoid models can lead to fundamental insights into human brain development and neuropsychiatric disorders.

  Study EGAS00001004586

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, CD4+ T cell subsets from 19 rheumatoid arthritis (RA), 62 systemic lupus erythematosus (SLE), 40 idiopathic inflammatory myopathy (IIM) and 64 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA). RNA-seq was performed with each CD4+ T cell subset samples.

  Study JGAS000626

• Whole Transcriptome Sequencing of NXF1 or CRM1 depleted Cell

  mRNA exporters, NXF1 and CRM1 are known to function in mRNA export. However, since each target mRNA has not been identified genome-widely, it is not clear whether they export exclusive mRNA subsets. To reveal this point, we prepared the nuclear and the cytoplasmic RNAs under either exporter inhibited condition and carried out RNA-seq. In these experiments, we also focused in the export machinery of aberrant transcripts that usually retained and decayed in the nucleus.

  Study JGAS000294

• The genomic landscape of follicular and diffuse large B-cell lymphoma

  As part of the ICGC, the ICGC MMML-Seq project performed whole genome sequencing and RNA sequencing of follicular and diffuse large B-cell lymphoma. Follicular and diffuse large B-cell lymphomas are the most common B-cell lymphomas in adulthood. Analyses were performed in concordance with the guidelines of the ICGC. The results define the genomic landscape of structural variants, somatic single nucleotide variants and mutational signatures in these lymphomas

  Study EGAS00001002199

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• NHLBI TOPMed: Pulmonary Fibrosis Whole Genome Sequencing

  This is a set of cases diagnosed with idiopathic pulmonary fibrosis, a fatal interstitial lung disease. These cases were included in the TOPMed phase three studies. The planned study will compare these cases to within-TOPMed controls for genome-wide association studies.

  Study phs001607

• Genomic Origins and Admixture in Latinos (GOAL)

  The GOAL Study was designed to comprehensively evaluate the genomic architecture of diverse Hispanic/Latino individuals with origins from the Caribbean, Central and South America, and to understand the impact of this diversity on genetic disease studies. Population structure and admixture are key confounders in genome-wide association and medical resequencing studies. In particular, accounting for difference in ancestry among cases and controls, both in terms of genomic and geographic location, is critical for proper analysis and interpretation of studies with multi- and trans-ethnic samples. Genomic studies of Hispanics/Latinos, the largest and fastest growing minority group in the US, reveal that they are a highly genetically heterogeneous admixed group with immense variation among individuals and populations in the proportions of African, European, and Native American ancestry. Knowledge of the underlying complex genetic structure of US Hispanic/Latino and Caribbean populations is, therefore, essential to ensuring robustness of genotype-phenotype associations and understanding the medical relevance of associated variants across diverse populations in the US and throughout the Americas. Furthermore, since much is known about the African and European migrations into the Americas over the past 500 years, population genetic studies of Hispanics/Latinos serve as an excellent model for developing novel algorithms and approaches for characterizing fine-scale genetic structure of admixed populations, in general. This project extends current studies of population genetic structure in US Hispanics/Latinos by densely genotyping parent-offspring triads from individuals (sampled in the US) of Caribbean-descent from six Latin American countries: Puerto Rico, Cuba, Dominican Republic, Haiti, Honduras and Colombia. This study will provide immediate insights and new statistical methods to improve study design and genetic analysis for medical genomic studies in Hispanics/Latinos, other complex admixed groups, and multi- and trans-ethnic studies.

  Study phs000750

• Whole Mitochondrial Sequencing of Gingivo-buccal Cancer: ICGC-India Project

  As a part of the ICGC, India has undertaken genomic studies on gingivobuccal cancer of the oral cavity, which is the most prevalent form of cancer among men in India. There are various known environmental (life-style) correlates of this cancer, the most important of which are tobacco chewing and HPV infection. Detailed clinical characterization of the patients, collection of data on demographic and environmental exposures, and isolation of DNA samples from blood and tumor tissues collected from each patient are being done at the Advanced Centre for Research, Treatment and Education on Cancer, Mumbai. Whole genome and other sequencing experiments are being performed at the National Institute of Biomedical Genomics, Kalyani. Whole mitochondria sequencing of 89 patients was performed in this study. The mean depth of sequencing was at least 2500X, but variable across platforms, 2689X and 9894X for amplicon sequencing in Ion Torrent PGM (Tumor-blood pairs=16) and Illumina HiSeq 2500 (Tumor-blood pairs =48), respectively; and, 14,190X for whole genome sequencing in Illumina HiSeq 2500 (Tumor-blood pairs =25). Associations of mutation data with important clinical aspects have been found.

