23144 results for "ega"

in 33.84 milliseconds.

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Here, we submit epigenetic data from EPIC array.

  Study EGAS00001008053

• Dataset for "Characterizing the cfDNA fragmentome in patients with hepatocellular carcinoma"

  The dataset includes 63 BAM files from Oxford Nanopore PromethION whole-genome sequencing, generated by base calling POD5 files with Dorado (super-accurate, modified base model v5.0.0_5mCG_5hmCG@v3) and aligning reads to the hg19 reference genome.

  Dataset EGAD00001015823

• Genomic and transcriptomic profiling of soft tissue sarcoma

  We characterized soft tissue sarcoma by targeted gene panel sequencing (MSK-IMPACT) and transcriptome profiling to discover biological mechanisms under metastatic progression.

  Dataset EGAD50000000846

• Data Quality Control

  Data Quality Control High-throughput sequencing techniques have become the leading method to study, decode and discover the genomic origins of biological phenomenons. EGA provides a secure archival of such identifiable genomics data with the purpose of data-upcycling, i.e. to re-use these data for research. High-quality data standards are essential to ensure the quality and credibility of the research. Moreover, a quality check report can assure a researcher beforehand about the data that they will request access, therefore saving time and effort. The EGA has developed a File Quality Control Report (QC Report) to provide generic quality control reports for Fastq, SAM/BAM/CRAM, and VCF files deposited at EGA. This QC Report will allow users to get information regarding the files submitted within a specific dataset. The data requesters will obtain information such as the quality of reads, mapped reads, number of variants, and other features before starting the requesting process, which will save the efforts and time.Accessing file quality control reportsIn each dataset page, the user can explore the files that it contains by clicking the "files" tab. The Quality Control report of a file has two sections. The first one, contains general information about the file, such as the inferred assembly, total reads, the dataset or study where it comes from, etc. The second section contains plots that summarise interesting information about the file, for example, the base coverage distribution, base quality or mapped reads. The description of each plot is accessible by clicking the "i" button at the top-right corner of each plot box. Technical Description For analysing the fastq, SAM/BAM/CRAM and VCF files, the EGA applies a set of tools widely used in the bioinformatics community. FASTQ: FastQC, recognised as the gold standard tool by the community.Per base sequence quality, per sequence quality scores, per base sequence content, per sequence GC content, sequence duplication levels, etc.SAM/BAM/CRAM: samtools, also the gold standard, generates results plots useful to get an overall idea of the quality of the file.base coverage distribution, base quality, % of mapped reads, % of both mates mapped, singletons, duplicates, etc.VCF: vcftools and bcftools, combined with a custom script to infer the genome assembly.site frequency distribution, Ts/Tv, base changes, indel distribution, etc.

  Documentation access/request-data/quality-control-reports

• Tumour evolvability metrics predict recurrence in advanced localised prostate cancer (normal data)

  There is a need for quantitative measurements of evolutionary metrics in controlled clinical trials with long term follow-up information. This is particularly true in advanced localised prostate cancer, which can recur more than a decade after diagnosis. Here we mapped genomic intra-tumour heterogeneity in 642 tumour samples from 114 patients who took part in the IMRT and DELINEATE clinical trials, for which full clinical information and 12y median follow-up was available. We concomitantly assessed phenotypic (morphological) heterogeneity using Deep Learning in 1,923 histological sections from 250 IMRT patients (fully overlapping with the genetic set). This study shows that combining genomics with AI-aided histopathology in clinical trials leads to novel clinical biomarkers. This EGA repository contains data produced from tumour samples using low coverage whole genome sequencing and a prostate cancer specific gene panel data following compression of unique molecular identifiers.

  Dataset EGAD00001010295

• Tumour evolvability metrics predict recurrence in advanced localised prostate cancer (tumour data)

  There is a need for quantitative measurements of evolutionary metrics in controlled clinical trials with long term follow-up information. This is particularly true in advanced localised prostate cancer, which can recur more than a decade after diagnosis. Here we mapped genomic intra-tumour heterogeneity in 642 tumour samples from 114 patients who took part in the IMRT and DELINEATE clinical trials, for which full clinical information and 12y median follow-up was available. We concomitantly assessed phenotypic (morphological) heterogeneity using Deep Learning in 1,923 histological sections from 250 IMRT patients (fully overlapping with the genetic set). This study shows that combining genomics with AI-aided histopathology in clinical trials leads to novel clinical biomarkers. This EGA repository contains data produced from tumour samples using low coverage whole genome sequencing and a prostate cancer specific gene panel data following compression of unique molecular identifiers.

