10648 results for "fc coins olx Navštivte Buyfc26coins.com Podpora pro profesionální hráče a týmy..zSiZ"

in 35.82 milliseconds.

• Whole_genome_sequencing_of_a_Grem1_mutant_human_tumour

  The BMP antagonist Grem1 has been shown to be associated with a rare human polyposissyndrome (HMPS). We have shown that there is a 40KB duplication on chrom 15 found insome patients with HMPS. Traditional serrated adenomas (rare sporadic polyps) share somemorphological features with HMPS polyps and it has long been hypothesised that they are thesporadic version of HMPS polyps. We have obtained of one of theselesions and in this project we aim to characterise this tumour.

  Study EGAS00001000562

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Much ado about nothing? - Off-target amplification can lead to false positive bacterial brain microbiome detection in healthy and Parkinson's disease individuals

  Recent studies suggested the existence of (poly-)microbial infections in human brains. Using 16S rRNA gene amplicon sequencing, we tested the hypothesis that there is a bacterial brain microbiome. We evaluated brain samples from healthy human subjects and individuals suffering from PD (olfactory bulb and pre-frontal cortex). We identified off-target amplification as a major confounding factor in low-bacterial/high-host-DNA scenarios.

  Study EGAS00001004757

• Spatial Heterogeneity in CLL

  A whole-genome/exome sequencing (WGS/WES) characterization of the spatial heterogeneity found in chronic lymphocytic leukemia (CLL) at diagnosis. Fifteen synchronous peripheral blood and lymph node samples were analyzed by WGS (n=2) or WES (n=13). Subtle differences in the global architecture of the tumor at peripheral blood and lymph node were observed only in a fraction of patients. Spatial heterogeneity was not found among the well-established CLL driver alterations.

  Study EGAS00001003803

• Distinct genomic profile and specific targeted drug responses in adult cerebellar glioblastoma

  Only a few studies have reported the molecular characteristics of adult cerebellar glioblastoma (C-GBM), a subtype comprising 1% of glioblastoma cases located within the infratentorial brain region due to the rarity. By identifying genomic profiles from 19 adult C-GBM samples, we revealed the genetic intertumoral heterogeneity in C-GBM as well as distinct genomic characteristics from those of supratentorial glioblastomas (S-GBMs), emphasizing the need of individualized therapies for C-GBM patients.

  Study EGAS00001002517

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• Whole-exome sequencing of ovarian clear cell carcinoma in clinical outliers

  Whole-exome sequencing dataset for the Australian Ovarian Cancer Study (AOCS) and The Jikei University School of Medicine (JIKEI) ovarian clear cell carcinoma (OCCC) clinical outliers project, representing 10 donors. Although OCCC are commonly resistant to platinum based chemotherapy, good clinical outcomes are observed in a subset of patients. Exome sequencing was performed in 10 patients who had either unusually long survival (N=5) or had a very short time to progression (N=5).

  Study EGAS00001004248

• Targeted sequencing of paired tumour/blood of 34 T1 stage bladder cancer patients

  Stage T1 bladder cancer presents a high risk of progression and requires improved understanding. In continuation of our whole-exome sequencing study on this subtype of the disease, we carried out this targeted paired tumour/blood sequencing study including 34 T1 stage bladder cancer patients. Agilent’s SureDesign tool was used to design a 1.133 Mb SureSelect custom capture for all coding exons of the 140 selected candidate genes.

  Study EGAS00001005767

• EXCEED Study

  EXCEED is a longitudinal population-based cohort which facilitates investigation of genetic, environmental and lifestyle-related determinants of a broad range of diseases and of multiple morbidity through data collected at baseline and via electronic healthcare record linkage. Recruitment has taken place in Leicester, Leicestershire and Rutland since 2013 and is ongoing, with approximately 10,000 participants aged 30-69 to date. The population of Leicester is diverse and additional recruitment from the local South Asian community is ongoing.

  Study EGAS00001003499

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Nasal epithelial cells of PCD and non-PCD patients grown at air-liquid interface for RNAseq analysis

  Raw RNAseq data files of genetically unsolved PCD patients used for transcriptomic analysis aming to uplift the diagnostic rate. The non-PCD patients were used as a clinical comparator to the PCD patients. Majority of the nasal epithelial cells used for RNAseq were cultured at an air-liquid interface for 21 days, unless the data file name indicates a different air-liquid-culture time-point.

  Study EGAS00001006632

• Somatic mutation and clonal evolution in premalignant lung disease - WGS (2020-01-15)

  Cancer is a genetic disease caused by an accumulations of mutations, however many of these mutations have been identified in pathologically normal tissue. We aim to use laser-capture microscopy (LCM) to sample individual clones from the lung tissue of individuals with a variety of lung diseases (COPD, UIP, IPF, Emphysema, pulmonary hypertension). This will allow us to identify whether cancer-associated mutations appear in this normal tissue, assess the mutational burden present, and identify the mutational processes causing these mutations. Smoking is a large risk factor for developing many of these lung diseases so we are particularly keen to determining whether there is evidence of a smoking signature in these patients. . This dataset contains all the data available for this study on 2020-01-15.

  Dataset EGAD00001005786

• Evaluating gene expression in aggressive B-cell lymphoma using a quantitative nuclease protection assay

  Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma (NHL), comprising 25-30% of all NHL in developed countries with an annual incidence in the USA of 7 cases/100000 persons/year. Collectively, DLBCL is classified based on a common morphological appearance of diffuse growth of large transformed B-cells, immunophenotype, high proliferation rate and aggressive behaviour. Despite these similarities, DLBCLs are a heterogeneous collection of malignancies with distinct clinical and molecular characteristics that do not always correlate with immunohistological features. This gene expression dataset includes transcriptomes of ABC-DLBCLs and of GCB-DLBCLs where cell of origin is determined by the HTG-EdgeSeq quantitative nuclease protection assay. Also included are clonality results from BCR profiling from high-grade B-cell lymphomas sequenced using a NOVA sequencer

  Dataset EGAD00001011309

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• Organ maturation in preparation for birth (Peds RFA) to develop a tissue resource and a single-cell atlas of organ development and maturation for dissemination among the scientific and clinical community: RNA (2025-10-14)

  Knowledge about abnormal organ development is important to understand pathology and to develop novel treatment approaches for individuals with congenital and acquired disease. Most of our current understanding is based on examination of tissues from the embryo and early foetus, collected from women undergoing termination of pregnancy in the first trimester (third) of pregnancy. There is very little known about normal and abnormal organ development from a developmental perspective during the crucial last two-thirds of pregnancy when much remodelling of foetal tissues occurs. This study will generate a single-cell atlas of late-foetal lungs, blood, heart, bone and immune organs. . This dataset contains all the data available for this study on 2025-10-14.

  Dataset EGAD00001015737

• Variant calling analysis of cfDNA whole exome sequencing in neuroblastoma

  This dataset contains VCF files from a variant calling analysis of 19 neuroblastoma patients. WES or WGS data of the primary tumor were compared to WES cfDNA analysis at the time of diagnosis and at a 2nd timepoint (complete remission, partial remission, disease progression or relapse). For 4 patients, WGS of germline, tumor at diagnosis and tumor at relapse DNA was performed on Illumina HiSeq2500, with 100-bp paired-end reads. For the other patients, WES was performed using either an AgilentSureSelect Human All Exon v5 or a Roche Nimblegen SeqCap EZ Exome V3 kit on Illumina HiSeq2000, with 100-bp paired-end reads. SNVs observed in any of the primary tumors or cfDNA samples studied by WES were targeted using a capture sequencing panel at all intermediate time points.

  Dataset EGAD00001003803

• Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria (2018-03-14)

  Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria. There are more than 100 genes known for congenital disorders of glycosylation and new disorders are discovered each year. WE included patients with a so far unsolved glycosylation disease. The diagnostic group 3-methyglutaconic aciduria is a heterogenous group of disorders mostly caused by abnormal phospholipid synthesis or in association with mitochondrial dysfunction. We included patients with a so far unsolved disease and 3-methylglutaconic aciduria. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ . This dataset contains all the data available for this study on 2018-03-14.

  Dataset EGAD00001004038

• Acquisition of additional mutations drives accelerated progression of NPM1 positive CMML to AML

  This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ We performed exome sequencing on serial samples from a patient with CMML who progressed to AML. The exome sequencing suggests that NPM1, TET2 and DNMT3a mutations were present in the dominant clone in the CMML sample and that NRAS is a new subclonal mutation in the AML sample. Diagnostic data shows the presence of a FLT3-ITD mutation in the AML sample, which is likely to have driven progression. Here we are performing re-sequencing of the putative driver and some passenger mutations which appear to be in the same clone to validate these mutations and to verify the relative quantification of these abnormalities .

  Dataset EGAD00001002194

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• Genetic scoring guide for personalized risk assessment in pediatric B-cell precursor Acute Lymphoblastic Leukemia

  In this study a next-generation sequencing based method was applied to comprehensively screen for recurrent, disease-relevant copy number aberrations in a cohort of Hungarian patients. Diagnostic bone marrow samples from 260 children with B-cell acute lymphoblastic leukemia and were investigated by digital multiplex ligation-dependent probe amplification using the disease-specific D007 probemix. Whole chromosome gains and losses, as well as subchromosomal copy number aberrations were simultaneously profiled.

  Study EGAS00001007239

• Clonal_selection_after_gene_therapy_in_SCD___Duplex_sequencing

  This study includes the targeted duplex sequencing data relating to this study. A custom targeted panel was used including 29 AML-associated genes, and a set of mutations from driver-containing clones that were sequenced during the WGS tree-building phase of the study. Targeted sequencing is performed on each of 6 individuals included at the study at at least 3 time points per individual: one prior to gene therapy, and two post-therapy time points.

  Study EGAS00001007253

• RNA sequencing in primary human macrophages overexpressing ETS2

  We investigated an intergenic haplotype on chr21q22, linked to five different inflammatory diseases, and discovered a mechanism that orchestrates macrophage responses during chronic inflammation. We delineated how the risk haplotype increases expression of the causal gene, ETS2, and demonstrated that ETS2 is necessary for inflammatory macrophage effector functions. To establish whether ETS2 is sufficient to drive inflammatory responses, we overexpressed ETS2 in a dose-dependent manner and performed RNA-sequencing to characterise the transcriptional effects.