  Study EGAS00001002425

• RNA sequencing of PTCL-NOS

  Study EGAS00001005015

• WGS of CTCs enriched using high-throughout microfluidic device from entire cancer patient leukopak

  Single-cell low-pass WGS analysis (illumina platform, PE150, 1-2x coverage) was performed on CTCs enriched using high-throughout microfluidic device from entire leukopak from patients with metastatic prostate cancer (GU-1 and GU-2) and metastatic hepatocellular carcinoma (HCC-1 and HCC-2).

  Study EGAS50000000723

• Paraganglioma Smart-Seq2 Single Nuclei Sequencing Data

  Paraganglioma is a rare neuroendocrine tumor that originates from chromaffin cells of the adrenal medulla or extra-adrenal paraganglia. This study aims to investigate the heterogeneity of this tumor and to identify potential biomarkers associated with its malignancy. To achieve this, we performed single-nucleus RNA sequencing of human paraganglioma samples using the SMART-Seq2 protocol.

  Study EGAS50000001184

• Molecular Signatures of DCIS to Invasive Progression for Basal-Like Breast Cancers: An Integrated Mouse Model and Human Tumor Study

  We studied the genomic signatures of progression in breast ductal carcinoma in situ (DCIS) as it progresses towards triple negative invasive breast cancer (TNBC). Single cell RNA sequencing (scRNAseq) was performed on the C3Tag genetically engineered mouse model that forms human breast-like DCIS and TNBC. Bulk RNA sequencing was performed on RNA harvested from archival formalin-fixed, paraffin embedded (FFPE) pairs comprising of estrogen receptor (ER) positive (ER+) and negative (ER-) subsets of DCIS. 

  Study phs002443

• Genome-Wide Association Studies of Prematurity and Its Complications (African American)

  Preterm delivery resulting in the birth of a premature infant is a complex problem with a devastating impact on individuals, families and society. The prevalence of preterm birth has increased steadily in developed countries over the last 20 years and more than three million children die of preterm birth worldwide each year. Despite the importance of the problem and its disproportionate occurrence in poor and minority populations, the underlying causes have been difficult to identify. Spontaneous preterm labor has as its suspected triggers infection, stress, poor nutrition and inherited factors. The single best predictor for preterm delivery is a previous preterm birth. Studies of twins and of recurrences within families provide evidence that genetic factors underlie a substantive component of the risk for prematurity. One major challenge in studying genetic factors in prematurity is that the risk case is not truly established. The genetic risk could reside either in the mother and her uterus or in the infant/placenta. Identification of genetic factors in the mother and/or infant could provide insights into identifying relevant environmental covariates that may be more amenable to rapid interventions but difficult to find using standard epidemiology alone. A comprehensive genome-wide association study (GWAS) is the ideal way to identify those genes that would not be suspected based on our current understanding of the biology of parturition. We are using 2200 African American samples with term or preterm labor. A subset of these (~800) are infant samples recruited by the Neonatal Research Network as part of a study on cytokines and infection in extremely low birth weight infants (Schelonka RL, et al., 2011. PMID: 21145756). Therefore, this group consists of infants <1,000 grams with clinical outcome data for the infant allowing study of the genetic contributors for not only preterm birth but also the complications that often accompany preterm birth. The result will enable a better understanding of the biology of parturition and suggest environmental modifications that can prolong gestations to improve neonatal and adult outcomes. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to preterm birth through large-scale genome-wide association studies of African-American cases and controls from multiple sites in the United States. Genotyping was performed at the Johns Hopkins University Center for Inherited Disease Research (CIDR). Data cleaning and harmonization were done at the GEI-funded GENEVA Coordinating Center at the University of Washington.

  Study phs000353

• Sequencing of in vitro generated macrophages and T cells

  Monocyte derived macrophages were polarised into M1 or M2 using IFNg+ ILP or IL-4 respectively (n =4) . Pan T cells were cultured with or without IL-2 for 4 days (n=4 - 6). Pan T cells were co-cultured with THP1 tumour cells for 20 hours in the presence or absence of ImmTAC molecules and in the presence or absence of M2 macrophages. Sorted T cells and macrophage populations prior and post co-culture were analysed by bulk RNA sequencing (60 million reads per sample) using the Illumina NovaSeq system.

  Study EGAS50000000837

• TRACERx 100: metastatic samples

  Whole exome sequencing of 10 metastatic biopsies from four TRACERx100 patients (see EGA dataset EGAS00001002247), collected either after relapse or death. The data from these samples are initially published with Abbosh, C. et al. Phylogenetic ctDNA analysis depicts early stage lung cancer evolution. Nature http://dx.doi.org/10.1038/nature22364 (2017). Abstract: Earlier detection of relapse following primary surgery for non-small cell lung cancer and the characterization of emerging subclones seeding metastatic sites might offer new therapeutic approaches to limit tumor recurrence. The potential to non-invasively track tumor evolutionary dynamics in ctDNA of early-stage lung cancer is not established. Here we conduct a patient-specific approach to ctDNA profiling in the first 100 lung TRACERx (TRAcking Cancer Evolution through therapy (Rx)) study participants, including one patient co-recruited to the PEACE (Posthumous Evaluation of Advanced Cancer Environment) post-mortem study. We identify independent predictors of ctDNA release in early-stage non-small cell lung cancer and perform tumor volume limit of detection analyses. Through blinded profiling of post-operative plasma, we observe evidence of adjuvant chemotherapy resistance and identify patients destined to experience recurrence of their lung cancer. Finally, we show that phylogenetic ctDNA profiling tracks the subclonal nature of lung cancer relapse and metastases, providing a new approach for ctDNA driven therapeutic studies.

