17510 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..Y2KA"

in 38.22 milliseconds.

• ESGI - Whole Genome Sequencing of NSPHS samples (2019-08-19)

  Whole genome sequencing of sampels from the NSPHS cohort. The samples are sequenced using the Illumina HiSeq X Ten system. . This dataset contains all the data available for this study on 2019-08-19.

  Dataset EGAD00001005267

• UCSF brain tumor data

  Single Nuclei ATAC seq data from GBM tumor samples. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005314

• MDA whole exome sequencing data for bladder cancer

  46 BAM files from 23 urothelial bladder cancer patients on an immunotherapy clinical trial. PBMC normal samples and solid tumor samples are paired. Alignment was done by BWA with reference genome hg19.

  Dataset EGAD00001005712

• Targeted panel sequencing for brainstem glioma

  Targeted panel sequencin on Illumina HiSeq X Ten of brainstem glioma primary tumor and blood samples

  Dataset EGAD00001006093

• Whole transcriptome sequencing datasets for Low-grade Serous Ovarian Carcinoma

  This dataset includes whole transcriptome sequencing reads from 8 cell lines based on TruSeq stranded mRNA kit (Illumina). They are all 2*75bp reads sequenced using Illumina NextSeq500.

  Dataset EGAD00001006441

• WES raw data for study "Molecular and functional profiling of plasmablastic lymphoma"

  1 cell line and 123 patient samples including 38 normal (22 paired normal and 16 unpaired), 85 tumor-initial, FASTQ file types, Agilent SureSelect Human All Exon V6 Kit

  Dataset EGAD00001006400

• HCV infected liver biopsy RNASeq from Boson clinical trial

  Bulk RNAseq from HCV infected liver biopsies. Two fastq files per sample for Paired end sequecing. Some samples were sequenced on multiple plates.

  Dataset EGAD00001006911

• miR-17-92 organoids

  Organoid cultures derived from colorectal adenomas were transduced with a miR-17-92 expressing vector. RNA from miR17-92-overexpressing organoids and respective non-transduced organoids (controls) was isolated for expression analysis.

  Dataset EGAD00001008480

• High-resolution analysis for urinary DNA jagged ends

  consists 17 cases, 7 control cases and 10 cancer cases.

  Dataset EGAD00001008594

• Isala Cross sectional Flow Meta Data

  This meta data contains extensive meta data from the cross sectional flow of the Isala Citizen Science project. The meta data file contains ENA Accession numbers for 16S Microbiome data, and cleaned responses to questionnaires.

  Dataset EGAD00001009890

• Human serum small non-coding RNA sequencing

  Human small non-coding RNA sequencing of serum from sons of PCOS mothers (n=9) and sons of control mothers (n=9), see publication for details.

  Dataset EGAD00001010165

• Long-read amplicon sequencing data per risk gene

  Each gene contains individual nanopore long-read amplicon sequencing FASTQ files for: individual (IND) 01-05 and brain regions: Brodmann Area (BA): 10, 24, 9, 46, caudate (CAUD), cerebellum (CBM) and temporal cortex (TCX).

  Dataset EGAD00001015350

• Dataset for hepatopancreaticobiliary_malignancy-RNA

  Rare cancer sequencing data of 119 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008863

• RNA Transcriptomic and DNA Methylation Landscape in FTLD-TDP and Controls

  Frontotemporal lobar degeneration (FTLD) is one of the leading causes of dementia in individuals younger than 65 years, with the aggregation of TDP-43 as one of the most common forms of FTLD. FTLD-TDP is clinically, genetically and pathologically heterogeneous, with GRN and C9orf72 as the most common genetic forms (although more than 50% of the cases are genetically unexplained), and A, B and C as the most common pathological subtypes. To investigate the molecular differences between the different forms of FTLD-TDP, we performed bulk RNA sequencing (RNAseq) and reduced representation bisulfite sequencing (RRBS) from different brain regions of FTLD-TDP patients and controls. The RNAseq dataset includes samples from the frontal cortex of 149 individuals, comprising 127 FTLD-TDP cases (genetically unexplained types A (27), B (20) and C (22), 24 GRN mutation carriers, and 34 C9orf72 expansion carriers) and 22 controls. The RRBS dataset includes samples from the frontal cortex of 158 individuals —119 FTLD-TDP cases (genetically unexplained types A (25), B (24), and C (25), 20 GRN mutation carriers, and 25 C9orf72 expansion carriers) and 39 controls; and from the cerebellum of 151 individuals —113 FTLD-TDP cases (genetically unexplained types A (24), B (21), and C (23), 20 GRN mutation carriers, and 25 C9orf72 expansion carriers) and 38 controls. In total, the study consists of data from 183 unique individuals, with some overlap across the different datasets.