  Study EGAS00001007554

• eMERGE Network Phase III Clinical Sequencing: eMERGEseq Panel

  The Electronic Medical Records and Genomics (eMERGE) Network is a National Institutes of Health (NIH)-organized and funded consortium of U.S. medical research institutions. The primary goal of the eMERGE Network is to develop, disseminate, and apply approaches to research that combine biorepositories with electronic medical record (EMR) systems for genomic discovery and genomic medicine implementation research. eMERGE was announced in September 2007 and began its third phase in September 2015. eMERGE III consists of nine study sites, two central sequencing and genotyping facilities, and a coordinating center. eMERGE Phase III aims to: 1) sequence and assess the phenotypic implication of rare variants in a custom designed eMERGEseq panel consisting of 109 genes (including 56 ACMG actionable finding list genes and the top 6 genes from each site relevant to their specific aims), as well as approximately 1400 SNPs; 2) assess the phenotypic implications of these variants by developing, validating and implementing new phenotype algorithms, 3) integrate genetic variants into EMRs to inform clinical care; and 4) create community resources. Included in this study are: ~24,000 eMERGE participants from 10 eMERGE III study sites. Corresponding demographics, body mass index measurements. Top PheWAS codes generated from a collated list of ICD codes from all study sites. Study sites and participants include: Cincinnati Children's Hospital Medical Center (CCHMC): Cincinnati Children's Hospital Medical Center (CCHMC) is a not-for-profit hospital and research center pioneering breakthrough treatments, providing outstanding family-centered patient care and training healthcare professionals for the future, and dedicated to improving health and welfare of children and to the shared purpose of discovery and practical application of new genomic information to the ordinary care of children. We bring a comprehensive electronic health record (EPIC), a deidentified i2b2 data warehouse of 680K patient records, a biobank with >261,000 consents that allow return of results to >84,000 patients and guardians who have provided DNA samples, and hundreds of faculty and senior staff who make genomics or informatics an active focus of their research. CCHMC will help the eMERGE III Steering Committee identify genes for the eMERGE III targeted sequencing panel, provide 3,000 DNA samples from CCHMC patients to be sequenced, review targeted gene panels from clinical care at CCHMC for somatic mosaicism and reinterpretation, and further develop and disseminate a software workflow suite for sequence analysis. We will also extend our work generating phenotype algorithms using heuristic and machine learning methods to many new childhood diseases. We will develop tools to evaluate adolescent return of results preferences, examine the ethical and legal obligations and potential to reanalyze results, and develop clinical decision support for phenotyping, test ordering, and returning sequencing results. Children's Hospital of Philadelphia (CHOP): The Center for Applied Genomics (CAG) is a specialized Center of Emphasis at the Children's Hospital of Philadelphia (CHOP), and one of the world's largest genetics research programs, with to state-of-the-art high-throughput sequencing and genotyping technology. Our primary goal is to translate basic research findings to medical innovations. We aim to develop new and better ways to diagnose and treat children affected by rare and complex medical disorders, including asthma, autism, epilepsy, pediatric cancer, learning disabilities, and a range of rare diseases. Ultimately, our objective is to generate new diagnostic tests and to guide physicians to the most appropriate therapies. Participants were recruited from the CAG biorepository (n>450,000), specifically from >100,000 CHOP pediatric patients and family members, which is enriched for rare-diseases (n>12,000). Center for Applied Genomics, The Children's Hospital of Philadelphia We gratefully thank all the children and their families who enrolled in this study, and all individuals who donated blood samples for research purposes. Genotyping for this project was performed at the Center for Applied Genomics and supported by an Institutional Development Award from The Children's Hospital of Philadelphia. Sequencing was supported by the National Institutes of Health through an award from the National Human Genome Research Institute's Electronic Medical Records and Genomics (eMERGE) program (U01HG008684). Columbia University: The goal of the Columbia eMERGE III project is to develop methods for integrating genomic data in EHRs and to study the impact of such genomic informatics interventions on the health of a diverse, underserved urban adult English- and Spanish-speaking patient population in Northern Manhattan served by Columbia University Medical Center/New York-Presbyterian Hospital system. The study group is 2500 patients recruited from diverse clinics and community outreach centers of self-reported White (~61%), Asian (~11%), African-American (~11%), American Indian/Alaska Native (<1%) racial and Hispanic (~33%) ethnic backgrounds. There are two subgroups in the study cohort - a retrospective group (N=1052) that includes patients from oncology and nephrology clinics, and a prospective one (N=1448) that includes healthy individuals as well as participants with diverse medical conditions. Confirmed pathogenic variants in 70 selected genes will be returned to participants and their healthcare providers through the EHR integration. Participants are able to choose the results they receive and will have the freedom to meet with a genetic counselor and a geneticist to review results. The impact of genetic testing on clinical care is determined by periodic monitoring of EHRs. Geisinger: Samples and phenotype data in this study were provided by the Geisinger MyCode® Community Health Initiative. Participants are recruited across the Geisinger System via online consents or in-person consents at a hospital or clinic visit. Enrollment is ongoing with over 100,000 individuals currently consented. Partners Healthcare (Harvard University): The Partners HealthCare Biobank is a large research program designed to help researchers understand how people's health is affected by their genes, lifestyle, and environment. This large research data and sample repository provides access to high-quality, consented blood samples to help foster research, advance our understanding of the causes of common diseases, and advance the practice of medicine. For the Partners research community (Massachusetts General Hospital and Brigham and Women's Hospital), the Biobank provides: Banked samples (plasma, serum, and DNA) collected from consented patients Blood samples that were discarded after clinical testing in the Crimson Cores maintained in the Brigham and Women's Hospital and Massachusetts General Hospital Pathology Departments Sample handling and preparation services Link to the biobank data to the Partners Research Patient Data Registry (RPDR) a research instance of our electronic clinical chart Data access through our research portal. To date, over 70,000 Partners patients have given their consent to enroll, give a blood sample, receive research results and agreed to be re-contacted for additional research studies. The Biobank has enabled Partners investigators to compete for nationally recognized grants in personalized medicine such as a clinical electronic Medical Records and Genomics network (eMERGE) site and the national All of US program. The Biobank currently supports over 120 Partners investigators and over 130 million dollars in NIH research. Kaiser Permanente Washington/ (KPWA) / University of Washington (UW): KPWA participants were enrolled in the eMERGE Network through the Northwest Institute of Genetic Medicine (NWIGM) biorepository, and provided the appropriate consent to receive clinically relevant genetic results (N=2,500.) NWIGM is based at the University of Washington and co-managed by the University of Washington and KPWA. The purpose of the NWIGM biorepository is to build infrastructure and resources to carry out a broad range of future genetic research. KPWA members enrolled in the biorepository are asked to provide informed consent to providing a DNA sample for storage in the NWIGM biorepository. The consent is purposefully broad to serve the dual purpose of reducing the burden on researchers who wish to use this biorepository and the IRB committees who will be responsible for reviewing these requests in the future. Participants were eligible if aged 50 - 65 years old at the time of their enrollment into the NWIGM repository, living, enrolled in KPWA's integrated group practice, and had completed an online Health Risk Appraisal. The selection algorithm was based on several data sources from the EHR at KPWA. 1) Demographics - participants with self-reported race as Asian ancestry were prioritized and selected to enrich for non-European ancestry. The KPWA eMERGE cohort includes N=1,245 members of Asian ancestry. 2) Participants were also selected for a history of colorectal cancer (N=1,255), in order to allow us to enrich germline pathogenic variants. Mayo Clinic: The Return of Actionable Variants Empirical (RAVE) Study was approved by the Mayo Clinic IRB. We recruited 2537 participants from Mayo Clinic biobanks in Rochester, MN, who had hypercholesterolemia or colon polyps, thereby enriching for Familial hypercholesterolemia (FH) and monogenic causes of colorectal cancer (CRC). Additional eligibility criteria were: 1) residents of Southeast MN who were alive and aged 18-70 years; 2) LDL-C level >155 or >120 mg/dl while on lipid-lowering therapy; 3) no known cause of secondary hyperlipidemia; and 4) no cognitive impairment or dementia that would compromise their ability to give written informed consent. Based on these criteria, we identified 5270 eligible patients and obtained informed consent from 3030 participants. Recruitment was conducted in waves and utilized mailed recruitment packets consisting of a study brochure, a written informed consent form, a baseline psychosocial questionnaire, and a return postage-paid envelope. DNA of 2537 participants was sent for CLIA-certified targeted sequencing of 109 genes including genes associated with FH and CRC. Targeted sequencing and genotyping was performed in a Central Laboratory Improvement Amendment (CLIA)-certified laboratory. Northwestern University: Samples and data used in this study were obtained from patients from Northwestern Medicine, an integrated healthcare system, formed through a partnership of Northwestern Memorial HealthCare and Northwestern University Feinberg School of Medicine. Participants include a retrospective cohort from the Northwestern Pharmacogenomics Study, funded through the eMERGE II project, NHGRI (3U01HG006388-02S1) and a prospective cohort from the Genetic Testing and Your Health Study, funded through the eMERGE III project, NHGRI (U01HG008673). Patients were eligible to participate if they were18 years or older and see a physician at Northwestern Medicine. Patients consented to genetic testing and to allow their results to be placed in their electronic medical record. Vanderbilt University Medical Center: Vanderbilt University Medical Center (VUMC) participants were enrolled in the eMERGE Network through the Vanderbilt Genome-Electronic Records (VGER) project. Patients were provided the appropriate consent to receive clinically relevant genetic results (N=2,700). Participants were eligible if aged 21 or over, had a healthcare provider at VUMC, and visited the provider at least 3 times in the past 3 years. Meharry Medical College: Inclusion of ethnic groups in genomic research is critical to identify possible reasons for health disparities. African-Americans are being enrolled in various outpatient clinics of Nashville General Hospital at Meharry, an inner city hospital primary serving a poorer patient group. A total of 500 African Americans with four cancer types demonstrating health disparities in this population - prostate, colon, breast, lung are identified and approached by clinical research coordinators. The purpose of the study is to determine if any genetic information can be identified from these patients who have or are at high risk of one of these disparate cancers. All participants provide written informed consent and HIPAA authorization to provide blood samples for broad research use and permission to access data in their hospital electronic medical record for research now and in the future. An extensive demographic profile is obtained and entered into a REDCap database. Blood samples are obtained for a panel of alleles from extracted DNA at Baylor. In addition, de-identified coded samples are processed and stored in a central biorepository for further DNA, RNA and proteomic analyses. The survey and phlebotomy are performed at the time of the initial contact and agreement to participate. Nearly all patients approached willingly agree to participate for potential benefit to themselves, family members, or humankind. Little concern is voiced of providing samples for genetic analysis. Study investigators will share results with the participants and providers if testing does not indicate high risk. Results indicating increased risk or actionable alleles for the patient and/or family will be returned by a genetic counselor. Monitoring of the patients' health in this cohort will continue to be followed in the EMR to identify any future associations that might explain health disparities in African Americans. Proposals will be reviewed from investigators to study the genetic or proteomic samples as well as the clinical and demographic information in the repository. Please note that this version of the dataset has a handful of mismatches between genotyped and provided sex. Data with the following IDs should be removed prior to analysis: 420252874213744142412243424569384245694642672223

  Study phs001616

• Germ Cell and Associated Heme Malignancies Evolve from a Common Shared Precursor

  Germ cell tumors (GCTs) are the most common cancer in men between the ages of 15-40. While most patients are cured, those with disease arising in the mediastinum have distinctly poor outcomes. One in every 17 patients with primary mediastinal non-seminomatous GCTs develop an incurable hematologic malignancy and prior data intriguingly suggests a clonal relationship exists between hematologic malignancies and GCTs in these cases. To date however, the precise clonal relationship between GCTs and the diverse additional somatic malignancies arising in such individuals has not been determined. Here, we traced the clonal evolution and characterized the genetic features of each neoplasm from a cohort of fifteen patients with GCTs and associated hematologic malignancies. We discovered that GCTs and hematologic malignancies developing in such individuals evolved from a common shared precursor, nearly all of which harbored allelically imbalanced TP53 and/or RAS pathway mutations. Hematologic malignancies arising in this setting genetically resembled mediastinal GCTs rather than de novo myeloid neoplasms. Our findings argue that this scenario represents a unique clinical syndrome, distinct from de novo GCTs or hematologic malignancies, initiated by an ancestral precursor which gives rise to the parallel evolution of GCTs and blood cancers in these patients. Reprinted from PMID: 32897884, with permission from JCI.

  Study phs002231

• A Large Data Resource of Genomic Copy Number Variation across Neurodevelopmental Disorders

  This study presents the first genome-wide copy number variation (CNV) analysis across autism spectrum disorder (ASD), attention deficit hyperactivity disorder (ADHD), schizophrenia (SCZ), and obsessive-compulsive disorder (OCD). A total of 2,691 subjects diagnosed with a neurodevelopmental disorder (NDD), and a total of 1,769 unaffected family members from Ontario, Canada were assayed using the Affymetrix CytoScan HD array. We identified rare CNVs, (< 0.1% frequency in 10,851 population control samples), and found clinically relevant CNVs in 10.5% of total subjects. Among all NDD subjects, we identified 17 (0.63%) with aneuploidies and 115 (4.3%) with known genomic disorder variants. We searched further for genes impacted by different CNVs in multiple disorders. Examples of NDD-associated genes linked across more than one disorder (listed in order of occurrence) are NRXN1, SEH1L, LDLRAD4, GNAL, GNG13, MKRN1, DCTN2, KNDC1, PCMTD2, KIF5A, SYNM, and long non-coding RNAs: AK127244, NRON, and PTCHD1-AS. We demonstrated that identical CNVs or genes could potentially contribute to the etiology of multiple NDDs. The CNVs identified will serve as a useful resource for both research and diagnostic laboratories for prioritization of variants and clinical interpretations.CNV data from this study are available through dbVar at https://www.ncbi.nlm.nih.gov/dbvar/studies/nstd173/.