  Study EGAS00001002415

• MutWP1__CRUK_Grand_Challenge_Mutographs_of_Cancer__head___neck

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, the International Agency for Research on Cancer is coordinating the recruitment of 5000 individuals with cancer (colorectal, renal, pancreatic, oesophageal adenocarcinoma or oesophageal squamous cancers) across 5 continents to explore whether different mutational signatures explain marked variation in incidence. In brief, through an international network of collaborators around the world, biological materials are collected, along with demographic, histological, clinical and questionnaire data. Whole genome sequences of tumour-germline DNA pairs are generated at the Wellcome Trust Sanger Institute. Non-tumour DNA is also studied for some cancer types. Somatic mutational signatures are subsequently extracted by non-negative matrix factorisation methods and correlated with risk factors data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001005450

• Pediatric Investigation for Genetic Factors Linked with Renal Progression (PediGFR)

  The Pediatric Investigation for Genetic Factors Associated with Renal Progression (PediGFR) (RO1-DK082394) is an international collaborative study among three large prospective cohort studies of children with chronic kidney disease. The participating parent cohort studies are the Chronic Kidney Disease in Children (CKiD), the Effect of Strict Blood Pressure Control and ACE Inhibition on CRF Progression in Pediatric Patients (ESCAPE), and the Cardiovascular Comorbidity in Children with Chronic Kidney Disease (4C) study. In these cohorts, pediatric subjects with CKD have been prospectively followed with standardized measurements for renal progression. The dbGaP data upload will utilize the structure of sub-studies to include the genotype and baseline phenotype for the three cohorts, as well as the RBC trait and anemia data for a sub-study under PI Susan Furth: Role of Genetic Variation in the Anemia of Chronic Kidney Disease (K24DK078737). In brief PediGFR is a prospective study of children with chronic kidney disease (CKD) to determine genetic factors associated with kidney function measured by the estimated glomerular filtration rate (eGFR) by Schwartz equation. The PediGFR_v2 Cohort is utilized in the following dbGaP sub-studies. To view genotypes, other molecular data, and derived variables collected in these sub-studies, please click on the following sub-studies below or in the "Sub-studies" box located on the right hand side of this top-level study page phs000842 PediGFR_v2 Cohort. phs000843 4C phs000650 CKiD phs000844 ESCAPE

  Study phs000842

• Dataset of 5 RNAseq from 3 non-muscle-invasive bladder cancer patients

  RNAseq (FASTQ files) of 5 tumor from 3 non-muscle-invasive bladder cancer patients. For patient UC2, RNA from 3 different synchronous tumors was extracted. Relating to the other datasets from the project : no RNA was available from patient UC4. NB : patients aliases are the following : ROXY : UC1, OMAD : UC2, MAKI : UC3, HAPE : UC4

  Dataset EGAD50000002009

• Human lymphoma plasma cfRNA - raw data

  This study contains total RNA sequencing data from plasma of 65 different human donors: 30 diffuse large B-cell lymphoma patients, 13 primary mediastinal large B-cell lymphoma patients and 22 cancer-free controls.

