22938 results for "ega"

in 49.43 milliseconds.

• Whole-exome sequencing data from head and neck cancer patients

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal samples, the primary tumors and the recurrences/metastases of 8 head and neck cancer patients.

  Dataset EGAD00001011278

• A96114A

  Whole genome sequencing for single cells for library A96114A 798 cells; filetype=bam

  Dataset EGAD00001007615

• FFPE CRC WGS Data

  The data consists of 3 BAM files. Two of three BAMs are tumour FFPE samples (1 repaired-FFPE; 1 unrepaired-FFPE); The other BAM file is sequenced from normal colon tissue

  Dataset EGAD00001007716

• Whole-genome-seqeuncing IMFT

  Whole-genome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007804

• A96210C

  Whole genome sequencing for single cells for library A96210C 1191 samples; filetype=bam

  Dataset EGAD00001008254

• Single Cell Genome Sequence for DLP+ library A96210B

  Single Cell Genome Sequence for high grade serous ovarian carcinoma patient SA1047B on DLP+ library A96210B

  Dataset EGAD00001009475

• Germline WES data of children with pathogenic mutations in cancer predisposing genes

  This data set includes bam files (aligned to hg38) from the germline of children who have pathogenic mutations in cancer predisposing genes

  Dataset EGAD00001009854

• RNA-seq

  Bulk RNA-seq data of 8 RNA samples were generated. Libraries were prepared using the Stranded mRNA Library Prep, Ligation Kit (Illumina) following manufacturer’s recommendations and sequenced on a NextSeq 2000 (2x50 bp, Illumina).

  Dataset EGAD00001010308

• RNA sequencing of human lung fibroblasts

  Bulk RNA seq data from human lung fibroblasts isolated from fresh and cryopreserved lung tissue (18 samples, 3 donors)

  Dataset EGAD00001010252

• Ovarian cancer cfDNA dataset

  The dataset contains 23 ovarian cancer and 2 healthy control urine cfDNA samples. Shallow WGS was performed on an Illumina Novaseq S4 PE150bp. Samples are provided as raw reads without any prior processing.

  Dataset EGAD00001010848

• Nanopore medulloblastoma data

  Nanopore data from 3 medulloblastoma samples of which 2 are tumor-normal pairs sequenced with the MinIon and one is tumor only data sequenced on the PromethIon. The data consists of BAM files aligned using minimap2

  Dataset EGAD00001010851

• Single-cell RNA sequencing of 43 BALF samples from CAPA and COVID-19 patients

  Single-cell RNA sequencing of 43 bronchoalveolar lavage fluid (BALF) samples from 15 CAPA and 22 COVID-19 mechanically ventilated patients.

  Dataset EGAD00001011342

• WGS of DNMT3A-mutant adult AML samples

  This dataset contains fastq files derived from whole genome sequencing of primary bone marrow samples from acute myeloid leukemia patients with different DNMT3A mutational status (wildtype, single mutant or double mutant).

  Dataset EGAD00001015432

• Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx tumor patient

  Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015307

• Genome-wide data for 11 Roma individuals

  This dataset includes genome-wide autosomal array data for 11 Iberian Roma individuals used in the Merchero project.

  Dataset EGAD00001007773

• 10xscRNA sequencing of 2 samples RRMM (multiple myeloma)

  Paired scRNA sequencing using 10xgenomics library preparation and Illumina HiSeq4000 for sequencing of 2 samples RRMM (relapsed refractory multiple myeloma)

  Dataset EGAD00001009681

• Genome and transcriptome sequence data from a rosette-forming glioneuronal tumor (RGNT) tumor patient

  Genome and transcriptome sequence data from a rosette-forming glioneuronal tumor (RGNT) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015320

• Genome and transcriptome sequence data from a diffuse midline glioma, H3K27 mutant tumor patient

  Genome and transcriptome sequence data from a diffuse midline glioma, H3K27 mutant patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015326

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - structural variation vcf files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - structural variation vcf files (Mutographs)

  Dataset EGAD00001015389

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - copy number variants (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - copy number variants (Mutographs)

  Dataset EGAD00001015390

• The University of Hong Kong Intestinal Metaplasia Organoids Study scRNASeq Data

  Single cell encapsulation and cDNA libraries were prepared by Chromium™ Single Cell 5’ Reagent Kits and Chromium™ Single Cell A Chip Kit.

  Dataset EGAD00001015422

• Colon adenomas and adenocarcinomas and matched mucosae

  Whole exome sequencing of neoplastic colorectal lesions, matched normal mucosa and peripheral blood leucocytes from 7 individuals. Data is contained within FASTQ files.