  Study phs001881

• Rapid Evolution of a Skin Lightening Allele in Southern African KhoeSan

  The genetic architecture and polygenicity of skin pigmentation is explored in KhoeSan communities, including Nama individuals whose phenotype and genotype data are provided in this dataset. By pairing genotypes and quantitative spectrophotometric skin pigmentation phenotypes, we show that skin pigmentation is highly heritable in KhoeSan, yet known pigmentation loci only explains a small fraction of the phenotypic variance. Using genome-wide association analyses, we identified both canonical and non-canonical skin pigmentation loci. We show that this phenotype is more polygenic and complex than previously characterized. (Martin et al., Cell 2017. PMID: 29195075) Following up on the top associated signal with large effect size in the gene SLC24A5, we demonstrate that the canonical Eurasian nonsynonymous allele was introduced into KhoeSan via a recent migration ~2 kya and was under extremely strong selection. The derived allele was present at high frequency despite controlling for gene flow. With high-throughput sequences in the captured SLC24A5 region, we show that the most common derived haplotype is identical amongst Europeans, eastern African and KhoeSan. Using 4-population demographic simulations with selection, we show that the allele was introduced into the KhoeSan only 2,000 ya via a back-to-Africa migration and then experienced a selective sweep.

  Study phs001753

• Generation of a Cellular Atlas of Human Adipose Tissue

  White adipose tissue (WAT), once regarded as morphologically and functionally bland, is now recognized to be dynamic, plastic, heterogenous, and involved in a wide array of biological processes including energy homeostasis, glucose and lipid handling, blood pressure control, and host defense.  High fat feeding and other metabolic stressors cause dramatic changes in adipose morphology, physiology, and cellular composition, and alterations in adiposity are associated with insulin resistance, dyslipidemia, and Type 2 diabetes (T2D). Here we provide detailed cellular atlases of human and murine subcutaneous and visceral white fat at single-cell resolution across a range of body weight. We identify subpopulations of adipocytes, adipose stem and progenitor cells (ASPCs), vascular, and immune cells and demonstrate commonalities and differences across species and dietary conditions. We link specific cell types to increased risk of metabolic disease, and we provide an initial blueprint for a comprehensive set of interactions between individual cell types in the adipose niche in leanness and obesity. We also utilize bulk RNA sequencing data of enzymatically digested human adipocytes to scale these findings to a larger cohort. These data comprise an extensive resource for the exploration of genes, traits, and cell types in the function of WAT across species, depots, and nutritional conditions. 

  Study phs002766

• Assessing gene expression profiling from FFPE Patient Samples: A Comparison of Two Library Preparation Approaches and Recommendations

  Next-Generation Sequencing (NGS) has transformed cancer research and clinical practice, with Whole Exome Sequencing (WES) driving advances in mutational profiling and personalized oncology. Yet, transcriptomic signatures remain essential for understanding disease mechanisms, including therapy resistance pathways. RNA sequencing (RNA-seq), however, faces unique challenges when dealing with low-input or degraded RNA, as often found in archival formalin-fixed paraffin-embedded (FFPE) tissues. Although previous studies have compared library preparation protocols, rapidly evolving technologies call for updated evaluations. Here, we present a direct comparison of two FFPE-compatible stranded RNA-seq library preparation kits: TaKaRa™ SMARTer® Stranded Total RNA-Seq Kit v2 (Kit A) and Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Kit B). Both kits generated high-quality RNA-seq data, yet important differences emerged. Notably, Kit A achieved comparable gene expression quantification to Kit B while requiring 20-fold less RNA input, a crucial advantage for limited samples, albeit with increased sequencing depth. We critically discuss these results in relation to RNA availability, technical performance, cost-effectiveness, processing time, and automation potential, offering practical guidance for selecting optimal RNA-seq strategies in clinical and translational research settings

  Study EGAS50000001066

• Recurrent somatic JAK-STAT mutations within a novel RUNX1-mutated pedigree

  The acquisition of somatic mutations is an emerging field of investigation in familial leukemia. Currently, genetic profiles in familial MDS/AML are considered analogous to sporadic disease, although the patterns of clonal evolution within families are poorly defined. We performed whole exome profiling of tumour samples from a novel RUNX1 mutated family, to determine the stepwise evolution of MDS/AML across 4 young siblings. Three siblings developed monocytic AML/RAEB2 at 5 years of age, with hepatosplenomegaly and somatic mutations upregulating JAK-STAT signalling, the latter are typically detected in <5% of sporadic MDS/AML. Two siblings acquired the canonical JAK2 V617F mutation, while another acquired a unique missense mutation of SH2B3, a negative regulator of JAK2. Notably, 2/3 siblings demonstrated dosage amplification of these mutations due to acquired uniparental disomy of chromosomes 9p and 12q (encompassing JAK2 and SH2B3, respectively). All 4 siblings were heterozygous for the 46/1 JAK2 haplotype associated with predisposition to sporadic V617F myeloproliferative disorders, which likely influenced the acquisition of JAK2 mutations. Our findings provide further evidence that relatives with shared germline mutations may acquire somatic mutations in a non-random manner leading to convergent patterns of disease evolution.

  Study EGAS00001001862

• Hermansky-Pudlak syndrome type 1 causes impaired anti-microbial immunity through a pathogenic lipid metabolism-mTOR circuit

  Mendelian diseases that present with immune-mediated disorders can provide insights into the molecular mechanisms that drive inflammation. Hermansky-Pudlak syndrome (HPS) types 1 and 4 are caused by defective vesicle trafficking involving the BLOC-3 complex. The presence of inflammatory complications such as Crohn’s disease-like inflammation and lung fibrosis in these patients remains enigmatic. Using mass cytometry we observe an augmented inflammatory monocyte compartment in HPS1 patient peripheral blood that may be associated with a TNF - and IL-1α-dominated cytokine dysregulation. HPS1 patient monocyte-derived macrophages express an inflammatory TNF-OSM mRNA gene signature and changes in lipid metabolism. Using stimulation experiments and lysosomal proteomics we show that defective lipid metabolism drives RAB32-dependent mTOR signaling, facilitated by the accumulation of mTOR on lysosomes. This pathogenic circuit translates into aberrant bacterial clearance, which can be rescued with mTORC1 inhibition. We reveal that a pathogenic lipid-mTOR signaling circuit acts as a metabolic checkpoint for defective anti-microbial activity. This mechanism may be relevant to the complex pathology of HPS1 patients featuring macrophage lipid accumulation, granuloma formation, defective anti-microbial activity and tissue inflammation. Lastly, this circuit may be present in a wider group of disorders with defective lipid metabolism and cholesterol accumulation.

  Study EGAS00001005053

• Hermansky-Pudlak syndrome type 1 causes impaired anti-microbial immunity through a pathogenic lipid metabolism-mTOR circuit - 10x Genomics scRNAseq

  Mendelian diseases that present with immune-mediated disorders can provide insights into the molecular mechanisms that drive inflammation. Hermansky-Pudlak syndrome (HPS) types 1 and 4 are caused by defective vesicle trafficking involving the BLOC-3 complex. The presence of inflammatory complications such as Crohn’s disease-like inflammation and lung fibrosis in these patients remains enigmatic. Using mass cytometry we observe an augmented inflammatory monocyte compartment in HPS1 patient peripheral blood that may be associated with a TNF - and IL-1α-dominated cytokine dysregulation. HPS1 patient monocyte-derived macrophages express an inflammatory TNF-OSM mRNA gene signature and changes in lipid metabolism. Using stimulation experiments and lysosomal proteomics we show that defective lipid metabolism drives RAB32-dependent mTOR signaling, facilitated by the accumulation of mTOR on lysosomes. This pathogenic circuit translates into aberrant bacterial clearance, which can be rescued with mTORC1 inhibition. We reveal that a pathogenic lipid-mTOR signaling circuit acts as a metabolic checkpoint for defective anti-microbial activity. This mechanism may be relevant to the complex pathology of HPS1 patients featuring macrophage lipid accumulation, granuloma formation, defective anti-microbial activity and tissue inflammation. Lastly, this circuit may be present in a wider group of disorders with defective lipid metabolism and cholesterol accumulation.

  Study EGAS00001005098

• Comprehensive Genomic Characterization of Refractory Multiple Myeloma Reveals a Complex Mutational and Structural Landscape Associated with Drug Resistance (H067)

  Outcome of patients with multiple myeloma (MM) refractory to immunomodulatory agents (IMiDs) and proteasome inhibitors (PIs) is still very poor. To elucidate the genetic landscape of relapsed/refractory MM (RRMM) we performed whole genome and transcriptome sequencing of 39 heavily pretreated RRMM patients with at least double refractoriness revealing complex structural changes and a high mutational load (H067/K08K). We found a median of 67 structural variants and 116 nonsynonymous exonic mutations per patient. Assessment of oncogenic drivers showed NRAS, BRAF, TP53, KRAS, SLC4A7, FAM46C, DIS3, RB1, KMT2C, MLLT4, EWSR1, HCFC2, and COPS3 as significantly mutated. We found multiple genomic regions with bi-allelic events affecting known tumor suppressor genes, most frequently TP53, RB1, and TRAF3. Supervised analysis of mutational signatures showed a major contribution of Cosmic signature 6 associated with deficiency in DNA mismatch repair and the ‘BRCAness’ signature which coincided with mutations in genes known to confer PARP inhibitor sensitivity. Recurrently mutated gene networks included genes with relevance for PI and IMiD activity, the latter including in particular members of the Cereblon and the COP9 signalosome complex. In conclusion, this comprehensive genomic characterization revealed a complex mutational and structural landscape in RRMM and highlights potential implications for therapeutic strategies.

  Study EGAS00001004363

• tFL with a PMBL GE signature

  We investigated the clinicopathologic features of 5 follicular lymphomas (FL) that transformed to morphologic diffuse large B-cell lymphomas (DLBCL) and had a primary mediastinal large B-cell lymphoma (PMBL)-like gene expression profile. None of the transformed FL (tFL) arose in the mediastinum, all cases tested had a germinal center B-cell immunophenotype, 20% were CD30+, 60% CD23+, 80% MAL+, 20% CD200+, and 0% CD273/PDL2+. Whole exome sequencing detected alterations in genes associated with both FL/DLBCL (CREBBP, KMT2C, KMT2D, ARID1A, HIST1 members, and TNFRSF14) and PMBL (JAK-STAT pathway genes, B2M, and CD58). Copy number (CN) analysis detected gains/amplification of REL in 60% and STAT6 in 40%, gains of chromosome 16, including IL4R, in 40%, and both deletions and gains of 11q in 20%. This cohort, although limited in size, supports a subset of tFL that has blended features between FL/DLBCL and PMBL. Despite having some features that are less common in DLBCL (MAL and CD23 expression, JAK-STAT activation), these cases lack the most characteristic CN alteration seen in PMBL (9p24.1 gain/amplification). This cohort expands the biologic heterogeneity of tFL, illustrating a subset with blended FL/DLBCL and PMBL features, with potential treatment implications that include the use of novel PMBL-targeted therapies.

  Study EGAS00001005870

• Asian Indian Diabetic Heart Study (AIDHS) /Sikh Diabetes Study (SDS)

  The Punjabi Sikh population is a well-defined, carefully collected homogeneous sample from northern India and the US. It has unique characteristics, which are ideal for genetic studies. Sikhs are strictly a non-smoking population and about 50% of participants are life-long vegetarians. All subjects included in the genome-wide association studies (GWAS) were recruited from one geographical location. Our population demonstrates a strong familial clustering of type 2 diabetes and related cardio-metabolic disorders that may be genetic and we believe that the contribution of alleles at specific loci are likely to be unique to Punjabi Asians compared to Europeans. Our group first showed that the association of a common variant at rs9939609 in the FTO (fat mass and obesity) gene in South Asians was independent of BMI (PMID:18598350) in contrast to Europeans where the association of same variant with T2D is mediated through obesity (PMID:17434869). These findings were later confirmed in an independent sample of South Indians (PMID:19005641), Pakistanis (PMID:21294771), and even East and South Asians in a large meta-analyses study comprising 96,551 individuals (PMID: 22109280). Earlier reported association of MTNR1B with fasting glucose concentrations and type 2 diabetes in European GWAS could not be confirmed in our Sikh cohort. On the other hand, our study revealed, for the first time, a significant protective association of another less common variant in MTNR1B with fasting glucose levels that was modulated by obesity. Ours was the first report that suggested that the low CETP activity was associated with higher CAD risk (PMID:22143414) in South Asians and that the genetic effects are significantly modulated by environmental factors (alcohol consumption). Our recent GWAS on type 2 diabetes has identified a novel locus at chromosome 13q12 in the SGCG gene (p=1.82x10-8) associated with type 2 diabetes (PMID:23300278) in Punjabi Sikhs. From these findings, we are optimistic that our resource will provide new insights to gene functions in the diabetic pathway and better help researchers to understand and translate these insights to novel therapeutic treatment and early prevention to T2D that may be important beyond Indians.

