22941 results for "ega"

in 57.19 milliseconds.

• Single-cell sequencing of PBMC & CSF in neuroinflammatory disorders

  Single-cell sequencing and genotyping for Cambridge samples analyzed as part of a project evaluating single-cell gene expression & lymphocyte receptor sequences in CSF and PBMC of MS and other neuroinflammatory disorders.

  Dataset EGAD50000001023

• scRNA-seq from lung cancer organoids and immune cells

  15 scRNA-seq samples were multiplexed, and 5' 10X Chromium scRNA-seq was performed. This dataset provides the FASTQ files for the multiplexed data, as well as the BAM files for the demultiplexed samples.

  Dataset EGAD50000000845

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• Patient-derived xenograft models of head and neck cancers

  Establishment and characterization of two patient-derived xenograft models from HNSCC patients , initiatlly treatment-naive, and for which cetuximab-acquired resistant model couterparts have been generated. All models have been characterized at genomic level. HNSCC tissues were obtained from surgical resections at Cliniques universitaires St Luc in Brussels (Belgium).

  Dac EGAC50000000502

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• fibroblast transcriptome of pediatric patients with epilepsy

  RNA sequencing of fibroblasts from pediatric patients with childhood epilepsy. Fibroblast RNA was extracted at passage 3-6 using MN nucleospin, >90M 150bp paired-end reads per sample were obtained with illumina sequencing. Reads were aligned to hg38.

  Dataset EGAD50000001166

• Dataset for early breast cancer samples

  This dataset contains WGS data for 27 tumor, control and patient derived culture samples of patients with breast cancer. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X using TruSeq Nano DNA Kit. The sequencing was always paired

  Dataset EGAD50000000860

• Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Study EGAS50000000773

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• ATAC-seq in KMS11 vs TKO cells

  ATAC-seq to determine chromatin accessibility in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of the translocated NSD2 allele.

  Study EGAS50000000076

• MicroC in KMS11 and TKO cells

  MicroC to show high resolution chromatin interactions in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of translocated NSD2 allele (KMS11 TKO).

  Study EGAS50000000078

• WES dataset of salivary gland tumor samples and control blood samples

  This dataset contains paired-end WES data of salivary gland tumor samples and control blood samples from 53 patients. Sequencing was performed on Illumina HiSeq 2500, HiSeq 4000 or NovaSeq 6000.

  Dataset EGAD50000001190

• Cohort B germline exome sequencing

  Cohort B includes IDH-wild type, EGFR amplified, surgically derived glioblastoma tissue samples from male and female individuals. Germline DNA was isolated from whole blood.

  Study EGAS50000000951

• RNA-Seq dataset for malignant pleural and peritoneal mesothelioma

  This dataset contains RNA sequencing data of pleural and peritoneal mesothelioma. The number of samples is 18. Sequencing was performed on Illumina NovaSeq 6000 and Illumina NovaSeqXPlus. The sequencing was always paired.

  Dataset EGAD50000001342

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Mitochondrial DNA sequencing of single muscle fibers in Parkinson's disease patients

  Mitochondrial DNA sequencing of n=157 single muscle fibers in Parkinson's disease patients and controls, n=27 bulk tissue samples and n=2 synthetic controls

  Dataset EGAD50000000946

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• WGS data of Japanese including COVID-19 patients and healthy subjects

  This dataset contains WGS data of 234 Japanese, including 88 COVID-19 patients and 146 healthy subjects. Libraries were sequenced on the HiSeqX or NovaSeq 6000 system. Sequenced reads were aligned against the Genome Reference Consortium human genome build 38 using BWA-MEM.

  Dataset EGAD00010002742

• Bulk RNA sequencing of hematological toxicity following CAR-T cells injection

  Bone marrow aspirations obtained from patients treated with CAR-T cells were analyzed using bulk RNA sequencing (CD3+, CAR T+, CD34+ sorted populations).