  Study phs004075

• med-pchic-dac

  The data are accessible under the terms of the following Data Access Agreement that needs to be filled in, signed (by yourself and your institution’s official contact) and returned by email to med-pchic-dac@lists.cam.ac.uk

  Dac EGAC00001000523

• Whole-exome-sequencing in Frontotemporal dementia (FTD)

  To identify the genetic cause and modifiers of Frontotemporal dementia (FTD), we performed Whole-exome-sequencing of FTD patients.

  Study JGAS000374

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Dataset of Clonal Evolution of PPM1D Mutations in the Spectrum of Myeloid Disorders

  This dataset contains genomic profiles of 7 PPM1D-mutated patients across the spectrum of myeloid disorders using single-cell analyses (Tapestri technology) on diagnostic and longitudinal samples.

  Dataset EGAD50000001229

• FOCUS study

  Shallow whole genome sequencing of adavanced colorectal tumors from patients included in the FOCUS clinical trial. Performed to calculate assocations of irinotecan with copy-number alterations. Copy number aberration analysis of 349 enroled patients.

  Dataset EGAD50000001007

• Molecular pathways and cellular subsets associated with adverse clinical outcomes in overlapping immune-related myocarditis and myositis

  ScRNA-seq FASTQ files from myocarditis and control cardiac muscle samples; and myositis and control skeletal muscle samples.

  Dataset EGAD50000000488

• H3K27me3 Cut&Tag on beta cells

  H3K27me3 Cut&Tag datasets in human pancreatic islets and the EndoC-bH1 cell line

  Dataset EGAD50000000463

• HSP90 inhibitor resistant cells

  K562 cells were treated with different HSP90 inhibitors (PuH71 and Coumermycin A1) and the CNV profil was compared to the parental K562 (untreated). In addition, the CNV profile of HSP90AB1 knockout K562 cells was analyzed.

  Dataset EGAD00010002336

• The MLPA result of LAM disease

  Tumor biopsies from LAM disease were analyzed by MLPA to characterize the alterations in patients ,to elucidate the landscape of genetic/genomic alterations. The dataset include 44 samples.

  Dataset EGAD00010001757

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (COH_TNBC_RNAseq)

  To determine the trascriptional profiles of Triple Negative Breast Cancers (COH cohort)

  Study EGAS00001006002

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• Cell lines with telomere fusion-induced rearrangements

  Whole-genome somatic rearrangement and point mutation analysis in cell lines with induced telomere fusions.

  Dataset EGAD00001001629

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• Exome_Sequencing_of_Human_myeloid_malignancies

  This study involves exome sequencing of blood/bone marrow DNA from patients with myeloid malignancies. Blood DNA samples have been taken from patients at different timepoints of disease phenotype. We hope to elucidate mechanisms of clonal evolution in these patients.

  Dataset EGAD00001002213

• 16S rDNA amplicon sequencing of 196 human fecal samples of an Inulin cross-over trial

  16S rDNA amplicon sequencing of 196 human fecal samples of an Inulin cross-over trial in healthy, mildly constipated individuals.

  Dataset EGAD00001004956

• Giant congenital nevi exome sequencing

  Whole exome sequencing of eight affected skin biopsies (“lesional”) from five giant CMN patients (age range, 4-58) with matching unaffected skin (not available in one patient) along with germline DNA. Agilent SureSelect V5+UTRs.

  Dataset EGAD00001006283

• subset of WES data from umbrella study EGAS00001004338, used in EGAS00001004786

  linking 82 samples/82 runs of WES from EGAS00001004338 Umbrella study to EGAS0001004786 study

  Dataset EGAD00001006613

• RNA sequencing data of pretreatment tumor biopsies of patients treated in the OpACIN-neo trial

  The dataset includes RNA sequencing on pre-treatment tumor biopsies of lymph node metastases (n=65)

  Dataset EGAD00001006731

• Paired-end Whole Exome-seq analysis of TERT promoter duplication in GBM

  Dataset contains paired-end Whole Exome sequencing data from 5 tumor samples and 1 single normal blood sample from a single primary GBM patient.