  Study phs000583

• National Institute on Aging (NIA) SardiNIA Study

  Sardinia is the second largest island in the Mediterranean and constitutes a genetically isolated founder population. This population has aided in the identification of genes involved in several Mendelian disorders and is attractive for genetic studies due to its organization in long-established settlements that developed from an initial group of founder settlers (~1,000) thousands of years ago. The current study has recruited 6,148 Sardinians aged 14 and older, from a cluster of four towns in the Lanusei Valley in the Ogliastra region of the province of Nuoro. This sample corresponds to approximately 62% of the population eligible in the area for recruitment. Information collected during enrollment allowed the individuals to be organized into 711 complex pedigrees, each up to five generations deep, with an average kinship coefficient of 0.1628. All volunteers have been characterized for 98 quantitative traits. Traits include anthropomorphic measures, plasma and serum markers (including cholesterol and other markers of cardiovascular disease), and personality traits (using the five-factor model). The main goal of the study is to examine phenotypic similarities between relatives that yield information on the overall contributions of genes to trait variability. Data given here provide p-values for 98 traits studied in 1,412 individuals, based on genotyping with the Affymetrix 500K chip and imputed markers using the HapMap population as a reference (N=2,259,179). Sharing this genome assessment data at high level of resolution for a variety of quantitative traits will be useful for other groups to validate newly observed associations and to investigate possible pleiotropic effects. For ulterior information, and in particular for any individual genotype information, a formal request should be addressed to the Steering Committee, c/o David Schlessinger, Chief, Laboratory of Genetics, National Institute on Aging, National Institutes of Health, NIH Biomedical Research Center, 251 Bayview Blvd., Suite 100 Baltimore, MD 21224 USA and should include IRB approval of a detailed proposal, along with a signed statement guaranteeing that no attempt will be made to identify any individual participant.

  Study phs000338

• NHLBI GO-ESP: Heart Cohorts Exome Sequencing Project (Ischemic Stroke Genetic Study, ISGS)

  The NHLBI "Grand Opportunity" Exome Sequencing Project (GO-ESP), a signature project of the NHLBI Recovery Act investment, was designed to identify genetic variants in coding regions (exons) of the human genome (the "exome") that are associated with heart, lung and blood diseases. These and related diseases that are of high impact to public health and individuals from diverse racial and ethnic groups will be studied. These data may help researchers understand the causes of disease, contributing to better ways to prevent, diagnose, and treat diseases, as well as determine whether to tailor prevention and treatments to specific populations. This could lead to more effective treatments and reduce the likelihood of side effects. GO-ESP is comprised of five collaborative components: 3 cohort consortia - HeartGO, LungGO, and WHISP - and 2 sequencing centers - BroadGO and SeattleGO. The Ischemic Stroke Genetics Study (ISGS) is a study of newly onset cases (~600) with ischemic stroke (a stroke due to sudden interruption of blood flow to a part of the brain) compared with sex- and age-matched non-stroke participants. The study was conducted to determine the genes and their variants that contribute to an individual's risk of developing an ischemic stroke. The coordination of the recruitment and flow of the samples occurred at the Mayo Clinic, Jacksonville, FL, under the direction of James F. Meschia, MD. The University of Virginia (Stephen S. Rich, PhD) served as the analytic site for the genetic data. All GWAS data on ISGS participants have been deposited into dbGaP. As part of the NHLBI Exome Sequencing Project, DNA from a subset of ISGS participants will undergo exome sequencing. For the NHLBI ESP, a subset of 92 individuals with lacunar (small vessel) or atherosclerotic (large vessel) TOAST subtypes were selected from among all ISGS participants, excluding those individuals with TOAST subtypes of stroke of other etiology or of stroke with undetermined etiology. All 92 samples pass initial quality control metrics and 89 samples completed exome sequencing. A total of 75 participants with appropriate consent and variant calls had their genetic and phenotypic data deposited into dbGaP.

  Study phs000546

• Gabriella Miller Kids First (GMKF) Pediatric Research Program in Susceptibility to Ewing Sarcoma Based on Germline Risk and Familial History of Cancer

  Ewing sarcoma (EWS) is a deadly bone cancer that occurs in children and adolescents. Mounting evidence suggests that a genetic predisposition exists for this pediatric cancer, although the specific genetic contribution has yet to be identified. EWS has never been linked to a specific cancer predisposition syndrome, although several case reports have been published that describe siblings and cousins with EWS. Furthermore, neuroectodermal tumors appear to occur more commonly in families with EWS. The two consistent epidemiology findings in EWS include a very strong Caucasian predilection and increased rates of hernia in EWS patients and their family members. Finally, the role of genetic microsatellite repeats in EWS tumorigenesis has been recently described, and these GGAA microsatellites are polymorphic in repeat size and location across the genome. The study goals of this Kids First project include (1) To identify cancer predisposition genes in EWS trios increasing disease risk, (2) To identify genome-wide GGAA microsatellite repeats in EWS trios increasing disease risk, and (3) To identity de novo mutation and structural variant rates in EWS trios reflecting underlying DNA repair defects that increase disease risk. As part of the Kids First Common Fund initiative, this study proposal will further elucidate the genetic contribution to pediatric cancer development. Around 375 of these trios were selected for whole genome sequencing as part of the Gabriella Miller Kids First fund. The EWS trios have been collected as part of the Children's Oncology Group's AEPI10N5 Study ("Genetic Epidemiology of Ewing Sarcoma"), and each trio has associated phenotypic data including a detailed family history. We will interrogate the sequence data using our genomic analysis pipeline at the University of Utah and the Utah Science Technology and Research initiative's (USTAR) Center for Genetic Discovery. We will look for the genetic contribution to EWS and the sequence data with be shared in a repository designated by the Kids First Common Fund. The WGS of these ~375 EWS trios will help us to understand the genetic origins of a deadly childhood cancer and may lead to novel strategies for prevention and treatment.

  Study phs001228

• DNA-Sequencing of Baseline Plasma From the Phase III Alliance A031201 Trial

  Liquid biopsy assays tailored for metastatic castration-resistant prostate cancer (mCRPC) patients are needed to identify molecular alterations and predict survival in the context of androgen receptor (AR) inhibitors. We developed a novel plasma cell-free DNA (cfDNA) sequencing assay to detect circulating tumor DNA (ctDNA) and alterations in key mCRPC driver genes, and tested associations with clinical features and survival outcomes in a phase III trial. cfDNA was isolated from evaluable baseline plasma specimens of untreated mCRPC patients (n=790) enrolled in the Alliance A031201 randomized phase III trial (NCT01949337) prior to enzalutamide therapy with or without abiraterone acetate and prednisone. A customized targeted cfDNA sequencing assay was used to detect AR and non-AR alterations in mCRPC. For this, DNA-seq libraries were constructed from cfDNA using Takara ThruPLEX Tag-Seq or Plasma-Seq kits, and subjected to hybridization enrichment using a custom-designed Agilent SureSelect bait panel. Post-capture DNA-seq libraries were pooled and sequenced on an Illumina HiSeq 2500 using 2x150 bp settings. ctDNA positivity was defined as >20% ctDNA using an aneuploidy-based estimate derived from ichorCNA (Group 1) or a novel definition of ≤20% ctDNA, but with detection of any alteration in AR, or gain of MYC and/or MYCN (Group 2). cfDNA sequencing data was obtained from 776 patients. There were 480/776 (62%) ctDNA-positive patients, with 324 (42%) in Group 1 and an additional 156 (20%) in Group 2 with AR or MYC/MYCN alterations detected. ctDNA-positive patients in Groups 1 and 2 had similarly poor median overall survival (OS) of 25.4 months (95% CI: 21.8-29.0) and 29.7 months (95% CI: 27.3-35.5), respectively, as compared to ctDNA-negative patients who had a median OS of 49.1 months (95% CI: 42.3-53.5). Relative to ctDNA-negative patients, OS was inferior in ctDNA-positive patients in Group 1 (HR 2.3, 95% CI: 1.9-2.9, P AR inhibitors in a contemporary phase III trial.

  Study phs003325

• Automated machine-learning approach for next generation profiling of sequence alterations, mutation burden, microsatellite instability, and structural variants in human cancers

  Sequence and structural alterations together with tumor mutation burden (TMB) and microsatellite instability (MSI) have been identified as biomarkers for the determination of response to targeted and immune checkpoint inhibitor therapies. However, widespread clinical adoption of these biomarkers has historically been limited due to barriers such as evidence of clinical utility and reimbursement. We have developed 2.2 Mb targeted NGS system and an automated machine-learning analysis approach (PGDx elio™ tissue complete, ETC) that has been FDA cleared for examination of 500+ cancer-related genes and 68 mononucleotide repeats for identification of sequence and structural alterations, TMB, and MSI in solid cancers in a clinical setting. We designed and trained this approach using sequence data from 4,174 cancers and >124,000 in silico alterations and evaluated the methodology in >2,550 tumor or non-cancerous normal samples. Independent analyses of ETC sequence changes in 440 formalin fixed paraffin embedded (FFPE) tumor or cell line samples using MSK-IMPACT™, FoundationOne®, and ddPCR revealed a positive percent agreement (PPA) >97% with high sensitivity as low as 3% mutant allele fraction. We observed high concordance between panel-wide and whole-exome TMB for 307 pan-cancer FFPE tumors (Pearson r=0.95, p < 0.0001) using samples with ≥20% tumor cellularity. Comparison of the mutation context and repeat-based MSI approach in ETC with a multiplex MSI PCR assay in 223 samples revealed a PPA of 99% and negative predictive agreement (NPA) >99%. We confirmed the accuracy and precision of TMB and MSI measurements across three independent laboratories (CV of <5% and average PPA >99%, respectively). Finally, evaluation of amplifications and translocations against DNA and RNA-based approaches exhibited >98% NPA and PPA of 86% and 82% respectively. These results demonstrate high analytical performance for determination of sequence and structural changes, TMB, and MSI using a targeted NGS panel and provide a scalable and facile approach for evaluating these biomarkers in a clinical laboratory.

  Study EGAS00001005556

• Identifying transcriptional programs underlying anti-EGFR small molecule response and resistance with TraCe-seq

  Genetic and non-genetic heterogeneity within cancer cell populations represents a major challenge to anti-cancer therapies. We currently lack robust methods to determine how pre-existing and adaptive features affect cellular responses to therapies. Here, by conducting clonal fitness mapping and transcriptional characterization using expressed barcodes and single-cell RNA-sequencing, we have developed TraCe-seq, a method that captures at clonal resolution the origin, fate, and differential early adaptive transcriptional programs of cells in a complex population in response to distinct treatments. We used TraCe-seq to benchmark how next-generation dual EGFR inhibitors-degraders compare to standard EGFR kinase inhibitors in EGFR-mutant lung cancer cells. To QC the TraCe-seq strategy, single-cell RNA-seq libraries were generated from a variety of human cancer cell lines transduced with the TraCe-seq library to validate the TraCe-seq strategy. Specifically, 5 different cell lines (PC9, MCF-10A, MDA-MB-231, NCI-H358, and NCI-H1373) were each transduced with a unique TraCe-seq barcode. The transduced cells were selected with puromycin only, dissociated to single cell suspensions, and then mixed together. The complex mixture of the 5 cell lines was profiled by 10X scRNA-seq. Furthermore, transduced NCI-H1373 cells were sorted by FACS to enrich for the top 50% of eGFP positive cells, and sorted cells were cultured briefly and used to construct scRNA-seq libraries and profiled by 10x scRNA-seq. To carry out the full TraCe-seq experiment, ~600 PC9 cells carrying unique TraCe-seq barcodes were expanded over 12 doublings to establish the barcoded population. A subset of the barcoded PC9 population was used to generate scRNA-seq libraries and profiled by 10x scRNA-seq prior to treatment to establish a baseline transcription profile for each barcoded clone. The rest of the cells were then treated for four days with 1 µM erlotinib, 1 µM GNE-069, or 1 µM GNE-104 respectively. scRNA-seq libraries were then generated form the treated cells and profiled by 10x scRNA-seq.