  Dataset EGAD00001010274

• Autozygosity pilot - British-Pakistani from Birmingham 2

  The offspring of first cousin marriages have ~6% of their genome autozygous, i.e. homozygous identical by descent, or even more if there was further consanguinity in their ancestry. In the UK there are large populations with very high first cousin marriage rates of 20-50%. Sequencing the exomes of a sample of these individuals has the potential both to support genetic health programmes in these populations, and to provide genetic research information about rare loss of function mutations. This pilot study based on existing British-Pakistani cohort samples from Birmingham will identify homozygous individuals for almost all variants down to an allele frequency around 1%, plus individuals carrying hundreds of new homozygous rare loss-of-function variants, and will support development of community relations and ethics for a wider study currently being designed. The data deposited in the EGA consists of low coverage whole exome sequencing on these samples.

  Dataset EGAD00001001026

• Autozygosity pilot - British-Pakistani from Birmingham

  The offspring of first cousin marriages have ~6% of their genome autozygous, i.e. homozygous identical by descent, or even more if there was further consanguinity in their ancestry. In the UK there are large populations with very high first cousin marriage rates of 50-80%. Sequencing the exomes of a sample of these individuals has the potential both to support genetic health programmes in these populations, and to provide genetic research information about rare loss of function mutations. This pilot study based on existing British-Pakistani cohort samples from Birmingham will identify homozygous individuals for almost all variants down to an allele frequency around 1%, plus individuals carrying hundreds of new homozygous rare loss-of-function variants, and will support development of community relations and ethics for a wider study currently being designed. The data deposited in the EGA consist of low coverage whole exome sequencing on these samples.

  Dataset EGAD00001001025

• Autozygosity_pilot___British_Pakistani_from_Birmingham_2

  The offspring of first cousin marriages have ~6% of their genome autozygous, i.e. homozygous identical by descent, or even more if there was further consanguinity in their ancestry. In the UK there are large populations with very high first cousin marriage rates of 20-50%. Sequencing the exomes of a sample of these individuals has the potential both to support genetic health programmes in these populations, and to provide genetic research information about rare loss of function mutations. This pilot study based on existing British-Pakistani cohort samples from Birmingham will identify homozygous individuals for almost all variants down to an allele frequency around 1%, plus individuals carrying hundreds of new homozygous rare loss-of-function variants, and will support development of community relations and ethics for a wider study currently being designed. The data deposited in the EGA consists of low coverage whole exome sequencing on these samples.

  Study EGAS00001000567

• Autozygosity_pilot___Pakistani_from_Birmingham

  The offspring of first cousin marriages have ~6% of their genome autozygous, i.e. homozygous identical by descent, or even more if there was further consanguinity in their ancestry. In the UK there are large populations with very high first cousin marriage rates of 50-80%. Sequencing the exomes of a sample of these individuals has the potential both to support genetic health programmes in these populations, and to provide genetic research information about rare loss of function mutations. This pilot study based on existing British-Pakistani cohort samples from Birmingham will identify homozygous individuals for almost all variants down to an allele frequency around 1%, plus individuals carrying hundreds of new homozygous rare loss-of-function variants, and will support development of community relations and ethics for a wider study currently being designed. The data deposited in the EGA consist of low coverage whole exome sequencing on these samples.

  Study EGAS00001000511

• Autozygosity_pilot___QMUL

  The offspring of first cousin marriages have ~6% of their genome autozygous, i.e. homozygous identical by descent, or even more if there was further consanguinity in their ancestry. In the UK there are large populations with very high first cousin marriage rates of 20-50%. Sequencing the exomes of a sample of these individuals has the potential both to support genetic health programmes in these populations, and to provide genetic research information about rare loss of function mutations. This pilot study based on existing British-Pakistani cohort samples will identify homozygous individuals for almost all variants down to an allele frequency around 1%, plus individuals carrying hundreds of new homozygous rare loss-of-function variants, and will support development of community relations and ethics for a wider study currently being designed. The data deposited in the EGA consists of low coverage whole exome sequencing on these samples.