  Dataset EGAD00001008768

• RNA-seq of frontal post-mortem human brain tissue

  RNA-sequencing dataset of post-mortem human brain tissue of FTD patients with mutations in GRN, MAPT and C9orf72 and healthy controls.

  Dataset EGAD00001008014

• TGL49_HBC CHARM panel

  Targeted panel sequencing of hereditary cancer syndrome-associated genes (TP53, BRCA1, BRCA2, PALB2, MLH1, MSH2, MSH6, PMS2, EPCAM, and APC) in plasma and buffy coat samples from healthy control patients.

  Dataset EGAD00001010001

• Single-cell CITE-seq from MDS patients with SF3B1 mutations

  Single-cell CITE(cellular indexing of transcriptomes and epitopes)-seq from MDS (n = 2, MDS02 in 2 replicates). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011281

• AmsterdamUMC Data Access Committee for the MAPS study

  The current data access committee reviews and assesses data requests of researchers that seek to gain access to data acquired from the MAping the Peritoneal immune System (MAPS) project as performed at the AmsterdamUMC, Amsterdam, Netherlands.

  Dac EGAC50000000096

• Clinical Utility of BRCA Research by Inocras, CMC and SMC (CUBRICS)

  This dataset consists of whole-genome sequences from 1,364 Korean breast cancers, with transcriptome data available for most cases

  Dataset EGAD50000001546

• The taxonomic composition of the human microbiome of healthy donors

  Single homogenized human stool samples from five healthy donors and mix were analyzed by shotgun sequencing to generate a baseline for the establishment of humanized microbiome to be transferred into mice.

  Dataset EGAD50000001119

• NanoString raw data

  NanoString raw data for a noeadjuvant combination PD-L1 plus CTLA-4 blockade trial on patients with cisplatin-ineligible operable urothelial carcinoma. All samples were FFPE tumor samples. Raw probe count data (.RCC files) were generated from nCounter Digital Analyzer (4.0.0.3).

  Dataset EGAD00010001852

• Sequencing data for oesophageal and related samples - BOs release 3 (RNA)

  Dataset EGAD00001003901

• Whole genome bisufite sequencing for smoking and non-smoking mother-child pairs

  WGBS data of whole blood samples from smoking and non-smoking mothers and their children at gestation/birth and follow-up years.

  Dataset EGAD00001000366

• WGS data for medulloblastoma samples (SJMB)

  WGS data of medulloblastoma tumor/control pairs.

  Dataset EGAD00001003126

• Low-coverage whole genome sequencing data to study "A biobank of patient-derived pediatric brain tumor models"

  Low-coverage whole genome sequencing data for 30 PDOX models (28 early passages, 4 late passages (2 overlaps)), 3 cell lines, and 21 matching human tumors

  Dataset EGAD00001003545

• RNA-seq colorectal adenomas NKI-AvL TGO series Gut2009

  The dataset "RNA-seq colorectal adenomas NKI-AvL TGO series Gut2009" includes 2 x 32 fastq files from paired-end mRNA sequencing on Illumina HiSeq2500 for 32 snap-frozen colorectal adenomas.

  Dataset EGAD00001004058

• RNA-seq colorectal carcinomas NKI-AvL TGO series Gut2009

  The dataset "RNA-seq colorectal carcinomas NKI-AvL TGO series Gut2009 " includes 2 x 29 fastq files from paired-end mRNA sequencing on Illumina HiSeq2500 for 29 snap-frozen colorectal carcinomas.

  Dataset EGAD00001004059

• H3Africa H3AChipDesign AWI-Gen

  60 samples from Burkina Faso and Ghana generated for the H3Africa Chip Design Study. The dataset includes BAM, FASTQ and decompressed gVCF files.

  Dataset EGAD00001004448

• Pilot Fetal Cell Atlas_RNAseq (2018-08-20)

  As part of the Human Cell Atlas we will study fetal tissue. . This dataset contains all the data available for this study on 2018-08-20.