  Study EGAS00001005405

• Institut Curie Neuroblastoma Whole Genome Sequencing Diagnosis Relapse

  Neuroblastoma, a clinically heterogeneous pediatric cancer, is characterized by distinct genomic profiles but few recurrent mutations. As neuroblastoma is expected to have high degree of genetic heterogeneity, study of neuroblastoma's clonal evolution with deep coverage whole-genome sequencing of diagnosis and relapse samples will lead to a better understanding of the molecular events associated with relapse. Samples were included in this study if sufficient DNA from constitutional, diagnosis and relapse tumors was available for WGS. Whole genome sequencing was performed on trios (constitutional, diagnose and relapse DNA) from eight patients using Illumina Hi-seq2500 leading to paired-ends (PE) 90x90 for 6 of them and 100x100 for two. Expected coverage for sample NB0175 100x100bp was 30X for tumor and constitutional samples. For the seven other patients expected coverage was 80X for tumor samples with PE 100x100, 100X in the other tumor samples and 50X for all constitutional samples (see table 1). Following alignment with BWA (Li et al., Oxford J, 2009 Jul) allowing up to 4% of mismatches, bam files were cleaned up according to the Genome Analysis Toolkit (GATK) recommendations (Van der Auwera et al., Current Protocols in Bioinformatics, 2013, picard-1.45, GenomeAnalysisTK-2.2-16). Variant calling was performed in parallel using 3 variant callers: GenomeAnalysisTK-2.2-16, Samtools-0.1.18 and MuTect-1.1.4 (McKenna et al., Genome Res, 2010; Li et al., Oxford J, 2009 Aug; Cibulskis et al., Nature, 2013). Annovar-v2012-10-23 with cosmic-v64 and dbsnp-v137 were used for the annotation and RefSeq for the structural annotation. For GATK and Samtools, single nucleotide variants (SNVs) with a quality under 30, a depth of coverage under 6 or with less than 2 reads supporting the variant were filter out. MuTect with parameters following GATK and Samtools thresholds have been used to filter our irrelevant variants. .SNVs within and around exons of coding genes overlapping splice sites.. Then,variants reported in more than 1% of the population in the 1000 genomes (1000gAprl_2012) or Exome Sequencing Project (ESP6500) have been discarded in order to filter polymorphisms. Finally, synonymous variants were filtered out. MuTect focuses on somatic by filtering with constitutional sample. Mpileup comparison between constitutional and somatic DNAs allowed us to focus also on tumor specific SNVs with GATK and Samtools. Finally, every SNV called by our pipeline and also supported in any constitutional samples were filtered our in order to prevent putative constitutional DNA coverage deficiency. Then we analyzed CNVs (copy number variants) with HMMcopy-v0.1.1 (Gavin et al., Genome Res, 2012) and control-FREEC-v6.7 (Boeva et al., Bioinformatics 2011) with a respective window of 2000bp and 1000 bp, and auto-correction of normal contamination of tumor samples for Control-FREEC. Finally we explored Structural variants (SVs) including deletions, inversions, tandem duplications and translocations using DELLY-v0.5.5 with standard parameters (Rausch et al., Oxford J, 2012). In tumors, at least 10 supporting reads were required to make a call and 5 supporting reads for the sample NB0175 with a coverage of only 40X (see table 2). To predict SVs in constitutional samples for subsequent somatic filtering, only 2 supporting reads were required in order not to miss one. To identify somatic events, all the SVs in each normal sample were first flanked by 500 bp in both directions and any SVs called in a tumor sample which was in the combined flanked regions of respective normal sample was removed (see graph 1). Deletions with more than 5 genes impacted or larger than 1Mb and inversions or tandem duplications covering more than 4 genes, were removed. We focused on exonic and splicing events for deletions, inversions, and tandem duplications. For translocation, we keep all SVs that occurred in intronic, exonic, 5'UTR, upstream or splicing regions. Bioinformatics detection of variations with Deep sequencing approach Once PE reads merged and adaptors trimmed by SeqPrep with default parameters, merged reads were aligned via the BWA (Li H. and Durbin R. 2009 PMID 19451168) allowing up to 1 differences in the 22-base-long seeds and reporting only unique alignments. Only reads having a mapping quality 20 or more have been further analysed. Variant calling software was not used, since we aimed to predict variations at low frequencies, observed in less than 1% of reads. Such variants require a custom approach. Using DepthOfCoverage functions of the Genome Analysis Toolkit (GATK) v2.13.2 (McKenna A, et al., 2010 Genome Research PMID: 20644199), we focused on high quality coverage of bases A, C, G and T at the targeted variant position. Depth of coverage of each base following a mapping quality higher than 20 and a base quality higher than 10 have been taken into account in order to focus only on high quality data. Aiming to determine the background level of variability at the studied regions, 10 control samples were included in the analysis. The same approach and filtering criteria have been applied as introduced above over the entire amplicons. In order to highlight variants, for each sample the frequencies of each bases at each amplicon position were then compared to those observed in the set of controls. Statistical analyses were performed with the R statistical software (http://www.R-project.org). Fisher’s exact two-sided tests with a Bonferroni correction were performed to compare percentages of bases between the data sets, i.e. for a given base between a case and the controls. Finally, significant variations were filtered-in once (i) a significant increase in the percentage of avariant base and (ii) a significant decrease in the percentage of it's reference base following our p.values criteria was observed (p.val < 0.05).

  Dataset EGAD00001001356

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• WGS and RNA-Seq data from a GBM patient PT-DF5919

  WGS and RNA-Seq data from a GBM patient PT-DF5919

  Dataset EGAD00001004232

• WGS and RNA-Seq data from a GBM patient PT-AL4257

  WGS and RNA-Seq data from a GBM patient PT-AL4257

  Dataset EGAD00001004225

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-RW9277

  WGS and RNA-Seq data from a GBM patient PT-RW9277

  Dataset EGAD00001004259

• Genome and transcriptome sequence data from a diffuse aarge B-cell lymphoma (relapse) tumor patient

  Genome and transcriptome sequence data from a diffuse large B-cell lymphoma (relapse) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015308

• Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm tumor patient

  Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015312

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor tumor patient

  Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015322

• Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour tumor patient

  Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015327

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Transcriptome sequencing of neuroendocrine tumors of the small intestine

  This dataset contains 206 RNASeq samples from a cohort of patients with neuroendocrine tumors of the small intestine. Libraries were prepared using a Illumina TruSeq Stranded mRNA kit following the manufacturer’s recommendations. Sequencing was performed on Illumina Novaseq6000 machine with a 2x75bp paired-end fashion. This dataset contains data for 169 tumors, 22 mesenteric nodules, 8 liver metastases, 2 adenomas, 1 lymph node and 4 normal ileum samples.

  Dataset EGAD50000000906

• Broad utility of ultrasensitive analysis of circulating tumor DNA (ctDNA) dynamics across solid tumors treated with immunotherapy

  Here, we applied a whole-genome, tumor-informed approach to study ctDNA in more than 202 advanced-stage cancer patients treated at VHIO. This study demonstrates the efficacy of ultrasensitive ctDNA as a broad biomarker in a large pan-cancer discovery and validation cohort, spanning 24 tumor types treated with diverse immunotherapy modalities. It demonstrates ctDNA’s potential for early response assessment, survival prediction, and distinguishing true progression from pseudoprogression, enhancing its clinical relevance. This dataset captures the plasma sequencing data from the project.

  Dataset EGAD50000001813

• Mid-frequency hearing loss is a characteristic clinical feature of OTOA-associated hearing loss

  In this study, we performed NGS analysis of a large Japanese hearing loss cohort, and identified 7 patients with OTOA-associated hearing loss. As novel clinical features identified in this study, the audiometric configurations of OTOA-associated hearing loss patients was found to be mid-frequency.

  Study JGAS000200

• CEITEC DAC

  A CEITEC Data Access Committee (DAC) is a body of one or more named individuals who are responsible for data release to external requesters. The members of DAC are selected members of research groups and their respective leaders. Multiple datasets may be affiliated to a single DAC. DAC continues communication with requester to understand the purpose of use, i.e. research setting the dataset is envisioned for by requester, to identify if data sharing is possible directly under current conditions for the dataset, or actions such as re-consenting is needed and desirable to accommodate the proposed research setting/data use.

  Dac EGAC50000000049

• Clinical and genetic analysis of a rare syndrome associated with neoteny

  We describe a novel syndrome in six patients with extreme developmental delay and the defining characteristic of neoteny. In an effort to discover any genetic causes of this syndrome whole genome sequence (WGS) analysis of the patients and their families was performed on Complete Genomics’ nanoarray platform.

  Study EGAS00001002419

• 120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  Study EGAS00001001733

• DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001005757

• Oral microbiota composition assessed with 16S rRNA sequencing from adults aged over 65 years old.

  This is a oral microbiota amplicon dataset derived from adult participants aged over 65 years old. It consists a total number of 491 samples, stored in 982 paired-end FASTQ files with sequence lengths of 200 nucleotides generated with a Illumina MiSeq. Of those 491 samples, 347 were used in analysis, the remaining 144 samples are control samples.

  Dataset EGAD00001007705

• CRUK Accelerator: Non-small cell lung cancer whole exome and RNA sequencing

  Whole exome and RNASeq raw sequencing data for a cohort 24 patients with non-small cell lung cancer, 15 adenocarcinoma (8 female, 7 male) and 9 squamous cell carcinoma(5 female, 4 male). Median age at diagnosis was 69. Tumour tissue and PBMCs were used for whole exome sequencing and RNA sequencing. This data was generated as part of a study funded by a Cancer Research UK Centres Network Accelerator Award Grant (A21998).

  Dataset EGAD00001007934

• Amplicon-based sequencing of drug resistant lung cancer cell lines (2017-07-05)

  A EGFR mutant NSCLC cell line which is sensitive to AZD9291 inhibition was mutagenised with the chemical mutagen ENU and then drug selected using a AZD9291. Single cell derived colonies were then manually picked and expanded in drug. Resistance was confirmed in a 14 day assay and DNA was collected. These then underwent targeted amplicon-based sequencing to confirm candidate resistance effectors hypothesised from currently available literature. This dataset contains all the data available for this study on 2017-07-05.

  Dataset EGAD00001003425

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• Comprehensive RNA repository of tissue and plasma from patients with esophageal cancer or precursor lesions

  A comprehensive RNA repository (both coding and non-coding) from 17 patients diagnosed with esophageal adenocarcinoma, high-grade dysplastic or non-dysplastic Barrett’s esophagus. Per patient, a blood plasma sample, and a healthy esophageal and disease tissue sample were collected. This dataset includes both mRNA and small RNA sequencing data (fastq.gz files) of all tissue and plasma samples. In total,102 RNA-seq libraries from 51 samples (17 plasma and 34 tissue samples) were sequenced (plasma mRNA libraries were sequenced twice).

  Dataset EGAD00001006857

• Ultra-deep sequencing of cell-free DNA derived from reference materials and a patient with asymmetric overgrowth

  This dataset contains: Ultra-deep sequencing data using the Duplex sequencing technology of: 1.) SeraSeq cfDNA reference materials with spike-in variants with allele frequencies from 0% to 5% 2.) One cfDNA sample from a CRC patient 3.) One cfDNA sample from a patient with asymmetric overgrowth Paired-end sequencing was performed with 2x151 bp reads on the NextSeq 500 system. Data is provided as mapped .bam files (aligned to GRCh38/hg38).

  Dataset EGAD00001009784

• Hip OA Functional Genomics RNAseq (2017-06-09)

  From 9 patients undergoing hip joint replacement surgery for osteoarthritis, we collected 3 cartilage samples each: a low-grade sample (no obvious evidence of damage or fibrillation); a high-grade sample (damaged and fibrillated cartilage); an osteophytic sample (overlaid bony protrusions mainly around the margins of the articular surface). Multiplexed libraries were sequenced on Illumina HiSeq 2000 (75bp paired-end read length) and a cram file was produced for each sample. This dataset contains all the data available for this study on 2017-06-09.

  Dataset EGAD00001003354

• Analysis of tumor periphery and center-specific mutations in renal cell carcinoma

  Renal cell carcinoma (RCC) is a genomically heterogeneous tumor. In the present project, the question whether intratumoral heterogeneity follows a zonal pattern indicating spatial niches was addressed. Whole exome sequencing of 16 paired samples from tumor periphery and center revealed a number of region-specific functional SNVs and Indels. Therefore, RCCs are not composed of evenly admixed tumor cells but show topological differences in their clonal composition.