  Dataset EGAD00001010875

• Human tumor bulk RNA-seq

  We profiled 7 patient neuroblastoma-FOXR2 tumor samples by bulk RNA-seq. The raw fastqs are provided.

  Dataset EGAD00001010901

• Single-cell CITE-seq from MDS patients with SF3B1 mutations

  Single-cell CITE(cellular indexing of transcriptomes and epitopes)-seq from MDS (n = 2, MDS02 in 2 replicates). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011281

• Profiling human first-trimester neurodevelopment using scATAC-seq and multiomics

  116 single cell ATAC runs and 23 single cell multiome (ATAC+RNA) runs on various brain regions during human first-trimester development.

  Dataset EGAD00001011300

• Spatially resolved cellular and molecular drivers of cardiac remodelling in healthy and failing human hearts: Adult Spatial (2025-07-31)

  Spatial transcriptome analysis of the human heart . This dataset contains all the data available for this study on 2025-07-31.

  Dataset EGAD00001015666

• WES and RNAseq data from Clonal driver neoantigen loss under EGFR TKI and immune selection pressures

  WES and RNAseq data from Clonal driver neoantigen loss under EGFR TKI and immune selection pressures

  Dataset EGAD00001015474

• ARIC

  Bam files are from matched normal + "very early" plasma (diagnostic) samples, sequenced on Illumina NovaSeq 6000 instrument. After bwa alignment, duplicates were removed by picard markduplicate, and base quality scores recalibrated using gatk baserecalibrator + apply bqsr.

  Dataset EGAD00001015603

• WGS DATA FILES FOR SJPhLike

  WGS DATA FILES FOR SJPhLike

  Dataset EGAD00001000976

• Use of deep sequencing to detect clonal mutations in sun exposed human epidermis - whole genome

  Deep sequencing of two skin biopsies to study the landscape of somatic mutations in human adult tissues.

  Dataset EGAD00001001123

• GIS-LUNGTCR1-2016_VAL-BAM

  This dataset contains BAM files of targeted Amplicon deep-sequencing data, for validation of the mutations found in WES. There are 16 patients and 95 samples in total, including 16 controls and 79 tumors.

  Dataset EGAD00001001980

• Whole genome sequencing of paediatric glioblastoma in the ICGC PedBrain project

  Whole genome sequencing of paediatric glioblastoma in the ICGC PedBrain project

  Dataset EGAD00001002006

• RNA-seq data from 195 pediatric BCP-ALL cases

  RNA-seq data from 195 pediatric BCP-ALL cases. Alignment: TopHat 2.0.7. Reference genome: hg19.

  Dataset EGAD00001002112

• Analysis of somatic mutations in normal blood, AML and MDS samples

  Targeted pulldown of genes known to be recurrently mutated in AML & MDS from patient and normal samples using Agilent Sureselect and for some cases also using Illumina Truseq technology.

  Dataset EGAD00001002180

• Exome_Sequencing_of_Human_myeloid_malignancies

  This study involves exome sequencing of blood/bone marrow DNA from patients with myeloid malignancies. Blood DNA samples have been taken from patients at different timepoints of disease phenotype. We hope to elucidate mechanisms of clonal evolution in these patients.

  Dataset EGAD00001002213

• Whole genome sequencing of 98 tumour-normal pairs for the pancreatic neuroendocrine cancer project

  Whole genome sequencing of 98 tumour-normal pairs for the PAEN-AU pancreatic neuroendocrine cancer project.

  Dataset EGAD00001002684

• Infant Spindle Tumour Study (2019-04-11)

  We aim to describe the transcriptomic landscape of infant spindle cell tumours. . This dataset contains all the data available for this study on 2019-04-11.

  Dataset EGAD00001004954

• Hospital for Sick Children Infant Glioma RNA Sequencing

  Whole transcriptome (n=4) and targetted RNA sequencing (n=15) .bam files of infantile glioma samples reported on at the Hospital for Sick Children

  Dataset EGAD00001005092

• Somatic genetic basis of Wilms' tumour

  We investigated the somatic genetic basis of Wilms' tumour and found complex phylogenetic relations between tumours

  Dataset EGAD00001005134

• UCSF brain tumor data

  Single Nuclei ATAC seq data from GBM tumor samples. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005314

• ChIP-seq for GOF p53

  This dataset includes ChIP-seq data from two cell lines (HKCI-11 (GOFp53) and MIHA(WT p53)). All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005449

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• Presence of bacterial infection in brains of patients with Huntington's disease (HD)

  Bacterial isolation in infected brains in patients with Huntington's disease. Here we used next generation sequencing of 16S ribosomal RNA gene PCR amplicons (NGS 16S amplicon analysis)

  Dataset EGAD00001005996

• Bulk and single cell RNA-seq analysis of keratinocytes and human skin

  106 bulk RNA-seq samples of primary human keratinocytes 8 single cell RNA-seq samples of human epidermis

  Dataset EGAD00001005998

• RNA-Sequencing data of Human Acute Myleloid Leukemia Stem Cells

  RNA-Sequencing of 27 functionally validated LSC and blast fractions from 9 AML patients. Three healthy hematopoietic stem and progenitor cells from age-matched controls.