  Study EGAS00001007127

• Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Dataset EGAD00001015397

• Targeted_sequencing_of_genes_recurrently_mutated_in_AML

  Background Massively parallel sequencing technology has transformed cancer genomics. It is now feasible, in a clinically relevant time-frame, for a clinically manageable cost, to screen DNA from patient tumours for mutations essentially genome-wide. The challenge for personalised medicine will be to increase the sample size to thousands or tens of thousands of well-characterised cases in order to attain sufficient statistical power to stratify patients accurately across the complexity and genomic heterogeneity expected for most of the common tumour types. Currently, whole genome sequencing on this scale is not feasible, and targeted sequencing of relevant portions of the genome will be required. Pilot data We have developed protocols for large-scale, multiplexed sequencing of 100-200 genes in thousands of samples. Essentially, using robotic technology, genomic DNA from the cancer specimen is processed into sequencing libraries with unique DNA barcodes, thereby allowing sequencing reads to be attributed to the sample they derive from. Currently, these sequencing libraries can be generated in a 96-well format using fully automated protocols, and we are exploring methods to expand this to a 384-well format. The sequencing libraries are pooled and hybridized to custom sets of RNA baits representing the genomic regions of interest. Sequencing of the pulled-down libraries is done in pools of 48-96 samples per lane of an Illumina Hi-Seq. This protocol is already implemented at the Sanger Institute. We have published proof that somatic mutations in novel cancer genes can be identified from exome-wide sequencing. In unpublished pilot data, we have established the feasibility of robotic library production, custom pull-down, and multiplexed sequencing of barcoded libraries for 100 known myeloid cancer genes across 760 myelodysplasia samples. Highlights of the data thus far analysed reveal that the coverage is remarkably even between samples; when 96 samples are run, average coverage per lane of sequencing is ~250, with 90-95% of targeted exons covered by >25 reads; known mutations can be discovered in the data set; and the protocol is amenable to whole genome amplified DNA. The bioinformatic algorithms for identification of substitutions and indels in pull-down data are well-established; we have pilot data proving that copy number changes, LOH and genomic rearrangements in specific regions of interest can also be identified by tiling of baits across the relevant loci. Proposal We propose to apply this methodology to 10000 samples from patients with AML enrolled in clinical trials over the last 10-20 years. Oncogenic point mutations and potentially genomic rearrangements will be identified, and linked to clinical outcome data, with a view to undertaking the following sorts of analyses: • Identification of co-occurrence, mutual exclusivity and clusters of driver mutations. • Correlation of prognosis with driver mutations and potentially gene-gene interactions • Exploration of genomic markers of drug response Ultimately, we would like to be in a position to release the mutation data together with matched clinical outcome data to genuine medical researchers via a controlled access approach, possibly within the COSMIC framework (www.sanger.ac.uk/genetics/CGP/cosmic/). The vision here is to generate a portal whereby a clinician faced with an AML patient and his / her mutational profile can obtain a ‘personalised’ prediction of outcome, together with a fair assessment of the uncertainty of the estimate. With a sufficient sample size, there would also be the potential to develop decision support algorithms for therapeutic choices based on such data.

  Study EGAS00001000408

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• RNA sequencing of periprostatic fat after a 6 month deep androgen deprivation therapy

  Androgen deprivation therapy treated patients (n=11) were recruited from an open label neoadjuvant phase II study in which patients with high-risk disease received a ‘supercastration’ regimen consisting of degarelix 240/80 mg subcutaneously every four weeks; abiraterone acetate 500 mg orally daily titrating upwards every two weeks by 250 mg to a final dose of 1000 mg daily; bicalutamide 50 mg orally daily; and prednisolone 5 mg orally twice daily for a total of 6 months (Australian New Zealand Clinical Trials Registry 12612000772842). Untreated patients with similar pre-treatment characteristics were obtained from a prospective prostatectomy biorepository22,23. Prior to ligation of the dorsal venous complex and prostate pedicles, the anterior prostate was defatted and the specimen was removed immediately, placed in a sterile container and transferred on ice for long-term storage in the vapour phase of liquid nitrogen. A total of 50–100 µg of adipose tissue was separated from fresh frozen samples stored at −160°C. RNA was isolated using the Qiagen RNeasy Lipid Tissue Mini Kit and eluted in 35 µL nuclease-free water. 0.5–1 µg of total RNA was used as the input for cDNA library synthesis using TruSeq RNA Sample Prep Kit v2 (Illumina), and libraries were constructed according to manufacturer’s instructions. Samples were sequenced on a HiSeq 2500 (Illumina) using 101 base paired-end chemistry, aiming for 50 million mapped paired-end reads per sample.

  Dataset EGAD00001004971

• scRNA-seq of HSPC treated with gemcitabine and carboplatin

  4 samples of 2000000 HSPCs in 2 ml media each were then prepared and treated for 24 hours: carboplatin-high: 150 µg/ml carboplatin carboplatin-low: 18.75 µg/ml carboplatin gemcitabine: 25 ng/ml gemcitabine control: no drug Single-cells were subsequently extracted using the ddSEQ™ Single-Cell Isolator (Bio-Rad) and later sequenced using the SureCell™ Whole Transcriptome Analysis 3' Library Prep Kit (Illumina) on the NextSeq 500 System (Illumina) using the NextSeq 500/550 High Output Kit v2.5 150 Cycles (Illumina) all following the manufacturer's instructions. The raw FASTQ-files are available as read 1 and read 2 files from 4 lanes for each sample giving a total of 16 FASTQ-files. The FASTQ-files were also processed following the ddSeeker (Romagnoli, D., et al., BMC Genomics 2018, doi:10.1186/s12864-018-5249-x) and Drop-seq (Macosko, E.Z., et al., Cell 2015, doi:10.1016/j.cell.2015.05.002) protocols for processing scRNA-seq data to yield the final digital gene expression (dge) for each cell of each sample. This has resulted in one dge text file and one dge summary text file per sample. These 8 text-files with dge data are found in the zip-compressed analysis data-file.