  Study EGAS50000000777

• Tumor Profiler Project - OV cell-free DNA data

  The dataset contains amplicon sequencing data from 48 samples from 35 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format.

  Dataset EGAD50000001410

• PRPH2-Related Retinal Dystrophies

  NGS dataset including patients affected by genomic variants at gene PRPH2. It includes NGS test using custom IRD gene panels, clinical exome sequencing (CES) and whole-exome sequencing (WES).

  Dataset EGAD50000001239

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• Nanopore whole-genome sequencing of human bone and soft-tissue sarcomas

  We performed single and multi-region nanopore whole-genome sequencing on human bone and soft-tissue sarcoma samples. We also performed nanopore whole-genome sequencing on matched whole blood samples.

  Dataset EGAD50000001392

• SPECIAL (scATACseq): Dissecting the melanoma ecosystem one cell at the time during immunotherapy

  Characterising epigenome profiles of stage III/IV melanoma samples treated with ICB before and on treatment by single cell ATAC sequencing.

  Study EGAS50000001014

• Long-read whole genome sequencing as a tool for variant detection in inherited retinal dystrophies

  WGS sequencing using nanopore long reads sequencing. These data is used for the diagnosis of patients with inherited retinal dystrophies.

  Study EGAS50000000846

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• RNA sequencing of OM-ALI cultures derived from control and AD individuals exposed to SARS-CoV-2

  RNA sequencing of air-liquid interface (ALI) cultures of olfactory mucosa (OM) cells derived from control (n=3) and AD (n=3) individuals exposed to SARS-CoV-2.

  Dataset EGAD50000000598

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• DNA sequencing of sgRNAs in CRISPR-Cas9 screening and RNA sequencing of SF3B4-overexpressing liver organoids

  DNA sequencing of sgRNAs in CRISPR-Cas9 screening and RNA sequencing of SF3B4-overexpressing liver organoids

  Dataset EGAD50000001240

• Bulk RNA-seq data of isogenic wild-type RPE1

  Deposited here are time series (6, 24 and 48hrs) bulk RNA-seq data generated from isogenic wild-type (WT) RPE1 untreated or treated with Brequinar (and other dNTP-pool disruptor compounds)

  Dataset EGAD50000001544

• Dataset with WGBS data of CRC and colon tissue

  This dataset contains WGBS data from 20 samples, which are either from colorectal cancer or control colon tissue. Sequencing was performed on either Illumina HiSeq 2000 or HiSeq X and the sequences are paired.

  Dataset EGAD50000000772

• Targeted capture sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Targeted capture sequencing for 366 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study and 29 samples from a previously uploaded dataset.

  Dataset EGAD50000001364

• SCANDARE ovarian

  Prospective biobanking study in ovarian cancer patients aiming at better understand the link between the molecular alterations of the tumor itself, its microenvironment and immune response.

  Study EGAS50000001161

• Extracellular Vesicle miRNA Sequencing with Qiaseq and NextSeq 550

  This dataset includes small RNA sequencing data from extracellular vesicle-derived RNA. miRNA libraries were prepared using the Qiaseq miRNA Library Kit with adaptations for low RNA input and sequenced on the Illumina NextSeq 550 platform

  Dataset EGAD50000001504

• Spontaneously differentiatiated iPSCs to EBs

  SUM-seq data (single-cell chromatin accessibility and gene expression) for spontaneously differentiatiated iPSCs. This data is the representative data in the Nature Protocols publication.

  Study EGAS50000001094

• WES - Characterization of a Breast Patient-derived Tumor Organoid biobank from an underserved population of patients.

  EXaCT-2, an augmented WES assay, has been performed on a cohort of 4 patients and their corresponding organoids

  Study EGAS50000000684

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Data access committee for "Detection of brain cancer using genome-wide cell-free DNA fragmentomes"

  The data access committee for “ Detection of brain cancer using genome-wide cell-free DNA fragmentomes”. The DAC is comprised of Drs. Dimitrios Mathios, Jillian Phallen, Victor Velculescu, Robert Scharpf, Noushin Niknafs, and Shashikant Koul, and can be contacted at skoul3@jh.edu.