  Dataset EGAD00001004305

• Genetics and Networks of Congenital Heart Defects

  Exome sequencing of families with Congenital Heart Defects of diverse sub-phenotypes. Comprises both parent-offspring trios for sporadic cases and multiplex families. Collaboration with David Brook, University of Nottingham. Funded by the British Heart Foundation.

  Dataset EGAD00001002251

• Whole genome sequencing generated from metastatic gliosarcoma patient samples

  This dataset contains whole genome sequencing data aligned to the b37 reference genome for 4 spatially and temporally distinct tumors from one patient with a matched normal blood sample.

  Dataset EGAD00001005745

• single-cell ATAC-seq

  Single-cell ATAC-seq data for 5 CLL samples (2 controls, 3 tumor) of the CancerEpiSys-PRECiSe project.

  Dataset EGAD00001005965

• Genome-wide data Iberian Roma

  VCF file with genome-wide data for 62 Iberian Roma samples.

  Dataset EGAD00001006358

• Whole exome sequencing datasets for Low-grade Serous Ovarian Carcinoma

  This dataset includes whole exome sequencing reads from 10 normal and 14 cell lines based on Agilent SureSelect XT Human All Exon v6. They are all 2*100bp reads sequenced using Illumina HiSeq4000.

  Dataset EGAD00001006440

• single cell RNAseq data of lung adenocarcinoma

  Single-cell RNA sequencing was performed for cells from five early-stage LUADs and fourteen multi-region normal lung tissues of defined spatial proximities from the tumors.

  Dataset EGAD00001006936

• Response labels from NABUCCO cohort 1 (NCT03387761)

  Data from NABUCCO cohort 1 (NCT03387761). This dataset includes the Response labels used for the analysis of the data. Details about the clinical definitions of Response can be found on the paper (https://doi.org/10.1038/s41591-020-1085-z)

  Dataset EGAD00001006853

• Bulk RNAseq fastq files

  RNAseq FASTq files from 15 samples from patients with ovarian cancer, 5 samples for each of the 3 tumor immune phenotypes (Infiltrated, Excluded and Desert).

  Dataset EGAD00001006975

• TPM matrix

  TPM matrices of counts from RNAseq data for IMvigor010 from bulk pre-treatment tumors.

  Dataset EGAD00001007653

• CBD-RAW-RNASEQ-MINI: Mini-bulk RNAseq data

  SmartSeq2 RNAseq data from 16 samples. For further information regarding this dataset, please contact Julian Knight and Alexander Mentzer at contact@combat.ox.ac.uk.

  Dataset EGAD00001007932

• RNA-seq

  This dataset contains the raw sequencing data (Runs) for all 10x Genomics single-cell RNA-seq Experiments.

  Dataset EGAD00001009823

• Raw data for "Spatial and temporal transcriptomics of medulloblastoma with chromothripsis identifies multiple genetic clones that resist to treatment and lead to relapse"

  FASTQ files from Illumina sequencing of 10x Visium experiments.

  Dataset EGAD00001010260

• Dataset for WES PCNSL

  WES sequencing of 23 samples from PCNSL tumor and blood control samples. Sequencing was performed on a NovaSeq 6000 and NextSeq 500 using Agilent SureSelectXT HS Human All Exon V7 and V8. Sequencing was always paired.

  Dataset EGAD00001010847

• DNA Double Strand Breaks in KMT2A-Rearranged AML patients

  DNA breakage at specific rearrangement-participating genes, which are more sensitive to a range of environmental and chemotherapeutic agents than other regions of the human genome, contributes to the generation of leukemia-causing rearrangements, and can be used as a predictor of susceptibility to cancer caused by gene rearrangements. As a direct proof-of-principle regarding the feasibility of employing fragile site breakage to identify and monitor high-risk populations to allow personalized treatments, genome-wide DNA break mapping/sequencing was used to determine whether preferential DNA breaks are generated at the major breakpoint regions of KMT2A in AML remission patients with previously diagnosed KMT2A rearrangement. We are submitting break mapping data from three patients with KMT2A rearrangements and three non-fusion patients, with and without etoposide treatments.