  Study EGAS00001000717

• SudanMitoSeq: Sudanese mitochondrial sequencing

  In various contexts, mitochondrial function or dysfunction can be linked to mitochondrial genome variations. The use of mitochondrial genetics thus promises personalized diagnostics and treatments. In order to devise specific precision medicine approaches based on mitochondrial genetic variation and to test them within clinical studies, control data is indispensable. Such control data needs to comprehensively cover genetic variation commonly observed and thus expected. In the context of this study we assessed whether current, world-wide mitochondrial data sufficiently represents the region of North and East Africa, that is, whether current reference data is ready for precision medicine in this region. Towards this, we sequenced mitochondrial genomes of 159 Sudanese individuals provided as part of this EGA study and analyzed them together with various other, publicly available data concerning mitochondrial variation. For details, please refer to the publication.

  Study EGAS00001005669

• Cancer Single Cell Sequencing

  This study is to ascertain whether it is feasible to extract a single cell form a Cancer cell line, amplify it and sequence it.

  Study EGAS00001000003

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• UCSF Brain Tumor Bioinformatics DAC

  Dac EGAC00001000515

• "Immunology of Diabetes HMGU"

  Dac EGAC00001002294

• EGAD00010000702

  SNP-chip genotyping data for one proband in the DDD study (Ref : Carvalho AJHG 2015)

  Dataset EGAD00010000702

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• Tetralogy of Fallot Exome Trios

  Exome sequencing of 30 parent-offspring trios to >50X mean depth, where the offspring has sporadic TOF, to identify potential causal de novo mutations. We will use the exome plus design for pulldown that incorporates ~6.8Mb of additional regulatory sequences in addition to the ~50Mb GENCODE exome.

  Dataset EGAD00001000344

• Exome sequencing for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome

  Exome sequencing was performed for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome. Tumor DNA was extracted from adrenocortical adenomas and normal DNA was extracted from adjacent adrenal tissues or periphral blood.

  Dataset EGAD00001000715

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• Pakistan_Damgaard2018

  Genotype data for 140 present-day individuals from five populations in Pakistan in The first horse herders and the impact of early Bronze Age steppe expansions into Asia DOI: 10.1126/science.aar7711. Sampling details are presented in supplementary section S2.1 Data generation

  Dataset EGAD00010001678

• Genomic profiling of patient-derived xenografts and organoids in prostate cancer

  Dataset contains genomic sequencing of 87 samples (blood germline, normal prostate tissues, human tumors, PDOs and PDXs). Sequencing was performed by whole-exome sequencing or targeted sequencing of prostate cancer genes.

  Dataset EGAD00001006403

• Genotype data for 4607 Greenlandic samples (MEGA array)

  This file fileset has 4607 Greenlanders scored on the Illumina MEGA array (1,622,813 sites), and has been put on the plus strand. The data is in PLINK bed/bim/fam format. The Greenlandic individuals originate from two population surveys, B99 and IHIT.

  Dataset EGAD00010002057

• Genotyping_data_total

  Genotyping data for ACE2 (rs2285666), MX1 (rs469390) and TMPRSS2 (rs2070788) variants. Patients are classified as mild (n=34) and severe (n=32). DNA genotyping was performed using the TaqMan® Genotyping Master Mix (Applied Biosystems). Allelic discrimination assays were performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems).

  Dataset EGAD00010002445

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• Whole-exome sequencing

  Buccal mucosal remodelling was evaluated through whole-exome sequencing on 40 samples of 0.2mm^2 in size from a subject. A paired control sample was also sequenced.

  Study EGAS50000000055

• Tumor sequencing dataset from 17 individuals with biallelic germline pathogenic variants in CHEK2

  WES data of 17 tumors from 9 individuals that have biallelic germline CHEK2 pathogenic variants. Shallow whole genome sequencing files from 16 tumors samples from 9 individuals with germline biallleic pathogenic variants in CHEK2.

  Dataset EGAD50000000112

• ImmuNEO CD8 cell lines

  Paired RNA-Seq data from 16 samples of different tumors CD8+ T cells added to the study "Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification (H021)". Sequencing was performed on Illumina NextSeq 500. The sequencing was always paired

  Dataset EGAD50000000193

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Homopolymer switches WES dataset

  This project used NGS (next generation sequencing) in mismatch repair deficient colorectal cancer samples. The project investigated the role of secondary MMR (mismatch repair) gene mutations in tumor evolution. This dataset includes BAM files from multi-region Whole Exome Sequencing of 49 samples from 22 patient tumors.

  Dataset EGAD50000000319

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• Shallow whole genome sequencing of FOCUS study

  Shallow whole genome sequencing of tumors from patients included in the FOCUS clinical trial. performed to calculate assocations of irinotecan with copy-number alterations.