  Dataset EGAD00001006112

• Giant congenital nevi exome sequencing

  Whole exome sequencing of eight affected skin biopsies (“lesional”) from five giant CMN patients (age range, 4-58) with matching unaffected skin (not available in one patient) along with germline DNA. Agilent SureSelect V5+UTRs.

  Dataset EGAD00001006283

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• Therapeutic vulnerabilities in the DNA damage response for the treatment of ATRX mutant neuroblastoma

  Whole genome sequencing data of isogenic ATRX/TP53 knockout clones of the neuroblastoma cell line SK-N-SH

  Dataset EGAD00001006294

• Whole genome sequencing of the healthy breast

  Whole genome sequencing of 29 donors of healthy mammary tissue. BAM files of stromal and epithelial DNA are included.

  Dataset EGAD00001006402

• BAM files of evolution T-ALL adults project

  WGS BAMs of 19 adult patients with T-acute lymphoblastic leukemia with primary, remission and relapse sample per patient. Total = 58 samples sequenced with HiSeq 4000 or NovaSeq 6000 (Illumina).

  Dataset EGAD00001006543

• RNA sequencing data of pretreatment tumor biopsies of patients treated in the OpACIN-neo trial

  The dataset includes RNA sequencing on pre-treatment tumor biopsies of lymph node metastases (n=65)

  Dataset EGAD00001006731

• Single-cell RNA-seq data from metastatic ovarian cancer for quality control study

  This study includes treatment-naïve fresh tissue sample from 4 HGSOC patients.

  Dataset EGAD00001006984

• Targeted sequencing of healthy bone marrow without antibodies

  Targeted sequencing using BD Rhapsody with 462 mRNA of healthy young adult bone marrow mononuclear cells from iliac crest aspirations (BM3/Young3).

  Dataset EGAD00001008184

• Induction of trained immunity by influenza vaccine: impact on COVID-19

  Cryopreserved PBMCs from 10 individuals before and after vaccination were used to perform single cell RNA sequencing. Equal number of cells per individual were pooled together (5 individuals per pool) and single-cell RNA sequencing was performed in paired-end mode on NovaSeq 6000 (Illumina) with a depth of 50,000 reads per cell. DNA was isolated from PBMCs and then used for genotyping by Illumina GSA Beadchip. This dataset contains the fastq sequence files, genotypes of the donors used for demultiplexing the pools and files indicating the linkages between individuals, pools and fastq files. The number of samples listed by EGA does not match the actual number of samples due to limitations on the upload scheme used.

  Dataset EGAD00001007827

• PCA Atlas Visium spatial transcriptomics data (FASTQs, spaceranger BAMs and Visium mapping tables)

  This dataset contains Visium spatial transcriptomics data for the PCA Atlas study EGAS00001008332. It includes: - Raw Visium FASTQ runs (EGAR00004172272–EGAR00004172283) for all libraries. - spaceranger alignment BAM analyses for those libraries where BAM output was generated. - visium.csv: a slide-level mapping table linking Visium slide samples to EGA sample accessions, sequencing runs/experiments and spaceranger BAM analyses. - visium_tma.csv: a TMA mapping table describing how mini-TMA slides relate slide-level Visium libraries to tissue-level samples/cores. Together these objects provide the raw and aligned Visium data and the technical/biological mappings needed to understand and reuse the spatial transcriptomics component of the PCA Atlas. High resolution histology images are available from the following Zenodo repository, along with additional spaceranger outs for each slide: - https://zenodo.org/records/17411292

  Dataset EGAD00001015796

• Autozygosity pilot - QMUL

  The offspring of first cousin marriages have ~6% of their genome autozygous, i.e. homozygous identical by descent, or even more if there was further consanguinity in their ancestry. In the UK there are large populations with very high first cousin marriage rates of 20-50%. Sequencing the exomes of a sample of these individuals has the potential both to support genetic health programmes in these populations, and to provide genetic research information about rare loss of function mutations. This pilot study based on existing British-Pakistani cohort samples will identify homozygous individuals for almost all variants down to an allele frequency around 1%, plus individuals carrying hundreds of new homozygous rare loss-of-function variants, and will support development of community relations and ethics for a wider study currently being designed. The data deposited in the EGA consists of low coverage whole exome sequencing on these samples.