  Dataset EGAD00001002067

• microRNA-seq of human serum from a longitudinal study of 66 women with no history of cancer

  This dataset includes microRNA sequencing data from 198 human serum samples, representing a subset of 66 women with no history of cancer who participated in the UKCTOCS study and with serum samples collected at three timepoints over a period of up to 5 years. Small RNA libraries prepared from the serum samples were sequenced with 50-bp single end reads on an Illumina HiSeq 2000 instrument. Data is provided as FASTQ files.

  Dataset EGAD00001004348

• Melanoma-Til Study RNAseq

  In this study, mutations present in a series of human melanomas (stage IV disease) will be determined, using autologous blood cells to obtain a reference genome. From each of the samples that are analyzed, tumour-infiltrating T lymphocytes have also been isolated. This offers a unique opportunity to determine which (fraction of) mutations in human cancer leads to epitopes that are recognized by T cells. The resulting information is likely to be of value to understand how T cell activating drugs exert their action.

  Dataset EGAD00001000325

• ENU-LS-411N-TripleTherapy

  BRAF V600E colorectal cancers do not respond to the only currently FDA approved targeted therapy for CRC. There is currently a trial underway in the UK recruiting V600E CRC patients for treatment with a triple therapy combination of Cetuximab, Trametinib and Dabrafenib. We have mutagenized a pool of V600E CRC cell lines and treated with this triple therapy to select out drug resistant clones. We will now sequence these drug resistant clones with the aim of identifying common point mutations engendering resistance to this new therapy.

  Dataset EGAD00001002051

• Whole exome sequencing of young onset Primary Sclerosing Cholangitis

  Primary sclerosing chloangitis is a rare autoimmune disease of the liver (prevalence =10/100,000) with a mean age of onset of 40 years. We are currently undertaking GWASand immunochip experiments to identify loci underlying PSC susceptibility. Through ourcollaborators at the University of Calgary we have access to DNA from three parent-offspringtrios where the children required liver transplants due to PSC before the age of 9. These areextremely rare cases indeed and we believe that exome-sequencing represents a powerfulmeans of identifying the causal mutation underlying this severe phenotype.

  Dataset EGAD00001000671

• RNASeq_EGAS00001001306

  RNASeq sequencing. Each library was sequenced using TruSeq SBS Kit v3-HS, in paired-end mode with a read length of 2 × 76 bp. We generated more than 20 million paired-end reads for each sample in a fraction of a sequencing lane on HiSeq2000 (Illumina Inc.) following the manufacturer’s protocol. Image analysis, base calling and quality scoring of the run were processed using the manufacturer’s software Real Time Analysis (RTA 1.13.48) and followed by generation of FASTQ sequence files.

  Dataset EGAD00001001443

• Long-read sequencing identifies a common transposition haplotype predisposing for CLCNKB deletions

  Long-read whole genome sequencing, long-read long-range PCR sequencing, targetted long fragment long-read sequencing data of the CLCNKA/CLCNKB locus in 27 Bartter syndrome patients. Multiple different deletion alleles are identified and a new common transposition haplotype predisposing for CLCNKB deletions is described.

  Study EGAS00001007339

• Projects

  Projects Jointly managed by the European Bioinformatics Institute (EMBL-EBI) in Cambridge (UK) and the Centre for Genomic Regulation (CRG) in Barcelona, the EGA provides an invaluable service to the worldwide biomedical research community. The teams leading the EGA are involved in several international partnerships and consortia in numerous scientific fields, where they contribute to ambitious projects. In addition to the project listed below, The EGA is in a long-standing partnership with the Global Alliance for Genomics and Health (GA4GH), as described on the dedicated page. On-going projects Project Duration Domain Funder Tags EASIGEN-DS | The EASIGEN-DS project aims to conduct a design study to establish a new European Research Infrastructure on Advanced Genomics Technologies, EASIGEN. To develop an excellent scientific, technological and operational design, we will conduct landscape studies, stakeholder consultations, and community surveying. 2025-2028 Genomic and health data Horizon Europe DATA MANAGEMENT DOCUMENTATION INFRASTRUCTURE Go-IMPaCT | Go-IMPaCT will contribute sequenced genomes and provide infrastructure as part of IMPaCT-Cohort, one of the three fundamental pillars of the Precision Medicine Infrastructure associated with Science and Technology (IMPaCT) program in Spain. Along with the Genome of Europe (GoE) project, around 18.000 people will have their genomes sequenced, also contributing to Spain's commitments in 1+MG. Go-IMPaCT will fund the development of an EGA node to manage and share this genomic and phenoclinic data, laying the foundations for regional and ethnic genomic variability in Spain to be available for research purposes. The IMPaCT cohort is created with the spirit of being an open research tool, compatible with the rest of the health research ecosystem, and other international initiatives. 2025-2027 Large-scale genomics and health data; personalised medicine Instituto de Salud Carlos III ACCESS DISCOVERY INFRASTRUCTURE METADATA STANDARDS FAIR-FEGA | This project seeks to accelerate data depositions into FEGA, significantly increasing the data flow in and from FEGA nodes. It will build capacity within the FEGA nodes and increase awareness in a wide range of stakeholders, thus altogether achieving the ultimate goal of enhancing data reuse. The project will be carried out by a strategic consortium comprising seven ELIXIR nodes and two ELIXIR communities. 2025-2026 Not applicable ELIXIR ACCESS DISCOVERY DOCUMENTATION INFRASTRUCTURE METADATA STANDARDS FEGA-Connect | A consortium of six ELIXIR nodes plus the Polish FEGA node (in-kind contribution) joining forces to build a solid base to develop solutions for effective multi-omic sensitive data integration between FEGA nodes and other infrastructures and specialised Data repositories. We aim to promote a more coherent data deposition, discoverability and retrieval of multi-omics datasets, providing FAIRer data and consequently accelerating research. 2025-2026 Multi-omics data ELIXIR ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE METADATA STANDARDS IMPaCT-Data 2 | IMPaCT-Data 2 will develop a digital platform for the integration and modelling of biomedical data associated with IMPaCT (Precision Medicine Infrastructure associated with Science and Technology) projects in Spain. It will deploy a sustainable infrastructure that facilitates the integration, standardisation, interoperability and analysis of clinical, genomic, molecular and medical imaging data. This platform will be aligned with European projects such as Genome of Europe (GoE), the first project to make use of the European Genomic Data Infrastructure (GDI), and EUCAIM. IMPaCT-Data 2 will benefit from advanced Artificial Intelligence and High Computing Capacity Systems capabilities, offering robust and accessible tools for researchers from the National Health System in Spain. 2025-2026 Large-scale genomics and health data; personalised medicine Instituto de Salud Carlos III ACCESS DISCOVERY INFRASTRUCTURE METADATA STANDARDS ERDERA | The European Rare Disease Research Alliance (ERDERA) takes over EJPRD to deliver concrete health benefits to rare disease patients in the next decade by advancing prevention, diagnosis and treatment research. To leave no one behind, over 170 organisations championed by the European Union and member states are working hand in hand to make Europe a world leader in rare diseases research and innovation. 2024-2034 Rare diseases Horizon Europe; "La Caixa" Foundation cofunds CRG's contribution ACCESS DATA ANALYSIS DISCOVERY INFRASTRUCTURE GoE | The Genome of Europe initiative aims to build a European network of national genomic reference cohorts of at least 500.000 citizens. These reference cohorts will be selected to be representative of the European population. 2024-2028 Large-scale genomic and health data Horizon Europe ACCESS DISCOVERY INFRASTRUCTURE METADATA STANDARDS HEREDITARY | HEREDITARY aims to transform the way we approach disease detection, prepare treatment response, and explore medical knowledge by building a robust, interoperable, trustworthy, and secure framework that integrates multimodal health data (including genetic data) while ensuring compliance with cross-national privacy-preserving policies. 2024-2027 Neurodegenerative disorders, gut-brain interplay Horizon Europe DATA MANAGEMENT DATA ANALYSIS EOSC-ENTRUST | The mission of EOSC-ENTRUST is to create a European network of trusted research environments for sensitive data and to drive European interoperability by joint development of a common blueprint for federated data access and analysis. 2024-2026 Trusted Research Environment Horizon Europe INFRASTRUCTURE EBV-MS | "Targeting Epstein-Barr Virus Infection for Treatment and Prevention of Multiple Sclerosis". The ambitious goals of the project are to answer the questions why only a few EBV infected persons develop MS, and define the underlying mechanism of this process, as well as clarify if targeting the EBV infection can prevent MS or improve the disease course. 2023-2028 Viral-host genetics; immune response; disease modelling; Disease prevention Horizon Europe DATA MANAGEMENT DATA ANALYSIS WISDOM | WELL-BEING IMPROVEMENT THROUGH THE INTEGRATION OF HEALTHCARE AND RESEARCH DATA AND MODELS WITHOUT BORDER FOR CHRONIC IMMUNE-MEDIATED DISEASES aims to deploy novel approaches for data processing, harmonisation, management, and secure data sharing and federated access for diseases like multiple sclerosis. Using an end-user guided approach, it will facilitate responsible and critical assessment of the use of AI in healthcare. 2023-2028 Chronic immune-mediated diseases Horizon Europe DATA MANAGEMENT INFRASTRUCTURE EUCAIM | EUropean Federation for CAncer IMages is a project that will build a highly secure, federated and large-scale European cancer imaging platform, with capabilities that will greatly enhance the potential of Artificial Intelligence in oncology. 2023-2027 Cancer Digital Europe Programme (DIGITAL) DISCOVERY CONTAGIO | CONTAGIO (COhorts Network To be Activated Globally In Outbreaks) aims to create coordination mechanisms to rapidly react to infectious disease (re-)emergence in low- and middle-income countries (LMICs). 2023-2026 Infectious Diseases European Commission - Horizon Europe ACCESS DATA MANAGEMENT DISCOVERY Youth-GEMs | Youth-GEMS (Gene Environment Interactions in Mental Health TrajectorieS of Youth) will conduct research into the genetic and environmental factors of mental health in young European people. 2022-2027 Mental health European Commission - Horizon Europe DATA MANAGEMENT DISCOVERY GDI | The European Genomics Data Infrastructure project is enabling access to genomic and related phenotypic and clinical data across Europe. It is doing this by establishing a federated, sustainable and secure infrastructure to access the data. 2022-2026 Genomic and health data European Commission - Horizon Europe; "La Caixa" Foundation cofunds CRG's contribution DISCOVERY DOCUMENTATION INFRASTRUCTURE EOSC4Cancer | EOSC4Cancer builds on existing projects, research outcomes and established community solutions to create the federated FAIR data, analysis and services infrastructure needed for European Cancer research programmes. 2022-2025 Cancer European Commission - Horizon Europe DISCOVERY IMPaCT-T2D | The IMPaCT-T2D project aims at studying the complete genomes of a large cohort of patients with Type 2 Diabetes mellitus (T2D), using modern sequencing technologies and artificial intelligence (AI) in order to improve the stratification and pharmacological treatment in the context of precision medicine. 2022-2025 Cardiovascular and Complex Diseases Spanish Ministry of Science and Innovation; Instituto de Salud Carlos III ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE EuCanImage | A European Cancer Image Platform Linked to Biological and Health Data for Next-Generation Artificial Intelligence and Precision Medicine in Oncology. 2020-2025 AI Solutions in Oncology European Commission - H2020 Programme; "La Caixa" Foundation cofunds CRG's contribution DATA MANAGEMENT METADATA STANDARDS GenoMed4ALL | A consortium built to empower personalised medicine in the field of haematological diseases through the use of AI and the pooling of genomic and clinical data. 2020-2025 Hematological diseases European Commission - H2020 Programme DISCOVERY METADATA STANDARDS Completed projects Project Duration Domain Funder Tags BY-COVID | The BeYond-COVID project aims to make COVID-19 data accessible to scientists in laboratories but also to anyone who can use it, such as medical staff in hospitals or government officials. Going beyond SARS-CoV-2 data, the project will provide a framework for making data from other infectious diseases open and accessible to everyone. 2021-2024 Infectious diseases European Commission - H2020 Programme ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE IMPaCT-Data | IMPaCT-Data aims to create the infrastructure for secondary use of data from Spanish healthcare systems - electronic health records, medical imaging and genomic repositories - and contribute with the knowledge and methodology produced to the healthcare system. 2021-2024 Large-scale genomics and health dataSpanish Ministry of Science and Innovation; Instituto de Salud Carlos III ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE LaMarató | It is a project aimed at creating and developing a catalan interhospitalary network to interrogate genetic variants from thousands of genetic tests carried out in patients with rare diseases from the main catalan hospitals. 2021-2024 Genomic and health data Fundació La Marató de TV3 (catalan foundation) DISCOVERY HealthyCloud | This consortium will contribute a Strategic Agenda towards the European Health Research and Innovation Cloud. The project will work in collaboration with a broad range of stakeholders to ensure that all voices are included and that the results are technically and ethically sound. 2021-2023 Not Applicable European Commission - H2020 Programme DOCUMENTATION B1MG | Beyond 1 Million Genomes aims to create a network of genetic and clinical data across Europe. The project provides coordination and support to the 1+ Million Genomes Initiative (1+MG). This initiative is a commitment of 24 EU countries, the UK and Norway to give cross-border access to one million sequenced genomes by 2022. 2020-2023 Not applicable European Commission - Horizon Europe DATA MANAGEMENT INFRASTRUCTURE METADATA STANDARDS ELIXIR-CONVERGE | An alliance with the goal of Connecting and aligning ELIXIR Nodes to deliver sustainable FAIR life-science data management services. 2020-2023 Data Management and Infectious Diseases European Commission - H2020 Programme DATA MANAGEMENT INFRASTRUCTURE METADATA STANDARDS IHCC | The International HundredK+ Cohorts Consortium aims to create a global platform for translational research – informing the biological and genetic basis for disease and improving clinical care and population health. 2020-2022 Translational research NIH; The Wellcome Trust; CZI INFRASTRUCTURE METADATA STANDARDS PPCG | The Pan Prostate Cancer Group aims to harmonise and interrogate Whole Genome DNA Sequence data generated around the world from over 2000 men with prostate cancer, with associated transcriptome and methylome data to include men from different clinical categories, and ethnicities. This project is about providing breakthrough advances through analysis of a very large series of Whole Genome DNA data from prostate cancer contributed by many of the leading scientists and clinicians working in prostate cancer genomics. 2019-2024 Cancer Cancer Research UK DATA MANAGEMENT CINECA | Consortium providing a Federated solution enabling population-scale genomic and biomolecular data accessible across international borders accelerating research and improving the health of individuals resident across continents. 2019-2023 Large-scale Genomics and Health Data European Commission - H2020 Programme ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE EASI-Genomics | A project designed to provide easy access to cutting-edge DNA sequencing technologies to researchers from academia and industry, within a framework that ensures compliance with ethical and legal requirements, as well as FAIR and secure data management. 2019-2023 Next Generation Sequencing European Commission - H2020 Programme ACCESS EJP-RD | An European consortium built to create a comprehensive, sustainable ecosystem allowing a virtuous circle between research, care, and medical innovation. 2019-2023 Rare diseases European Commission - H2020 Programme ACCESS DATA MANAGEMENT DOCUMENTATION METADATA STANDARDS EOSC-Life | EOSC-Life brings together the 13 Life Science research infrastructures (LS RIs) to create an open, digital and collaborative space for biological and medical research. The project will publish 'FAIR' data and a catalogue of services provided by participating RIs for the management, storage and reuse of data in the European Open Science Cloud (EOSC). 2019-2023 Not applicable European Commission - H2020 Programme DOCUMENTATION EUCANCan | A federated network aiming at implementing a cultural, technological and legal integrated framework across Europe and Canada, to enable and facilitate the efficient sharing of cancer genomic data. 2019-2023 Cancer European Commission - H2020 Programme DATA MANAGEMENT METADATA STANDARDS The Federated EGA framework: supporting sensitive data management across the ELIXIR Nodes | This project is a direct continuation of the FHD IS with the goal to position the FEGA framework as the core infrastructure driver to support human data sharing for research. 2019-2023 Human genomic data ELIXIR INFRASTRUCTURE UK Biobank | UK Biobank is a large-scale biomedical database and research resource, containing in-depth genetic and health information from half a million UK participants. This project is to archive whole genome sequencing and other genetic data for UK Biobank participants. 2019-2023 Large-scale Genomics and Health Data The Wellcome Trust; UKRI; Amgen; AstraZeneca; GSK; Johnson & Johnson DATA MANAGEMENT INFRASTRUCTURE VEIS | The core mission of VEIS is to create an open ecosystem of technologies that will address and adapt to the requirements of the systems used to analyse and interpret -omics and clinical data in research and application environments in biomedicine. The aim of the project is to leverage the value of the EGA for both industry and society. 2019-2022 Oncology and Rare diseases Generalitat de Catalunya and European Regional Development Fund (ERDF) ACCESS DISCOVERY ELIXIR BEACON IS | This study follows on from a number of earlier activities that have established the ELIXIR Beacon Project. The main aim is to extend the Beacon protocol, developed at EGA, to become the reference ELIXIR Data Discovery product 2019-2021 Not applicable ELIXIR DISCOVERY ELIXIR FHD IS | This project coordinates the delivery of FAIR compliant metadata standards, interfaces, and reference implementation to support the federated ELIXIR network of human data resources. 2019-2021 Human genomic data ELIXIR INFRASTRUCTURE ELIXIR Rare Disease | The Rare Disease Community extends and generalises the system of access authorisation and high volume secure data transfer developed within the EGA. The goal of the Community is to create a federated infrastructure that will enable researchers to discover, access and analyse different rare disease repositories across Europe. It is doing this in partnership with other European infrastructure projects, namely RD-CONNECT, BBMRI-ERIC and E-Rare.2019-2021 Rare diseases ELIXIR INFRASTRUCTURE Solve-RD | Solve-RD - solving the unsolved rare diseases - is a research project funded by the European Commission. It echoes the ambitious goals set out by the International Rare Diseases Research Consortium (IRDiRC) to deliver diagnostic tests for most rare diseases by 2020. The current diagnostic and subsequent therapeutic management of rare diseases is still highly unsatisfactory for a large proportion of rare disease patients - the unsolved RD cases. For these unsolved rare diseases, we are unable to explain the etiology responsible for the disease phenotype, predict the individual disease risk and/or rate of disease progression, and/or quantitate the risk of relatives to develop the same disorder. 2018-2024 Rare diseases European Commission - H2020 Programme ACCESS DATA MANAGEMENT METADATA STANDARDS EuCanShare | An EU-Canada joint infrastructure for next-generation multi-Study Heart research. 2018-2022 Cardiovascular Diseases European Commission - H2020 Programme ACCESS METADATA STANDARDS