  Study phs002804

• Longitudinal Multi'omics of the Human Microbiome in Inflammatory Bowel Disease (IBDMDB)

  Inflammatory bowel diseases (IBD), including Crohn's disease (CD) and ulcerative colitis (UC), affect millions of individuals worldwide. The Integrative Human Microbiome Project (HMP2) characterized a total of 132 CD, UC and non-IBD patients across a year to generate longitudinal molecular profiles of host and microbial activity during this time frame. A total of 2,965 stool, biopsy and blood specimens were produced and analyzed from this cohort. A comprehensive view of the gut microbiome's functional dysbiosis during IBD activity was derived from analyzed samples each providing a different window into disease activity. The study's resources, results and data are available through the Inflammatory Bowel Disease Multi'omics Database (IBDMDB) provide the most comprehensive description of host and microbial activities in IBD to date.

  Study phs001626

• Multimodal Mapping of the Immune Landscape in Human Pancreatic Cancer

  Pancreatic ductal adenocarcinoma (PDA) is characterized by an immune-suppressive tumor microenvironment that has rendered it largely refractory to immunotherapy. We used single-cell RNA sequencing on patient tumors and matched blood, and we uncovered a previously unappreciated, complex environment of immune-suppressive cellular interactions. These experiments reveal immune checkpoint expression heterogeneity on individual patient T cells, with corresponding ligands on neoplastic and myeloid cells. TIGIT was upregulated on tumor infiltrating CD8+ T cells and was the only checkpoint receptor consistently expressed by exhausted CD8+ T cells. Clinical annotation of the samples revealed that the exhausted signature is most prominent in patients with advanced stages of disease. Our findings suggest individualized combination therapy, involving anti-TIGIT therapies, may be necessary to extend the benefits of immunotherapy to pancreatic cancer patients.

  Study phs002071

• Single-Cell Sequencing Reveals Distinct Microenvironment Cell Types Associated with Response to High Dose Melphalan and Autologous Stem Cell Transplant in Multiple Myeloma

  The aim of this study is to understand the transcriptome of microenvironment cells in pre- and post- autologous stem cell transplantation (ASCT) samples between patients with complete response and partial response to transplant. Here, we studied immune cells from 40 multiple myeloma patients who have undergone ASCT. Samples were collected from 40 multiple myeloma patients before and after ASCT. Samples were sorted using magnetic activated cell sorting (MACS) and the non-tumor CD138- fraction underwent 3' single cell RNA-sequencing (scRNA-seq) or 5' scRNA-seq + 5' T cell receptor sequencing (TCRseq), to determine the scRNA transcriptome and TCR repertoire. This study includes 24 samples with 3' scRNA-seq, 56 samples with 5' scRNA-seq, and 56 samples with 5' TCRseq data.

  Study phs003219

• Ethiopia Genome Project (high coverage)

  The Ethiopian area stands among the most ancient ones ever occupied by human populations and their ancestors. Particularly, according to archaeological evidences, it is possible to trace back the presence of Hominids up to at least 3 million years ago. Furthermore, the present day human populations show a great cultural, linguistic and historic diversity which makes them essential candidate to investigate a considerable part of the African variability. Following the typing of 300 Ethiopian samples on Illumina Omni 1M (see Human Variability in Ethiopia project, previously approved by the Genotyping committee) we now have a clearer idea on which populations living in the area include the most of the diversity. This project therefore aims to sequence the whole genome of 300 individuals at low (4-8x) depth belonging to the six most representative populations of the Ethiopian area to produce a unique catalogue of variants peculiar of the North East Africa. Furthermore 6 samples (one from each population) will also be sequenced at high (30x) depth to ensure full coverage of the diversity spectrum. The retrieved variants will be of great help in evaluating the demographic dynamics of those populations as well as shedding light on the migrations out of Africa.

  Dataset EGAD00001000696

• Ex vivo RNA-seq in moderate COVID-19 monocytes

  This dataset was used to compare gene expression profiles of ex vivo isolated classical CD14+ monocytes from patients with moderate COVID-19 to those of healthy individuals. Blood samples were taken from patients with moderate COVID-19 admitted to hospitals in London (Hammersmith Hospital, Charing Cross Hospital, Saint Mary’s Hospital) 3-14 days after disease onset and 0-2 days after hospitalization and positive PCR, and before study treatment initiation. Moderate patients displayed mild or moderate COVID-19 pneumonia, defined as grade 3 or 4 WHO severity. Samples were collected from March 2020 to February 2021. Healthy donors were Imperial College staff with no prior diagnosis of or recent symptoms consistent with COVID-19, and where possible, were matched in age and sex distribution with COVID-19 patients. None of the participants of this study were COVID-19 vaccinated. Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll Hypaque (GE Healthcare) gradient centrifugation <4 hours after blood collection. CD14+ monocytes were isolated using a positive selection magnetic sorting kit (StemCell Technologies, UK) from total PBMC and stimulated with vehicle, UV-inactivated SARS-CoV-2 (CoV-2). RNA was isolated using the RNeasy Micro Plus Kit (QIAGEN) following the manufacturer’s guidelines. RNA-sequencing was performed by the Oxford Genomics Centre. PolyA-enriched strand- specific libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kits (Illumina). All samples were pooled together and 150bp PE reads were sequenced on a Novaseq 6000 system.