  Dataset EGAD00001006080

• Mapping genetic effects on cell type-specific chromatin accessibility using single nucleus ATAC-seq

  Gene regulation is highly cell type-specific and understanding the function of non-coding genetic variants associated with complex traits requires molecular phenotyping at cell type resolution. In this study we performed single nucleus ATAC-seq (snATAC-seq) and genotyping in peripheral blood mononuclear cells from 13 individuals. We mapped chromatin accessibility QTLs (caQTLs) in each immune cell type and sub-type in a subset of 10 samples of European genetic ancestry.

  Study EGAS00001006184

• Effects of 2DG, Galactose, or Oligomycin on the epigenome remodeling induce by T cells activation.

  T cell activation is known to require a metabolic shift towards glycolysis, triggered by TCR-engagement . To substantiate the role of glycolysis in transcriptional reprogramming during antigen-driven T cell activation, we utilized a well-established ex-vivo model to recapitulate the process of antigen stimulation without the requirement for additional antigen-presenting cells . We initially explored and validated the conditions for both metabolic and epigenetic reprogramming. Antigen-mediated CD4+ T cells activation initiates context-specific gene-expression programs that drive effector functions and cell fates through changes in the epigenetic landscape . To evaluate global changes in histone modifications, we isolated CD4+ T cells from peripheral blood (PB) of healthy control (HC) human donors and either maintained them in resting conditions or stimulated with anti-CD3/CD28 for 24h. Rapid changes in the CD4+ epigenome and transcriptome were observed within 24h as measured by RNA-sequencing (RNA-seq) and H3K27ac chromatin immunoprecipitation followed by DNA-sequencing (ChIP-seq).To explore the requirement for metabolic reprogramming in regulating transcriptional responses after initial TCR engagement, CD4+ T cells from PB of healthy donors were isolated and activated in either the presence or absence of oligomycin (inhibitor of ATP synthase blocking the production of ATP by OXPHOS), 2-deoxyglucose (2DG; competitively inhibiting production of glucose-6-phosphate from glucose), or replacement of glucose with galactose. Galactose is metabolized through glycolysis, utilizing the Leloir pathway which is energy neutral, forcing cells to use all the pyruvate production to sustain the TCA cycle for OXPHOS and ATP synthesis at the expense of lactate production. Employing ChIP-seq and RNA-seq, inhibition of OXPHOS-mediated ATP production by oligomycin had only a limited effect on H3K27-acetylation or activation-induced transcription during the first 24h of activation. In contrast, inhibition of glycolysis by 2DG treatment compromised both H3K27-acetylation and transcriptional changes. However, under conditions of galactose-metabolism where lactate production is abrogated, activated CD4+ T cells were still able to globally remodel H3K27 acetylation and reprogram the transcriptome.

  Study EGAS00001007115

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354

• GTestimate: Improving relative gene expression estimation in scRNA-seq using the Good-Turing estimator

  This study introduces a novel scRNA-seq normalization method, which takes unobserved genes into account. To validate GTestimate we designed a cell targeted amplification strategy, enabling us to sequence a small set of cells twice, once at a "typical" sequencing depth and once at a "ultra-deep" sequencing depth.

  Study EGAS50000000915

• Data access committee for "Detection of brain cancer using genome-wide cell-free DNA fragmentomes"

  The data access committee for “ Detection of brain cancer using genome-wide cell-free DNA fragmentomes”. The DAC is comprised of Drs. Dimitrios Mathios, Jillian Phallen, Victor Velculescu, Robert Scharpf, Noushin Niknafs, and Shashikant Koul, and can be contacted at skoul3@jh.edu.

  Dac EGAC50000000605

• DNA WGS Short Read Sequence (Illumina NovaSeq) for manuscript titled: "Performance of Somatic Structural Variant Calling in Lung Cancer using Oxford Nanopore Sequencing Technology"

  DNA WGS Short Read Sequence (Illumina NovaSeq) for manuscript titled: "Performance of Somatic Structural Variant Calling in Lung Cancer using Oxford Nanopore Sequencing Technology"

  Dataset EGAD00001015399

• Single-cell characterization of human GBM reveals regional differences in tumor-infiltrating leukocyte activation

  Raw sequencing files from scRNA-seq dataset used in Schmassmann et al. 2023. Single-cell characterization of human GBM reveals regional differences in tumor-infiltrating leukocyte activation. Elife 12 (https://elifesciences.org/articles/92678) Dataset content: 14 samples from 5 donors File type: paired-end fastq files Technology: Illumina sequencing Experimentation used: scRNA-seq using the 10X technology

  Dataset EGAD50000000434

• Subtype specific studies of breast cancer progression. Milan cohort.

  The aim of this study is to compare DCIS and IBC in a subtype stratified manner in several genomic levels (gene expression, copy number, methylation).The data in this archive is supplementary to previously published data.