  Documentation about/projects-and-funders/projects

• Sudden Cardiac Death in Heart Failure Trial (SCD-HeFT-BioLINCC)

  Data Access NOTE: Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives The Sudden Cardiac Death in Heart Failure Trial (SCD-HeFT) was designed to evaluate the hypothesis that amiodarone or a conservatively programmed shock-only, single-lead implantable cardioverter defibrillator (ICD) would decrease the risk of death from any cause in a broad population of patients with mild-to-moderate heart failure. Background Patients with congestive heart failure (CHF) can die suddenly and unpredictably from arrhythmia despite the use of proven medical therapies, such as beta-blockade. Two approaches have been developed to prevent sudden death among patients with CHF: therapy with amiodarone and therapy with an ICD. However, most of the mortality data on amiodarone and ICD therapy at the time of the study had been obtained in clinical trials performed after myocardial infarction in patients without CHF or those with ventricular arrhythmias. Thus, more data was needed to guide these therapies in patients who did not meet these criteria. Participants There were a total of 2521 participants. 847 were randomly assigned to placebo, 845 to amiodarone, and 829 to ICD therapy. Design Before randomization, participants underwent electrocardiography, a 6-minute walk test, 24-hour ambulatory electrocardiography, liver and thyroid function studies, and chest radiography. Participants were required, if clinically reasonable, to receive treatment with a beta-blocker and an angiotensin-converting-enzyme inhibitor, as well as an aldosterone antagonist, aspirin, and statins, when appropriate. Participants were randomly assigned in equal proportions to receive placebo, amiodarone, or a single-chamber ICD programmed to shock-only mode. Participants assigned to amiodarone or matching placebo began therapy as outpatients immediately after randomization. Placebo and amiodarone were administered as a loading dose of 800 mg/day for one week, 400 mg/day for three weeks, and then as a daily maintenance dosage according to weight and bradycardia status. Participants assigned to ICD therapy received their device a median of three days after randomization. The goal of ICD therapy was to treat only rapid, sustained ventricular tachycardia or ventricular fibrillation. Dual-chamber or biventricular devices, or antitachycardia or rate-response pacing therapies were not permitted. The ICD was uniformly programmed to have a detection rate of 187 beats per minute or more. Antibradycardia pacing was initiated only if the intrinsic rate decreased to less than 34 beats per minute. Median follow-up was 45.5 months. The primary end point was death from any cause. Secondary outcome measures included cardiac mortality, arrhythmic mortality, morbidity, quality of life, and incremental cost-effectiveness of the interventions. Each active treatment arm was compared to the placebo drug arm. Conclusions In participants with NYHA class II or III CHF and LVEF of 35% or less, amiodarone had no favorable effect on survival, whereas single-lead, shock-only ICD therapy reduced overall mortality by 23%.

  Study phs003654

• Best Endovascular vs. Best Surgical Therapy in Patients With Critical Limb Ischemia (BEST CLI-BioLINCC)

  Data Access NOTE Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives To compare the effectiveness of surgical treatment to the effectiveness of endovascular treatment in adults with chronic limb-threatening ischemia who are eligible for both treatment options. Background Peripheral artery disease (PAD) affects more than 200 million people worldwide. A portion of those individuals develop chronic limb-threatening ischemia (CLTI). CLTI is associated with severe health outcomes. CLTI is defined by ischemic foot pain at rest, ischemic ulcerations, or gangrene. Treatment for CLTI includes revascularization to improve limb perfusion and limit the risk of amputation. However, the choice of surgery or endovascular therapy for revascularization varies greatly. The extent to which this variability affects clinical outcomes in patients with CLTI is unknown. The BEST-CLI trial was initiated to determine whether endovascular revascularization was superior to surgical revascularization in patients with CLTI. Participants A total of 1434 participants with a single segment of great saphenous vein comprised cohort 1. Of these, 718 participants were randomly assigned to the surgical treatment group and 716 participants were randomly assigned to the endovascular therapy group. A total of 396 participants needing an alternative conduit comprised cohort 2. Of these, 197 participants were randomly assigned to the surgical treatment group and 199 participants were randomly assigned to the endovascular therapy group. Design BEST-CLI was an international, randomized, open-label trial. Participants were assigned to one of two cohorts based on the availability of a single segment of great saphenous vein. Participants in both cohorts were randomly assigned to either surgery or endovascular therapy. Follow-up was performed at 30 days after the procedure, 3 months, 6 months, and every 6 months thereafter up to 84 months after randomization. Telephone visits in lieu of clinic visits were planned at 30 months and every 12 months thereafter and at the end of the trial. Participants were followed for major adverse cardiovascular events (myocardial infarction, stroke, or death from any cause), quality of life, level of pain, and performance on the six-minute walk test. The primary outcome was a composite of major adverse limb events or death from any cause. A major adverse limb event was defined as above ankle amputation of the index limb or a major index-limb reintervention (new bypass, interposition graft revision, thrombectomy, or thrombolysis). Conclusions Among patients with CLTI who had an adequate great saphenous vein for surgical revascularization (cohort 1), the incidence of a major adverse limb event or death was significantly lower in the surgical group than in the endovascular group. Among the patients who lacked an adequate saphenous vein conduit (cohort 2), the outcomes in the two groups were similar. Farber A, Menard MT, Conte MS, et al. Surgery or Endovascular Therapy for Chronic Limb-Threatening Ischemia. N Engl J Med. 2022;387(25):2305-2316. PMID 36342173

  Study phs003844

• A small cell lung cancer genome reports complex tobacco exposure signatures

  Cancer is driven by mutation. Worldwide, tobacco smoking is the major lifestyle exposure that causes cancer, exerting carcinogenicity through 60 chemicals that bind and mutate DNA. Using massively parallel sequencing technology, we sequenced a small cell lung cancer cell line, NCI-H209, to explore the mutational burden associated with tobacco smoking. 22,910 somatic substitutions were identified, including 132 in coding exons. Multiple mutation signatures testify to the cocktail of carcinogens in tobacco smoke and their proclivities for particular bases and surrounding sequence context. Effects of transcription-coupled repair and a second, more general expression-linked repair pathway were evident. We identified a tandem duplication that duplicates exons 3-8 of CHD7 in-frame, and another two lines carrying PVT1-CHD7 fusion genes, suggesting that CHD7 may be recurrently rearranged in this disease. These findings illustrate the potential for next-generation sequencing to provide unprecedented insights into mutational processes, cellular repair pathways and gene networks associated with cancer.