  Dataset EGAD00001009800

• CcRCC_metabolic_heterogeneity

  Heterogeneity is a hallmark of clear cell renal cell carcinoma (ccRCC). In this study, hyperpolarized [1-13C]pyruvate MRI (HP-13C-MRI) was used to probe metabolic heterogeneity non-invasively in 6 ccRCC patients from which 58 tumor and healthy tissues biopsies were acquired postoperatively. MRI parameters were correlated with 146 metabolite concentrations and the expression of 2523 metabolic genes across 34 metabolic pathways. Using metabologram projections and pathway consensus scoring, several metabolic pathways were correlated with the metabolic MRI, including glycolysis, pentose phosphate pathway, and the TCA cycle. A simple thresholding approach applied to the imaging metrics was sufficient to provide meaningful metabolic pathway information. We also show that tissue metabolic heterogeneity increases in regions with higher pyruvate-to-lactate conversion on imaging. These results provide validation of the biological relevance of HP-13C-MRI and support the possibility of its clinical use to improve disease characterization, stratification, targeting of biopsies, and providing novel methods to monitor treatment response.

  Dataset EGAD00001015780

• Development of cell lines and mouse models of bone and soft tissue sarcoma to establish novel treatment

  Malignant giant-cell tumors are extremely rare bone sarcomas that transform from conventional giant-cell tumors during long periods of treatment. We have applied the culture methods and succeeded in establishing patient-derived organoids (PDO) of rare sarcomas. This study aimed to investigate the genomic characteristics of our established novel organoids from human malignant giant-cell tumors. The developed tumors with xenograft were genomically analyzed to compare their characteristics with those of the original tumors. Genetic changes over time throughout treatment were analyzed, and the genomic status of the established organoid was confirmed. Next generation sequencing revealed that the established organoids lacked the H3-3A G34W mutation. The xenografted organoids of the malignant giant-cell tumor had phenotypes genetically similar to those of the original tumor. The established organoids were confirmed to be derived from human malignant giant-cell tumors. In summary, the present study demonstrated a novel organoid model of a malignant giant-cell tumor that was genetically confirmed to be a malignant transformed tumor. Our organoid model could be used to elucidate the molecular pathogenesis of a malignant giant-cell tumor and develop novel treatment modalities.

  Study JGAS000618

• We performed whole-exome sequencing of 20 samples (10 actinic keratosis and 10 cutaneous squamous cell carcinoma) to investigate a potential relationship between DNA methylation-based subtypes and genetic mutation patterns (Rodriguez-Paredes et al., Nat Commun 2017)

  Cutaneous squamous cell carcinoma (cSCC) is the second most common skin cancer type and arises from keratinocytes. Most cSCC progress from a UV-induced precancerous lesion termed actinic keratosis (AK). Despite various efforts to characterize these lesions molecularly, the etiology of AK and its progression to cSCC remain only partially understood. Here we have used Infinium MethylationEPIC BeadChips to interrogate the DNA methylation status of about 850.000 CpGs in epidermal preparations from healthy skin, AK and cSCC. Importantly, we found that the premalignant AK samples displayed classical features of cancer methylomes and were highly similar to cSCC methylomes. Further analysis identified typical features of stem cell methylomes, such as a reduced DNA methylation age, non-CpG methylation and stem cell-related keratin and enhancer methylation patterns. Interestingly, this signature was detected only in one half of the AK and cSCC samples, while the other half showed keratin and enhancer methylation patterns that were more closely related to the control epidermis. These findings suggest the existence of two distinct subclasses of AK and cSCC that originate from distinct keratinocyte differentiation stages.