  Dataset EGAD00001001027

• How to upload GPG files

  Uploading files Users that holds an ega-box-XXX account can upload files using either INBOX or FTP. Users who have a Submitter role associated with their email will only be able to upload files using INBOX. Before uploading your files please make sure that any files that will be uploaded to EGA do not use special characters in their naming convention such as # ? ( ) [ ] / \ = + < > : ; " ' , * ^ | &. This can cause issues with the archiving process, leading to problems for end users. The EGA is a shared, public service with limited storage. In order to manage the available resources, we enforce a limit of 10Tb per submission account at any one time. Please do not exceed this limit. INBOX FTP The FTP is only compatible with files encrypted using the EGACryptor tool Before uploading Once your submission files have been prepared using the EGAryptor, the resulting encrypted files and associated md5sum files can be uploaded to your submission account using Aspera or FTP. The EGA is a shared, public service with limited resources. In order to manage the available resources, EGA submission boxes should not exceed 8Tb in size, and cannot exceed 12Tb. If you are approaching this limit please contact contact EGA Helpdesk so that we can advise on how to register the associated metadata and trigger the archiving of files, so that you can continue with your submission. If we note that your submission account increases above 10Tb on a consistent base your password will be changed until metadata is associated. Aspera Download Aspera Using Aspera FTP FTP windows FTP Linux / Unix FTP client (Filezilla) FTP and TLS Troubleshooting Troubleshooting Aspera Download Aspera is a commercial file transfer protocol that may provide faster transfer speeds than ftp especially over longer distances. The Aspera ascp command line client. Please select Aspera Connect. The ascp command line client is distributed as part of the aspera connect highperformance transfer browser plugin and is free to use, without registration. The minimum required version of the IBM Aspera Cli is V4. Further instructions. Using the Aspera ascp command line program The location of the ascp program in the filesystem: Mac: on the desktop go cd /Applications/Aspera\ Connect.app/Contents/Resources/ there you'll see the command line utilities where you're going to use ascp. Windows: the downloaded files are a bit hidden. For instance, in Windows 7 the ascp.exe is located in the users home directory in: AppData\Local\Programs\Aspera\Aspera Connect\bin\ascp.exe Linux: should be in your user's home directory, cd /home/username/.aspera/connect/bin/ there you'll see the command line utilities where you're going to use ascp. Your command should look similar to this: ascp -P33001 -O33001 -QT -l300M -L- /path/file ega-box-N@fasp.ega.ebi.ac.uk:/path If you wish to upload several files without being requested the password, please use the below command : ASPERA_SCP_PASS=ega-box-password ascp -P33001 -O33001 -QT -l300M /path/file ega-box-N@fasp.ega.ebi.ac.uk:/path/ Explanation of parameters l300M option sets the upload speed limit to 30MB/s. You may wish to lower this value to increase the reliability of the transfer. L option is for printing logs out while transferring files to upload can be a file mask (e.g. '/homes/submitter/*.srf) or a list of files. ega-box-N is your submission account login. Add k2 switch for transfer restarts Check the command line transfer usage for more configuration details. Using FTP to upload your prepared files Use your preferred ftp client. For example, lftp is a popular choice for Linux and Mac users. Use binary mode for file transfers. Use ftp.ega.ebi.ac.uk as the target host. Login with your ega-box username and password. Upload files to your private ega-box upload area. Depending on your network setting you might wish to start FTP in passive or active mode. Using default FTP command line client in Windows Start the command line interpreter: press WinR, type cmd, hit enter Enter ftp ftp.ega.ebi.ac.uk Enter your submission username Enter your submission password Type binary to enter binary mode for transfer To see a list of available ftp commands type help. Type ls command to check the content of your submission account. Type prompt to switch off confirmation for each file uploaded. Use mput command to upload files: mput *.bam* Use bye command to exit the ftp client. Use exit command to exit the command line interpreter. Using default FTP command line client in Linux / Unix Open a terminal and type ftp ftp.ega.ebi.ac.uk Enter your submission username Enter your submission password Type binary to enter binary mode for transfer To see a list of available ftp commands type help. Type ls command to check the content of your submission account. Type prompt to switch off confirmation for each file uploaded. Use mput command to upload files: mput *.bam* Use bye command to exit the ftp client. Using FTP client FileZilla We recommend the use of FileZilla, a free FTP client . FileZilla is open source software distributed free of charge under the terms of the GNU General Public License. Use the following connection details (File - Site Manager) and add yoursubmission account username and password: Using FTP client FileZilla Select the files you wish to upload and then select upload: Using FTP client Filezilla Using LFTP with TLS We recommend the following to force the use of a secure connection. lftp > set ftp:ssl-force yes We also recommend setting the following for not encrypting the bulk data itself for performance reasons (theauthentication will still be encrypted): lftp > ftp:ssl-protect-data no In order to verify the certificate,the recommended way would be to use the CA certificates from your machine. To do that use this command in lftp adjusting the path to your ca-certificates location. lftp > ssl:ca-file "/etc/ssl/certs/ca-certificates.crt" If that is not possible or certificates are old and you can't update them, you can download the certificates needed from Quo Vadis Digital Repository The two certificates to download in PEM format are: QuoVadis Root CA2 G3 QuoVadis EV SSL ICA G3 Then you can concatenate them in a file one after the other and save it as lftp-certificates.pem Once this is done you have to point the ssl:ca-file variable to the path lftp > set ssl:ca-file "/path/to/lftp-certificates.pem" Also note that you can save this configuration at ~/.lftp/rc Another option is to download the certificates and add them to the ca-certificates of your machine. For example: In RHEL7 and cenots and others box the process to add the certificates globally is: Download the two certificates (in PEM or DER format, doesn't matter) and save them to "/etc/pki/ca-trust/source/anchors/" Run "update-ca-trust extract" Another less secure option is to turn off certificate verification with the following command: lftp > set ssl:verify-certificate false Troubleshooting If you are having problems with Aspera connection timeouts, it can be down to either one of the following. Transfers cannot start the connection fails instantly. Ensure that TCP traffic on port 33001 is allowed (open) for outbound connections through your computer's firewall and network's firewall. The connection is made, transfers are started, but 0 bytes (0%) are uploaded for each file. Ensure that UDP traffic on port 33001 is allowed (open) for outbound connections through your computer's firewall and network's firewal