  Dac EGAC50000000605

• Human exome sequencing data (n=2) from the publication "Germline variants in UHRF1 are associated with multi-locus imprinting disturbance in humans and mice"

  II2_hg38.bwa.QC.vcf III1_III2_hg38.bwa.QC.vcf The VCF files of the mother (II:2) and both affected siblings (III:1+III:2, merged).

  Dataset EGAD50000001684

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• Fluctuating DNA methylation tracks cancer evolution at clinical scale

  Long-read Nanopore data of fCpGs from Gabbutt & Duran-Ferrer (2025) for developing the EVOFLUx method to study cancer evolution via DNA methylation fluctuations.

  Study EGAS50000001192

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Dac for "ARHGAP11A Maintains Cortical Progenitor Identity Through RHOA–ROCK Signalling During Human Brain Development" with Julia.ladewig@zi-mannheim.de, Department of Translational Brain Research. Moritz Mall, m.mall@dkfz-heidelberg.de, German Cancer Research Center (DKFZ). Yannick Hass, yannick.hass@zi-mannheim.de, Department of Translational Brain Research. Anne Hoffrichter, anne.hoffrichter@zi-mannheim.de, Department of Translational Brain Research, Central Institute of Mental Health

  Dac EGAC00001003603

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• cfDNA sWGS BAM — Metastatic colorectal cancer

  Plasma cirDNA sWGS for metastatic colorectal adenocarcinoma at diagnosis prior to systemic therapy. Libraries DSP/SSP (per sample). Sequencing by IntegraGen (2022–2024). Alignment: GRCh38 with BWA-MEM; BAMs sorted/indexed; delivered as primary mapped reads only (filters/MAPQ in analysis metadata). Controlled access

  Dataset EGAD50000001879

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Ultra-long whole-genome and Cas9-targeted nanopore sequencing of fibroblasts: FSHD, BAMS, healthy controls

  Data from the D4Z4End2End study (Xiao et al. 2025), for genetic and epigenetic analysis of the D4Z4 macrosatellite in health and disease.

  Dataset EGAD50000001551

• SCANDARE TNBC

  Prospective biobanking study in breast patients aiming at better understand the link between the molecular alterations of the tumor itself, its microenvironment and immune response.

  Study EGAS50000000970

• RIP-seq of SF3B4 binding RNA fragments

  There are 2 paired samples. The project aims to characterize SF3B4 binding RNA fragments within liver organoids to understand its role in splicing regulation

  Study EGAS50000001129

• Pediatric B-cell precursor acute lymphoblastic leukemia RNA sequencing

  This dataset included 33 childhood B-cell precursor acute lymphoblastic leukemia RNA sequencing samples. All samples were subjected to Illumina pair-end sequencing.

  Study EGAS50000000763

• WES_dataset2

  Twenty-six EATLs and 22 additional cases of MEITLs (among which 5 had only tumoral tissue available) were sequenced using the xgen research panels v1.0 and v2.0 from IDT DNA (Newark, New Jersey, USA).

  Dataset EGAD50000001621

• WES Analysis of CRC and UC samples from a cohort of Lynch Syndrome carriers

  Whole-exome sequencing (WES) was performed on 73 tumors, including 58 colorectal cancers (CRC) and 15 urothelial cancers (UC), derived from 58 individuals with Lynch syndrome (LS). The cohort comprised both primary and metachronous tumors.

  Dataset EGAD50000001915

• miRNA

  The purpose is to perform miRNA analysis on FACS sorted target immune cell populations to uncover novel potential miRNA diagnostic markers biomarkers predictive of therapy response but also possibly identify perturbed signaling pathways or miRNA targets of intervention with the use of agomirs/antagomirs.