  Study EGAS00001002670

• TRACERx Renal 100

  Evolutionary dynamics of clear cell renal cell carcinoma (ccRCC) have not been studied prospectively or across all disease stages. Through the multi-centre prospective cohort study, Renal TRACERx Renal, we analysed 1209 primary tumour regions from 101 patients with ccRCC. We detect up to 30 driver events in a single tumour, and show that subclonal diversification is associated with known clinical parameters. Defining driver event co-occurrence, mutual exclusivity and timing at clone level, we reveal deterministic patterns of clonal evolution and disease progression. We find that ccRCC can be grouped into seven distinct evolutionary subtypes, ranging from tumours characterised by early fixation of multiple mutational and copy number driver events that can disseminate widely and rapidly; to highly branched tumours with >10 subclonal drivers and extensive parallel evolution presenting with oligometastatic disease. We identify either heterogeneity or chromosome instability, or both, as determinants of patient outcome. Our insights reconcile the variable clinical behaviour of ccRCC and the benefit of surgical intervention in early and late-stage disease; and offer potential biomarker opportunities to maximise the benefit of both surgery and active surveillance.

  Study EGAS00001002793

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__Gastric_Organoids

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001003151

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__Pancreatic_Organoids

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001003520

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__organoid_control_WGS

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001005449

• Functional single-cell characterization of immune aplastic anemia shows convergence of NK and NK-like CD8+ T cells with disease-associated TCR signature

  Immune aplastic anemia (AA) is a life-threatening bone marrow (BM) failure disorder driven by an autoimmune T cell attack against the hematopoietic stem and progenitor cells (HSPCs). However, the autoantigen targets and the role of other immune cells are unknown. Here, by analyzing an international cohort of 156 AA patients with scRNA+TCRαβ-seq, TCRβ-seq, flow cytometry, and plasma cytokine profiling with comparisons to healthy controls and patients with other hematological disorders, we identify NK cells and CD8+ TEMRA cells expressing NK receptors with AA-associated TCRβ-seq motifs as the most dysregulated immune cell populations in AA BM. Functional co-culture experiments with scRNA-TCRαβ-seq readout utilizing primary HSPCs and immune cells provide evidence that NK cellscannot kill HSPCs alone, but sensitize them to CD8+ T cell-mediated killing. Furthermore, HSPCs induce strong activation of T cell clones with CD8+ TEMRA NK-like phenotype and AA-associated TCR motifs. Our results reveal the convergent evolution of innate and adaptive immune cells in AA, where NK cells support CD8+ T cell-mediated autoimmunity.

  Study EGAS00001007602

• Functional single-cell characterization of immune aplastic anemia shows convergence of NK and NK-like CD8+ T cells with disease-associated TCR signature

  Immune aplastic anemia (AA) is a life-threatening bone marrow (BM) failure disorder driven by an autoimmune T cell attack against the hematopoietic stem and progenitor cells (HSPCs). However, the autoantigen targets and the role of other immune cells are unknown. Here, by analyzing an international cohort of 156 AA patients with scRNA+TCRαβ-seq, TCRβ-seq, flow cytometry, and plasma cytokine profiling with comparisons to healthy controls and patients with other hematological disorders, we identify NK cells and CD8+ TEMRA cells expressing NK receptors with AA-associated TCRβ-seq motifs as the most dysregulated immune cell populations in AA BM. Functional co-culture experiments with scRNA-TCRαβ-seq readout utilizing primary HSPCs and immune cells provide evidence that NK cellscannot kill HSPCs alone, but sensitize them to CD8+ T cell-mediated killing. Furthermore, HSPCs induce strong activation of T cell clones with CD8+ TEMRA NK-like phenotype and AA-associated TCR motifs. Our results reveal the convergent evolution of innate and adaptive immune cells in AA, where NK cells support CD8+ T cell-mediated autoimmunity.