  Study EGAS00001007609

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• AmsterdamUMC Data Access Committee for the study "Multi-omic analysis of thyroid dysfunction in Down Syndrome"

  The current data access committee reviews and assesses data requests of researchers that seek to gain access to data acquired as part of the "Multi-omic analysis of thyroid dysfunction in Down Syndrome" study as performed at the AmsterdamUMC, Amsterdam, Netherlands.

  Dac EGAC50000000186

• Transcriptome-wide gene expression analysis of cocaine use disorder in postmortem human brain tissue

  Dataset contains raw fastq-files from RNA-sequencing analysis of total RNA extracted from Brodmann Area 9 human postmortem brain tissue samples.

  Dataset EGAD50000000212

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• Whole-genome sequencing of high-retrotransposition rate tumours

  We performed whole-genome sequencing of 137 tumours and their matched-normal (adjacent tissue) samples to identify tumours with high rates of somatic retrotransposition

  Study EGAS50000000414

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• scRNA-seq and scTCR-seq from 7 MF patients

  Dataset containing scRNA and scTCR sequencing of 7 patients with cutaneous T cell lymphoma. Sequencing was performed on Illumina NextSeq 550, HiSeq 4000 and NovaSeq 6000. The sequencing was always paired.

  Dataset EGAD50000000332

• FMT metagenomics triads and plasma metabolomics

  These are the metagenomic datasets of 29 FMT traids with corresponding plasma metabolomics. Data for each triad consists of metagenomics for baseline, post FMT and corresponding donor. Clinical data concerning the glucose rate of disappearance and blood pressure are available as phenotypes.

  Dataset EGAD50000000599

• cytogenetically visibile inversions

  Pacbio Hifi whole genome sequencing data from six individuals carrying cytogenetically visible inversions. The HiFi data was produced on the PacBio Revio machine, using 1 flowcell per sample. The resulting data was aligned to hg19 using minimap2, and converted into bam using samtools.

  Dataset EGAD50000000635

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• Single-cell RNA and TCR-sequencing of treatment-refractive immune-mediated arthritis

  Single-cell RNA and TCR-sequencing of three patients with treatment-refractive immune-mediated arthritis. The dataset consists of synovial tissue CD4+ and CD8+ T cells and peripheral blood CD45+ leukocytes.

  Dataset EGAD50000000749

• Raw ONT R10 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 207 samples sequenced using rapid-multiplexed barcoded library preparation on Nanopore PromethION R10 flow cells on P2 Solo and P24 systems. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000791

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• Tumor Profiler Project - AML bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 23 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000822

• Tumor Profiler Project - AML scDNA data

  The dataset contains single-cell DNA seq data from 21 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000824

• BAM files from whole-genome sequencing of 3 agressive B-cell lymphoma tumour and non-tumor samples

  This dataset contains BAM files from whole-genome sequencing (WGS) of 3 agressive B-cell lymphoma tumour samples for cases 1, 6, and 7 as well as the corresponding non-tumor whole-genome sequencing BAM files.

  Dataset EGAD50000000800

• Tumor Profiler Project - MEL bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 80 samples from 77 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000851

• Tumor Profiler Project - MEL scDNA data

  The dataset contains 10x Chromium single-cell DNA sequencing data from 63 samples from 60 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000852

• Solve RD DAC

  Dac EGAC00001001319

• WGS from melanoma patient tumor/normal pairs and longitudinal panel-based cfDNA sequencing data

  This data includes paired WGS from tumor/normal and longitudinal panel-based sequencing data of plasma-derived cfDNA from melanoma patients being treated with ICI.

  Dataset EGAD50000000785

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Regulatory Elements active in Insulinomas

  Characterization of regulatory elements active insulinomas, assessed by the presence of H3K27ac. This study also includes characterization of H3K27me3 in control pancreatic beta cells.

  Study EGAS50000000319

• Genomewide association studies in ankylosing spondylitis

  The aim of this study was to identify genes associated with ankylosing spondylitis susceptibility in British and Australian individuals of European descent.

  Study EGAS00000000104

• WGS of primary neuroblastoma data

  Study of ecDNA structure heterogeneity for 13 primary neuroblastoma patients from shallow long-read whole-genome sequencing (MinION platform, WGS mean-coverage 5-10X).

  Study EGAS50000000348

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• Whole genome sequencing of childhood acute lymphoblastic leukaemia patients

  Whole genome sequencing of childhood acute lymphoblastic leukaemia patients. Matched diagnostic and germline samples were obtained from bone marrow aspirates and sequenced on the Illumina platform to characterise the underlying genetic features (DOI: 10.1038/s41375-022-01806-8).