  Dataset EGAD50000002025

• Bulk WES Fastq Files for 103 Samples of Cornell-NCI DLBCL Genomic Project

  Paired-read fastq files were derived from standard Illumina WES NGS sequencing for 103 DLBCL biopsy samples. This is one of three datasets associated with the multi-platform NGS sequencing efforts of the Cornell-NCI DLBCL genomic study.

  Dataset EGAD50000001747

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• RNA isoform diversity, splicing variants, and switching in single cells of the Alzheimer’s disease brain

  Paired 10X 3' single-nucleus RNA sequencing with PacBio Kinnex long-read sequencing in 7 control and 8 Alzheimer's disease human frontal cortex samples.

  Dataset EGAD50000002124

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• DDD-Africa Exome Sequencing

  1230 participants from both South Africa and The Democratic Republic of Congo underwent whole exome sequencing on an Illumina NovaSeq 6000 at Wellcome Trust Sanger Institute.

  Dataset EGAD00001015728

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Dataset for desmoplastic small round cell tumor - WGS

  This dataset contains 25 WGS sequencing samples of patients with desmoplastic small round cell tumor. Sequencing was performed on Illumina HiSeq X and NovaSeq 6000 using Illumina TruSeq Nano DNA Kit. The sequencing was always paired.

  Dataset EGAD50000000911

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• Bulk RNASeq of metastatic colorectal cancer organoids with ATOH1 knockout

  Bulk RNA sequencing was performed on mCRC organoids subjected to cetuximab treatment, comparing ATOH1 knockout and control conditions. The dataset is intended to elucidate the contribution of ATOH1-regulated secretory cell population to cetuximab persistence mechanisms.

  Dataset EGAD50000002060

• Enzymatic Methyl-Seq Rectal Mucus

  Enzymatic methyl sequencing of rectal mucus samples from patients suspected to have colorectal cancer. This is 1 of 4 sequencing experiments on the same sample type.

  Study EGAS50000001314

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• WGS for 21 samples

  This dataset contains whole-genome sequencing (WGS) data from 14 acute leukemia cases of the newly identified FOXF1/FENDRR ALL subtype, including diagnosis or relapse samples, as well as 7 matched germline samples. All the 21 samples are in bam file type.

  Dataset EGAD50000001790

• Sorted WGS for three samples

  This dataset contains Whole Genome Sequencing (WGS) data from two cell populations (myeloid and lymphoid) and the germline population sorted from a primary sample of the novel FOXF1/FENDRR ALL subtype. All the three samples are in bam file type.

  Dataset EGAD50000001792

• Genentech Small Cell Lung Cancer (SCLC) Screen

  Exome capture, RNA-Seq, whole genome sequencing of set of Small Cell Lung Cancer samples.

  Study EGAS00001000334

• NGS_based_viability_screening_using_haploid_cell_line

  Identification of human deubiquitylating enzymes whose knock out result in hypersensitivity to DNA damaging agents, by comparing the sequence reads of ‘barcode region’ from mixed cell culture.

  Study EGAS00001001095

• TraIT Cell Line use case

  Experimental data collected from a set of cell lines. To be used as a test for pipelines and infrastructure.

  Study EGAS00001001476

• Matched_Pair_Cancer_Cell_line_Whole_Genomes

  We propose to definitively characterise the somatic genetics of 29 matched pair cell lines through generation of comprehensive catalogues of somatic mutations by high coverage genome sequencing.

  Study EGAS00001000160

• Second generation noninvasive fetal genome analysis reveals de novo mutations, single-base parental inheritance, and preferred DNA ends

  Second generation noninvasive fetal genome analysis reveals de novo mutations, single-base parental inheritance, and preferred DNA ends

  Study EGAS00001001882

• MPN_TGS2_Follow_up___PT1_Vori_other

  Targetted capture and resequencing of 94 known myeloid genes across MPN trials (PT1 and Voriconazole study) as well as remaining MPN samples. New bait design Jan 2014.

  Study EGAS00001000765

• ICGC PedBrain DNA methylation sequencing

  DNA methylation profiling of 107 medulloblastoma and 8 control samples by high-coverage whole-genome bisulfite (WBGS) sequencing and Illumina Infinium HumanMethylation450k array.