  Study EGAS00001004390

• Dataset for hematopoietic_malignancy-WHOLE_GENOME

  Rare cancer sequencing data of 49 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008881

• Dataset for leiomyosarcoma-WHOLE_GENOME

  Rare cancer sequencing data of 66 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008887

• Dataset for bone_cancer-EXON

  Rare cancer sequencing data of 87 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008865

• Dataset for leiomyosarcoma-EXON

  Rare cancer sequencing data of 96 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008885

• Dataset for upper_gastrointestinal_tumor-EXON

  Rare cancer sequencing data of 85 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008902

• Dataset for other_cancer-WHOLE_GENOME

  Rare cancer sequencing data of 49 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008895

• Identification of early disease progression in ALK-rearranged lung cancer using circulating tumor DNA analysis (hipo_K34R)

  Study EGAS00001005327

• Multi-omic analysis of the tumor microenvironment shows clinical correlations in Ph1 study of atezolizumab +/- SoC in MM

  Multiple myeloma (MM) remains incurable, and treatment of relapsed/refractory (R/R) disease is challenging. There is an unmet need for more targeted therapies in this setting; deep cellular and molecular phenotyping of the tumor and microenvironment in MM could help guide such therapies. This phase 1b study (NCT02431208) evaluated the safety and efficacy of the anti-programmed death-ligand 1 monoclonal antibody atezolizumab (Atezo) alone or in combination with the standard of care (SoC) treatments lenalidomide (Len) or pomalidomide (Pom) and/or daratumumab (Dara) in patients with R/R MM. Study endpoints included incidence of adverse events (AEs) and overall response rate (ORR). A novel unsupervised integrative multi-omic analysis was performed using RNA sequencing, mass cytometry immunophenotyping, and proteomic profiling of baseline and on-treatment bone marrow samples from patients receiving Atezo monotherapy or Atezo+Dara. A similarity network fusion (SNF) algorithm was applied to preprocessed data. Eighty-five patients were enrolled. Treatment-emergent deaths occurred in 2 patients; both deaths were considered unrelated to study treatment. ORRs ranged from 11.1% (Atezo+Len cohorts, n=18) to 83.3% (Atezo+Dara+Pom cohort, n=6). High-dimensional multi-omic profiling of the tumor microenvironment and integrative SNF analysis revealed novel correlations between cellular and molecular features of the tumor and immune microenvironment, patient selection criteria, and clinical outcome. Atezo monotherapy and SoC combinations were safe in this patient population and demonstrated some evidence of clinical efficacy. Integrative analysis of high dimensional genomics and immune data identified novel clinical correlations that may inform patient selection criteria and outcome assessment in future immunotherapy studies for myeloma.

  Study EGAS00001007286

• Neuroblastoma patient Total RNA Seq data

  Tumor Total RNA Seq data of primary neuroblastomas. This is an update of the „Berlin Neuroblastoma Dataset” (EGAS00001004022). This data was used for the analysis of circular RNA expression and regulation in neuroblastoma.

  Dataset EGAD00001008124

• minION fastq files of 10 different tumor samples from the Master program (H021)

  Nanopore RNA Sequencing was done for 10 tumor samples. Direct cDNA sequencing was performed using the SQK-DCS109 kit (Oxford Nanopore Technologies). For analysis of a single sample on a MinION flow cell (version R9.4.1), 5 μg RNA was used as input. For multiplexing on a MinION flow cell, 2.5 μg RNA per sample was used as input, and the native barcoding expansion kit EXP-NBD104 was employed in conjunction with SQK-DCS109. After reverse transcription with Maxima H Minus Reverse Transcriptase (Thermo Scientific), second-strand synthesis was performed using the 2x LongAmp Taq Master Mix (New England Biolabs). The resulting double-stranded cDNA was subjected to end-repair and dA-tailing using the NEBNext Ultra End Repair/dA-Tailing Module (New England Biolabs). For multiplexed libraries, this step was followed by barcode ligation and library pooling. Next, libraries were quantified with a Qubit Fluorometer 3.0 (Life Technologies). Finally, sequencing adapters were added to the library preparations and ligated with Blunt/TA Ligase Master Mix (New England Biolabs), followed by further quality control using a Qubit. Samples ACC1 and ACC2 were analyzed on individual MinION flow cells, while the remaining eight samples were sequenced as multiplexed libraries on two MinION flow cells by pooling four samples for each run. Five ACC samples were also analyzed individually on Flongle flow cells

  Dataset EGAD00001008970

• MutWP1__CRUK_Grand_Challenge_Mutographs_of_Cancer__pancreas

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, the International Agency for Research on Cancer is coordinating the recruitment of 5000 individuals with cancer (colorectal, renal, pancreatic, oesophageal adenocarcinoma or oesophageal squamous cancers) across 5 continents to explore whether different mutational signatures explain marked variation in incidence. In brief, through an international network of collaborators around the world, biological materials are collected, along with demographic, histological, clinical and questionnaire data. Whole genome sequences of tumour-germline DNA pairs are generated at the Wellcome Trust Sanger Institute (Illumina HiSeqX, 40X and 20X depth respectively). Somatic mutational signatures are subsequently extracted by non-negative matrix factorisation methods and correlated with risk factors data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001002726