  Dataset EGAD50000000975

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  'Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Dataset EGAD50000001135

• Single-cell sequencing of PBMC & CSF in neuroinflammatory disorders

  Single-cell sequencing and genotyping for Cambridge samples analyzed as part of a project evaluating single-cell gene expression & lymphocyte receptor sequences in CSF and PBMC of MS and other neuroinflammatory disorders.

  Dataset EGAD50000001023

• scRNA-seq from lung cancer organoids and immune cells

  15 scRNA-seq samples were multiplexed, and 5' 10X Chromium scRNA-seq was performed. This dataset provides the FASTQ files for the multiplexed data, as well as the BAM files for the demultiplexed samples.

  Dataset EGAD50000000845

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• Patient-derived xenograft models of head and neck cancers

  Establishment and characterization of two patient-derived xenograft models from HNSCC patients , initiatlly treatment-naive, and for which cetuximab-acquired resistant model couterparts have been generated. All models have been characterized at genomic level. HNSCC tissues were obtained from surgical resections at Cliniques universitaires St Luc in Brussels (Belgium).

  Dac EGAC50000000502

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• fibroblast transcriptome of pediatric patients with epilepsy

  RNA sequencing of fibroblasts from pediatric patients with childhood epilepsy. Fibroblast RNA was extracted at passage 3-6 using MN nucleospin, >90M 150bp paired-end reads per sample were obtained with illumina sequencing. Reads were aligned to hg38.

  Dataset EGAD50000001166

• Dataset for early breast cancer samples

  This dataset contains WGS data for 27 tumor, control and patient derived culture samples of patients with breast cancer. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X using TruSeq Nano DNA Kit. The sequencing was always paired

  Dataset EGAD50000000860

• Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Study EGAS50000000773

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• ATAC-seq in KMS11 vs TKO cells

  ATAC-seq to determine chromatin accessibility in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of the translocated NSD2 allele.

  Study EGAS50000000076

• MicroC in KMS11 and TKO cells

  MicroC to show high resolution chromatin interactions in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of translocated NSD2 allele (KMS11 TKO).

  Study EGAS50000000078

• WES dataset of salivary gland tumor samples and control blood samples

  This dataset contains paired-end WES data of salivary gland tumor samples and control blood samples from 53 patients. Sequencing was performed on Illumina HiSeq 2500, HiSeq 4000 or NovaSeq 6000.

  Dataset EGAD50000001190

• Cohort B germline exome sequencing

  Cohort B includes IDH-wild type, EGFR amplified, surgically derived glioblastoma tissue samples from male and female individuals. Germline DNA was isolated from whole blood.

  Study EGAS50000000951

• RNA-Seq dataset for malignant pleural and peritoneal mesothelioma

  This dataset contains RNA sequencing data of pleural and peritoneal mesothelioma. The number of samples is 18. Sequencing was performed on Illumina NovaSeq 6000 and Illumina NovaSeqXPlus. The sequencing was always paired.

  Dataset EGAD50000001342

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Mitochondrial DNA sequencing of single muscle fibers in Parkinson's disease patients

  Mitochondrial DNA sequencing of n=157 single muscle fibers in Parkinson's disease patients and controls, n=27 bulk tissue samples and n=2 synthetic controls

  Dataset EGAD50000000946

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• WGS data of Japanese including COVID-19 patients and healthy subjects

  This dataset contains WGS data of 234 Japanese, including 88 COVID-19 patients and 146 healthy subjects. Libraries were sequenced on the HiSeqX or NovaSeq 6000 system. Sequenced reads were aligned against the Genome Reference Consortium human genome build 38 using BWA-MEM.

  Dataset EGAD00010002742

• Bulk RNA sequencing of hematological toxicity following CAR-T cells injection

  Bone marrow aspirations obtained from patients treated with CAR-T cells were analyzed using bulk RNA sequencing (CD3+, CAR T+, CD34+ sorted populations).

  Study EGAS50000000777

• Tumor Profiler Project - OV cell-free DNA data

  The dataset contains amplicon sequencing data from 48 samples from 35 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format.

  Dataset EGAD50000001410

• PRPH2-Related Retinal Dystrophies

  NGS dataset including patients affected by genomic variants at gene PRPH2. It includes NGS test using custom IRD gene panels, clinical exome sequencing (CES) and whole-exome sequencing (WES).

  Dataset EGAD50000001239

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398