  Study EGAS00001000561

• ESGI___Whole_Genome_Sequencing_of_samples_from_the_INGI_Val_Borbera_genetic_isolate__X10_

  Whole genome sequencing of sampels from an isolated population from the Val Borbera valley in Italy. The samples are sequenced using the Illumina HiSeq X Ten system.

  Study EGAS00001001123

• AML clonal phylogeny

  Study of AMl clonal phylogeny. Fastq files from targeted resequencing and from exome sequencing from AML patients at diagnosis, complete remission or relapse time.

  Study EGAS00001001779

• Pancreatic Cancer Sequencing Initiative OICR

  Pancreatic Cancer Sequencing Initiative for the International Cancer Genome Consortium at the Ontario Institute for Cancer Research.

  Study EGAS00001000395

• Congenital_Heart_Disease___Pilot

  This pilot study aims to generate pilot data to inform future study designs by resequencing the whole exomes of 10 unrelated individuals diagnosed with Congenital Heart Disease (CHD).

  Study EGAS00001000425

• Combination Therapies for Personalised Cancer Medicine in 11-18 (2019-06-10)

  This study involves mutagenizing 11-18 with ENU to identify those mutations which engender resistance to targeted treatment. . This dataset contains all the data available for this study on 2019-06-10.

  Dataset EGAD00001005081

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• 2017_ AML WGS analysis result

  This data is belong to 2017 AML genome data which is aligned to human reference(human_g1k_v37.fasta). There are 10 paired tumor/normal samples from SNUH. All samples has passed QC and recalibration steps while aligning to reference.

  Dataset EGAD00001003599

• whole-genome sequencing of gastric cancer

  whole-genome sequencing of 168GCs identifies hot-spot tandem duplications

  Dataset EGAD00001004811

• Multi-region sequencing of colon tumour biopsies and matched normals

  Dataset of adenoma and colon cancer multi-region sequencing. Publication: Nat Ecol Evol. 2018 Oct;2(10):1661-1672. doi: 10.1038/s41559-018-0642-z. Epub 2018 Aug 31.

  Dataset EGAD00001004966

• Kidney tumour_DNA (2018-09-19)

  This is a bulk DNA and RNA sequencing study of human renal tumours . This dataset contains all the data available for this study on 2018-09-19.

  Dataset EGAD00001004346

• ESGI - Whole Genome Sequencing of samples from the Croatian isolated populations (2017-11-22)

  Whole genome sequencing of sampels from isolated populations from Croatia. The samples are sequenced using the Illumina HiSeq X Ten system. This dataset contains all the data available for this study on 2017-11-22.

  Dataset EGAD00001003812

• SF12017 snATAC Seq IDH1 Mutant GBM 55, Male

  IDH1 mutant GBM 55, Male. Single Nuclei ATAC seq data from high grade human glioma samples. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005405

• Low pass whole genome sequencing of CACRC

  Genome-wide copy number profiling was performed using low-pass whole genome sequencing on archival non-dysplastic mucosa (n=9), low-grade dysplasia (LGD; n=30), high-grade dysplasia (HGD; n=13), mixed LGD/HGD (n=7) and CA-CRC (n=19).

  Dataset EGAD00001004270

• SF11612 snATAC Seq Recurrent oligodendroglioma

  SF11612 Recurrent oligodendroglioma. Gender Male Age 67. Single Nuclei ATAC seq data from low grade human glioma samples. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005413

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• DKFZ-St.Jude Medulloblastoma - 218 CEF control exomes

  218 control exomes, CEF cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006659

• Sporadic and endemic Burkitt lymphoma have frequent FOXO1 mutations but distinct hotspots in the AKT recognition motif

  Sample set of 74 whole-exome sequencing samples from sporadic Burkitt lymphoma patients from the UK. 33 of these samples have matched constitutional data, giving a total number of 107 samples

  Dataset EGAD00001005105