• MutWP1__CRUK_Grand_Challenge_Mutographs_of_Cancer__Oesophageal_squamous_cell_carcinoma

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, the International Agency for Research on Cancer is coordinating the recruitment of 5000 individuals with cancer (colorectal, renal, pancreatic, oesophageal adenocarcinoma or oesophageal squamous cancers) across 5 continents to explore whether different mutational signatures explain marked variation in incidence. In brief, through an international network of collaborators around the world, biological materials are collected, along with demographic, histological, clinical and questionnaire data. Whole genome sequences of tumour-germline DNA pairs are generated at the Wellcome Trust Sanger Institute (Illumina HiSeqX, 40X and 20X depth respectively). Somatic mutational signatures are subsequently extracted by non-negative matrix factorisation methods and correlated with risk factors data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001002725

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• RNASeq profiles of ROBUST clinical trial and processed WGS mutation calls output

  The dataset contains RNAseq profiles of 1040 patients from the ROBUST clinical trial (NCT02285062). The Allprep DNA/RNA FFPE kit was used to simultaneously purify genomic DNA and total RNA from formalin-fixed, paraffin embedded (FFPE) tissue sections. RNAseq libraries (75PE, 50M) were constructed using Illumina TruSeq RNA Access method. Fastq files are included. Also includes processed WGS mutation calls output.

  Dataset EGAD50000000482

• RNA Sequencing of Control and Myotonic Dystrophy Type 1 Cells During Myogenic Differentiation

  To investigate gene expression dynamics during myogenic differentiation in myotonic dystrophy type 1, RNA was collected from immortalized control, patient-derived, and CRISPR/Cas9-corrected myoblasts at proliferation (day -2) and at days 1 and 5 of differentiation. High-quality RNA was isolated and sequenced using poly(A)-enriched or rRNA-depleted protocols, yielding 100 bp paired-end reads with high coverage. A subset of samples at day 1 underwent deeper sequencing to enhance transcriptome resolution.

  Dataset EGAD50000001647

• Using RNA-sequencing to characterize the resistance to lirafugratinib

  In addition to Exome-sequencing, we used RNA-sequencing to also characterize resistance to lirafugratinib with whole exome sequencing in patients with FGFR2-driven cancers, treated in the phase 1/2 ReFocus trial (NCT04526106) and enrolled in the UNLOCK program at Gustave Roussy

  Study EGAS50000001370

• Single-cell RNA sequencing of erythroid and megakaryocytic acute myeloid leukemia patient cells

  Single-cell RNA sequencing was performed on bone marrow mononuclear cells of a patient with acute myeloid leukemia with erythroid differentiation of the blasts and on peripheral blood mononuclear cells of a patient with acute myeloid leukemia with megakaryocytic differentiation of the blasts. The dataset contains raw fastq files of these two samples with single-cell RNA sequencing performed using the 10x Genomics platform.

  Dataset EGAD00001009865

• Single molecule genome-wide mutation profiles of cell-free DNA for non-invasive detection of cancer

  Somatic mutations are a hallmark of tumorigenesis and may be useful for non-invasive diagnosis of cancer. We analyzed whole-genome sequencing (WGS) data from 2,511 individuals in the Pan-Cancer Analysis of Whole Genomes (PCAWG) study as well as 489 individuals from four prospective cohorts and found distinct regional and mutation type specific frequencies in tissue and cell-free DNA (cfDNA) of cancer patients that were associated with replication timing and other chromatin features. A machine learning model using genome-wide mutational profiles combined with other features and followed by CT imaging detected >90% of lung cancer patients, including those with stage I and II disease. The fixed model was validated in an independent cohort, detected patients with cancer earlier than standard approaches, and could be used to monitor response to therapy. This approach lays the groundwork for non-invasive cancer detection using genome-wide mutation features that may facilitate cancer screening and monitoring.

  Study EGAS00001007248

• Identification of molecule relationship between intravenous leiomyomatosis and uterus myoma

  Up to now, there are two hypothesis about the pathogenesis of the relationship of intravenous leiomyomatosis and uterine myoma. One theory suggests that the IVL comes from the smooth muscle cell in the vessel wall.The other theory indicates that the IVL derives from the uterine myometrium. However, limited to the technology, few studies have been deeply explore the underlying relation. In this study, we employ the RNA sequencing to explore the molecule relationship between IVL and uterus myoma. In order to identify the molecule relationship between IVl and uterine myoma we conducted transcriptome sequencing and bioinformaitc analysis

  Dataset EGAD00001003356

• End motifs analysis of circulating DNA from the plasma of patients with stage II-III breast cancer (n=50), stage I-III non-small cell lung cancer (n=56), metastatic colorectal cancer (mCRC) (n=15) and healthy individuals (n=37)..