  Study EGAS00000000051

• Comprehensive Omics Analysis of Pediatric Solid Tumors and Establishment of a Repository for Related Biologic Studies (10C0086)

  This study (10-C-0086) collected and analyzed tumor and circulating tumor omics of pediatric and young adult patients with relapsed rhabdomyosarcoma who were co-enrolled in and receiving treatment on the interventional study 17-C-0049. We sought to describe the summary genomic findings of tumors, and report on the detection of circulating tumor DNA (ctDNA) in serial samples. Tumor tissue and blood were collected and analyzed. Tumor samples were subjected to whole exome and/or whole genome sequencing paired with RNA-Seq. Cell free DNA (cfDNA) was extracted from serially collected blood samples and sequenced. Fusion status, mutations, and IGF1R and YES1 expression from tumor samples revealed the presence of a PAX3 fusion in most samples, a number of common mutations, and universal but heterogeneous expression of IGF-1R and YES1. ctDNA was detected above the 3% threshold in a majority of patients and analysis of cfDNA demonstrated an ability to monitor tumor clonal evolution.

  Study phs003243

• Blepharospasm in a Multiplex African-American Pedigree

  Blepharospasm (BSP) is a late-onset focal dystonia characterized by involuntary contractions of the orbicularis oculi muscles. Genetics plays an important role on the pathogenesis of BSP, especially in hereditary BSP families. In this project, a large African-American pedigree with BSP was phenotypically characterized and its relationship with known common dystonia genes was investigated with Sanger sequencing on dystonia genes such as THAP1, TOR1A and GNAL. And whole-exome sequencing (EXOME) of the proband was performed to identify all other dystonia-associated genes for potentially pathogenic SVs. A novel THAP1 SV (c.314T>C, p.L105S) was identified in the family, however, this SV did not co-segregate with blepharospasm in the pedigree. No pathogenic or likely pathogenic SVs in other dystonia-associated genes were identified with whole-exome sequencing. The current study makes available phenotype data and summary genotype data of n=12 family members (mutation absent/heterozygous for THAP1); whole exome sequencing data of one (het) subject are available through public SRA.

  Study phs001206

• A Whole Genome Association Scan for Myopia and Glaucoma Endophenotypes using Twin Studies

  Myopia and glaucoma are highly prevalent ophthalmic disorders worldwide and contribute significantly to ocular morbidity. There is substantial evidence that genetic factors play a significant role in the development of non-syndromic myopia and glaucoma. We propose to perform mapping studies for well-characterized twin populations in the United Kingdom and Australia in order to ultimately identify implicated genes for these disorders and related ocular parameters. This will provide a fundamental molecular understanding of how these disorders develop, and may lead to directed physiologic (i.e. pharmacologic, gene therapy) interventions. Our aim is to dissect the genetic basis of the eye disorders myopia and glaucoma. Instead of limited analyses of the trait/disease in a dichotomous manner, we are using continuous phenotypes of measures of refraction and intermediate phenotypes of glaucoma to analyze quantitative traits in unselected population samples of volunteer twins. Achievement of this goal requires cooperative efforts and large sample sizes. Thus, we have created an international collaboration of large complementary studies.

  Study phs000142

• ZNF703 is a common Luminal B breast cancer oncogene that differentially regulates luminal and basal progenitors in human mammary epithelium.

  The telomeric amplicon at 8p12 is common in oestrogen receptor-positive (ER+) breast cancers. Array-CGH and expression analyses of 1172 primary breast tumours revealed that ZNF703 was the single gene within the minimal amplicon and was amplified predominantly in the Luminal B subtype. Amplification was shown to correlate with increased gene and protein expression and was associated with a distinct expression signature and poor clinical outcome. ZNF703 transformed NIH 3T3 fibroblasts, behaving as a classical oncogene, and regulated proliferation in human luminal breast cancer cell lines and immortalized human mammary epithelial cells. Manipulation of ZNF703 expression in the luminal MCF7 cell line modified the effects of TGFβ on proliferation. Overexpression of ZNF703 in normal human breast epithelial cells enhanced the frequency of in vitro colony-forming cells from luminal progenitors. Taken together, these data strongly point to ZNF703 as a novel oncogene in Luminal B breast cancer.

  Study EGAS00000000082

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  DNA methylation (DNAm) is a key epigenetic mark that shows profound alterations in cancer. Read-level methylomes enable more in-depth DNAm analysis due to the broad coverage and preservation of rare cell-type signals, compared to array-based data such as 450K/EPIC array. Here, we propose MethylBERT, a novel Transformer-based model for read-level methylation pattern classification. MethylBERT identifies tumour-derived sequence reads based on their methylation patterns and genomic sequence and the method estimates tumour cell fractions within bulk samples. In our evaluation, MethylBERT outperforms existing deconvolution methods and demonstrates high accuracy regardless of methylation pattern complexity, read length and read coverage. Moreover, we show its applicability to cell-type deconvolution as well as non-invasive early cancer diagnostics using liquid biopsy samples. MethylBERT represents a significant advancement in read-level methylome analysis and enables accurate tumour purity estimation. The broad applicability of MethylBERT will enhance studies on both tumour and non-cancerous bulk methylomes.

  Study EGAS50000000806

• Efficient prediction of a spatial transcriptomics profile better characterizes breast cancer tissue sections without costly experimentation

  Spatial transcriptomics is an emerging technology requiring costly reagents and considerable skills, limiting the identification of transcriptional markers related to histology. Here, we show that predicted spatial gene-expressions in unmeasured regions and tissues can enhance biologists��� histological interpretations. We developed the Deep learning model for Spatial gene Clusters and Expression, DeepSpaCE and confirmed its performance using the spatial-transcriptome profiles and immunohistochemistry images of consecutive human breast cancer tissue sections. For example, the predicted expression patterns of SPARC, an invasion marker, highlighted a small tumor-invasion region that is difficult to identify using raw data of spatial transcriptome alone because of a lack of measurements. We further developed semi-supervised DeepSpaCE using unlabeled histology images and increased the imputation accuracy of consecutive sections, enhancing applicability for a small sample size. Our method enables users to derive hidden histological characters via spatial transcriptome and gene annotations, leading to accelerated biological discoveries without additional experiments.

  Study JGAS000290

• A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies

  Pineoblastoma is a clinically aggressive childhood brain tumor composed of distinct molecular subgroups with divergent driver genes, demographics, and clinical outcomes. To identify developmental origins and mechanisms governing disease pathogenesis, we derive single-cell transcriptomes from pineal parenchymal tumors, aligning malignant cells with our atlas of pineal gland development to retrace cellular origins. Integrative computational analyses maps pineoblastoma origins to transient cycling pinealocyte progenitors during development. Lineage-specific perturbation of suspected drivers in the early pineal gland yields preclinical models representative of consensus molecular subgroups. Multi-omic characterization of patient tumors and these models uncovers a tumor-associated photoreceptor signature common to pineoblastoma, retinoblastoma, and Group 3 medulloblastoma. Transcriptional activity of this signature within respective cellular origins establishes a developmental basis for molecular similarities between entities. Photoreceptor signature constituents are selective dependencies across these anatomically distinct central nervous system malignancies, motivating future studies evaluating developmentally encoded programs of malignancy as potential therapeutic liabilities.

  Study EGAS50000001457

• Transcriptome changes in circulating immune cells of critical COVID-19 patients predict a specific metabolic and epigenetic imprint

  The progression to severe COVID-19 arises predominantly from a dysregulated host immune response, although the underlying regulatory mechanisms still remain partially elusive. This limits a prompt prediction of disease progression and restrains our understanding of “long COVID”. Here, we analyzed the transcriptomes of peripheral blood mononuclear cells collected from COVID-19 patients experiencing different degrees of the disease and control patients. In critical COVID-19 patients, we found an altered regulatory network involving microRNAs, long non-coding RNAs, and coding genes that control mRNA translation-related genes, epigenetics, and metabolism. We also observed an upregulation of tRNA aminoacylation genes and increased expression of coding genes enriched for the cognate amino acids. Collectively, our findings indicate a broad perturbation of the gene expression landscape that characterizes the aberrant host immune response in critical COVID-19 patients and is potentially coordinated by alterations in microRNA expression and tRNA metabolism.

  Study EGAS50000000965

• Full genome sequencing of a monozygotic twin discordant for schizophrenia

  We sequenced the genomes from a monozygotic twin discordant for schizophrenia and a tumor-normal pair of an ovarian cancer patient. Using whole-genome twin data to discriminate between correctly identified single nucleotide variants (SNVs) and errors a strategy for the accurate detection of SNVs was developed. By applying stringent sequencing quality measures, excluding error-prone regions and selecting SNVs identified by different mapping and variation calling algorithms, error rates were ~37-fold reduced. This enabled us to identify the first discordant SNVs in monozygotic twins using whole-genome sequencing. In addition, by showing that novel SNVs are highly enriched in errors, accurate estimates of the number of novel and rare SNVs occurring in unrelated Caucasian individuals were obtained. Finally, somatic mutations in coding and regulatory sequences were reliably identified in the highly rearranged ovarian tumor. Overall, our data demonstrate that strategies to reduce error rates in whole-genomes are required for disease gene discovery.

  Study EGAS00001000152

• A Genomic History of Aboriginal Australia

  The population history of Aboriginal Australians remains largely uncharacterised. We generated high-coverage genomes for 83 Aboriginal Australians (speakers of Pama-Nyungan languages) and 25 Papuans from the New Guinea Highlands. We find that Papuan and Aboriginal Australian ancestors diversified 25-40 thousand years ago (kya), suggesting early population structure in the ancient continent of Sahul (Australia, New Guinea and Tasmania). However, all studied Aboriginal Australians descend from a single founding population that differentiated ~10-32 kya. We infer a population expansion in northeast Australia during the Holocene (past c.10 kya) associated with limited gene flow from this region to the rest of Australia consistent with the spread of the Pama-Nyungan languages. We estimate that Aboriginal Australians and Papuans diverged from Eurasians 51-72 kya, following a single out of Africa dispersal, and subsequently admixed with different archaic populations. Finally, we report evidence of selection in Aboriginal Australians potentially associated with living in the desert.

  Study EGAS00001001766

• We describe a method to culture organoids from adult human kidney tissue and describe applications for the culture system.

  Adult Stem Cell (ASC)-derived organoids are 3D epithelial structures that recapitulate essential aspects of their organ of origin. We have developed conditions for the long-term growth of primary kidney epithelial organoids. Cultures can be established from mouse and human kidney tissue, as well as from urine and can be expanded for at least 20 passages (> 6 months). Chromosome numbers remain normal. Human organoids represent proximal as well as distal nephron segments, as evidenced by gene expression, immunofluorescence and tubular functional analyses. BK virus infection of organoids recapitulates in vivo phenomena. Organoids can be established from Wilms nephroblastoma. Kidney organoids from Cystic Fibrosis (CF) patient’s urine allowed ex vivo assessment of treatment efficacy. Finally, organoids cultured on microfluidic organ-on-a-chip plates adopt a tubular conformation and display active transport function. Adult kidney-derived organoids allow studies of hereditary, infectious and malignant kidney disease in a personalized fashion.

  Study EGAS00001002729

• Whole-genome plasma sequencing reveals focal amplifications as a driving force in metastatic prostate cancer

  Genomic alterations in metastatic prostate cancer remain incompletely characterized. Here we analyze 493 prostate cancer cases from the TCGA database and perform whole-genome plasma sequencing on 95 plasma samples derived from 43 patients with metastatic prostate cancer. From these samples, we identify established driver aberrations in a cancer-related gene in nearly all cases (97.7%), including driver gene fusions (TMPRSS2:ERG), driver focal deletions (PTEN, RYBP, SHQ1), and driver amplifications (AR, MYC). In serial plasma analyses, we observe changes in focal amplifications in 40% of cases. The mean time interval between new amplifications was 26.4 weeks (range: 5-52 weeks), suggesting that they represent rapid adaptations to selection pressure. An increase in neuron-specific enolase is accompanied by clonal pattern changes in the tumor genome, most consistent with subclonal diversification of the tumor. Our findings suggest a high plasticity of prostate cancer genomes with newly occurring focal amplifications as a driving force in progression

  Study EGAS00001001018