  Study EGAS00001007604

• MutWP4__CRUK_Grand_Challenge_Mutographs_of_Cancer__Mutagen_treated_organoids

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, Kings College London will characterise the mutational signatures induced by putative human carcinogens in order to identify the origins of mutational signatures found in human cancers. To achieve this human organoid cell cultures will be exposed to a representative catalogue of known or suspected human carcinogens and mutagens and, using whole genome sequencing, the patterns of mutations induced by them will be determined. Somatic mutational signatures will be subsequently extracted by non-negative matrix factorisation methods and correlated with exposure data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001004873

• The impact of BNT162b2 mRNA vaccine against SARS-CoV-2 on adaptive and innate immune responses

  The mRNA-based BNT162b2 protects against severe disease and mortality caused by SARS-CoV-2 through induction of specific antibody and T-cell responses. Much less is known about its broad effects on immune responses against other pathogens. In the present study, we investigated the specific adaptive immune responses induced by BNT162b2 vaccination against various SARS-CoV-2 variants, as well as its effects on the responsiveness of human immune cells upon stimulation with heterologous viral, bacterial, and fungal pathogens. BNT162b2 vaccination induced effective humoral and cellular immunity against SARS-CoV-2 that started to wane after six months. We also observed long-term transcriptional changes in immune cells after vaccination, as assessed by RNA sequencing. Additionally, vaccination with BNT162b2 modulated innate immune responses as measured by the production of inflammatory cytokines when stimulated with various microbial stimuli other than SARS-CoV-2, including higher IL-1/IL-6 release and decreased production of IFN-α. Altogether, these data expand our knowledge regarding the overall immunological effects of this new class of vaccines and underline the need of additional studies to elucidate their effects on both innate and adaptive immune responses.

  Study EGAS00001006818

• Massively parallel functional dissection of schizophrenia associated non-coding genetic variants

  Schizophrenia (SCZ) is a severe mental disorder affecting 1% of the world population. SCZ is characterized by an underlying genetic architecture that is highly polygenic. Genome wide association studies have identified thousands of genetic variants that are statistically linked to the disease. However, the translation of these associations into insights on the pathomechanisms has been challenging because the causal genetic variants, their molecular function, and their target genes remain largely unknown. To address these questions, we combined induced pluripotent stem cell technology with a massively parallel variant annotation pipeline (MVAP) to functionally characterize 35,000 SCZ associated non-coding genetic variants. This approach identified a set of 620 (1.7%) single nucleotide polymorphisms as functional on the molecular level in a highly cell type and condition specific fashion. Subsequent multi-modal integration of epigenomic data combined with CRISPR screening in human neurons enabled us to systematically translate SCZ variant associations into target genes, biological processes, and ultimately alterations of neuronal physiology. These results provide a new high-resolution map of functional variant-gene combinations and offer comprehensive biological insights into the developmental context and stimulus dependent molecular processes modulated by SCZ genetic variation beyond statistical association.

  Study EGAS00001007542

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• GBM Up and Down Responder EZH2 ChIPseq

  ChIPseq using anti-EZH2 with a sheared input DNA control to assess EZH2 genomic biding in one longitudinal pair of samples (pre- and post-treatment) from one UP and one DOWN responder GBM patient

  Dataset EGAD50000000134

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• The sanger result of LAM disease

  Tumor biopsies from LAM disease were analyzed by sanger to characterize the alterations in patients ,to elucidate the landscape of genetic/genomic alterations. The dataset include 21 samples.

  Dataset EGAD00010001761

• Genomic Alterations in Gingivo-buccal Cancer: ICGC-India Project_YR02

  Dataset EGAD00001001060

• Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina

  Study the sub-continental origins of African, European and Native American genetic ancestries of Argentinean populations.

  Study EGAS00001004492

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Dataset contains Exome-seq and RNA-seq from 2 GBM patients, as well as RNA-seq from the derived cultured cells (GNS).

  Dataset EGAD00001001359

• Deep Sequencing of somatic cancer mutations

  We enriched a panel of cancer associated genes using the Custom Sure Select Target Enrichment Kit. Identified mutations were validated with deep sequencing in order to assess mutated allele frequencies more accurately.

  Dataset EGAD00001001313

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• Biological and Therapeutic Implications of a Unique Subtype of NPM1 Mutated AML (RNAseq Data)

  This dataset contains 91 RNAseq paired reads, in fastq format. Samples were collected from fresh bone marrow and peripheral blood sample from AML patients.

  Dataset EGAD00001006669

• Transcriptome profiling of desmoplastic small round cell tumors (DSRCTs)

  RNA sequencing of frozen resected specimens of desmoplastic small round cell tumors (DSRCTs). Four patients have specimens from multiple tissue sites included in this dataset.

  Dataset EGAD00001006388

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026