  We have developed an algorithm designed to discriminate cancer patients and healthy individuals based on cirDNA fragment end motif analysis assisted by machine learning, using data obtained from shallow whole genome sequencing (a method we call EMA). We applied EMA to cirDNA from the plasma of patients with stage II-III breast cancer, stage I-III non-small cell lung cancer, and metastatic colorectal cancer (mCRC). CirDNA from 158 individuals was prepared following the conventional double-stranded DNA library preparation (DSP). We also performed a single-stranded DNA library preparation (SSP) using mCRC patients and healthy control cirDNA, which allowed us to make the first ever end motif analysis in the literature which compares the use of DSP and SSP.

  Study EGAS50000001319

• Genome-wide cell-free DNA biological patterns in patients with cancer

  The structure of cell-free DNA (cfDNA) is altered in the blood of cancer patients. From whole genome sequencing we retrieved the cfDNA fragment-end composition using a new software (FrEIA), as well as the cfDNA size and tumor fraction in three independent cohorts (n=925 cancer from >10 types and 321 control samples). At 95% specificity, we detect 72% of cancer samples using at least one cfDNA measure, including 64% of early-stage cancer (n=220). cfDNA detection correlates with a shorter overall (p=0.018) and recurrence-free (p=0.006) survival in patients with resectable esophageal adenocarcinoma. Integrating cfDNA measures with machine learning in an independent test set (n=396 cancer, 90 controls) achieve a detection accuracy of 82% and AUROC of 96%. In conclusion, harnessing the biological features of cfDNA can improve at no-extra cost the diagnostic performance of liquid biopsies.

  Study EGAS00001007400

• miRNASeq profiles from Indian HFrEF Cohort

  The dataset contains miRNA profiling from a cohort of 49 HFrEF patients. The myocardium samples were collected from these patients during heart transplant of LVAD implantation procedure. The RNA samples were collected in RNAlater. Small RNA libraries were prepared using QIAseq miRNA Library Kit, Qiagen and sequenced on Illumina HiSeq4000.

  Dataset EGAD50000001194

• Dicer and/or ADAR1 depleted HEK293-LGP2 cells

  This dataset includes bulk RNA-sequencing data from HEK293-L cells subjected to siRNA-mediated knockdown of Dicer and/or ADAR1. In total, 12 samples are included, representing four experimental groups with triplicate biological replicates. RNA was extracted using TRIzol according to standard protocols and sequenced on an Illumina NovaSeq 6000.

  Dataset EGAD50000002044

• Single-cell RNA sequencing of acute myeloid leukemia patients

  Single-cell RNA sequencing was performed on bone marrow mononuclear cells from 8 acute myeloid leukemia patients at diagnosis. The profiling was performed using 10x Genomics 3' (5 samples) and 5' (3 samples) platforms. The raw data are available as fastq files.

  Dataset EGAD00001006173

• Single cell RNA-sequencing of treatment naïve PDAC patient samples

  Single cell RNA-sequencing of treatment naïve PDAC patient samples. We have 10 samples, sequenced using the 10X genomics chromium platform with 3 prime chemistry. We are submitting FASTQ files representing the index files (I1), Read1 (R1) and Read2 (R2).

  Dataset EGAD00001008961

• Small molecule screen reveals synergy of cell cycle checkpoint kinase inhibitors with DNA-damaging chemotherapies in medulloblastoma (methylation dataset)

  human medulloblastoma xenograft isolated from mouse brain was frozen and genomic DNA or RNA was extracted. Bisulfite converted DNA was processed and hybridised to illumina EPIC or 450K arrays using standard protocols. RNAseq was performed on total RNA.

  Dataset EGAD00001006583

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• Assessment of epigenetic variation in human iPS cells-Medip

  n order to progress human induced pluripotent stem cells (hiPSCs) towards the clinic, several outstanding questions must be addressed. It is possible to reprogram different somatic cell types into hiPSCs and from studies in the mouse, it appears that an epigenetic memory of the starting cell type is carried over to hiPSCs. However a comprehensive comparative study of the characteristics of these hiPSCs has been missing from the literature. Importantly studies which aimed to address these aspects of hiPSCs have used cells from different patients. In order to avoid this important confounding variable and to keep the genetic background constant, tissue samples were procured from the patients and reprogrammed to iPS cells. The methylation status of these iPS cells will be compared. Protocol: Primary cell cultures were generated and reprogrammed to iPS cells. DNA was extracted and immunoprecipitated using anti-methyl cytosine and anti-hydroxymethyl cytosine antibodies. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Dataset EGAD00001000827