  Documentation submission/data/uploading-files/ftp

• Genentech Data Access Committee

  Dac EGAC00001000055

• "Immunology of Diabetes HMGU"

  Dac EGAC00001002744

• DAC CTC - Plasma-DNA

  Dac EGAC00001000072

• EGAD00010000628

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000628

• EGAD00010000630

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000630

• Testing the feasibility of genome scale sequencing in routinely collected FFPE cancer specimens versus matched fresh frozen samples

  Testing the feasibility of genome scale sequencing in routinely collected FFPE cancer specimens versus matched fresh frozen samples

  Dataset EGAD00001000255

• GoT2D WGS analysis files

  This data set includes the following summary level data files used for the GoT2D WGS analysis: wgs.assoc.samples.list: list of samples to keep for association analysis wgs.assoc.variants.list: list of variants to keep for association analysis wgs.sv.assoc.txt: single variant association results

  Dataset EGAD00010001185

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• Sequencing data for oesophageal and related samples - Normals release 3 (RNA)

  Dataset EGAD00001003902

• arcOGEN_HumanCoreExome-24v1-0_subset_2

  Subset 2 of osteoarthritis cases from the arcOGEN Consortium (http://www.arcogen.org.uk/) genotyped on HumanCoreExome-24v1-0 with consent for osteoarthritis studies only.

  Dataset EGAD00010000927

• arcOGEN_HumanCoreExome-12v1-1_subset_2

  Subset 2 of osteoarthritis cases from the arcOGEN Consortium (http://www.arcogen.org.uk/) genotyped on HumanCoreExome-12v1-1 with consent for osteoarthritis studies only.

  Dataset EGAD00010000924

• arcOGEN_HumanCoreExome-12v1-0_subset_2

  Subset 2 of osteoarthritis cases from the arcOGEN Consortium (http://www.arcogen.org.uk/) genotyped on HumanCoreExome-12v1-0 with consent for osteoarthritis studies only.

  Dataset EGAD00010000923

• usgwas-QC_update

  Understanding Society GWAS, samples that passed quality control

  Dataset EGAD00010000891

• Sequencing data for oesophageal and related samples - Normals release 5 (RNA)

  Dataset EGAD00001005384

• Array data for oesophageal and related samples – sj_paper_methyl_normal_release

  Array data for oesophageal and related samples – sj_paper_methyl_normal_release

  Dataset EGAD00010001834

• Colorectal-Cancer-Tumor-Spheres-H012-Microarray_Expression

  Gene expression of 12 colon cancer TSCs (sensitive or resistant) after 12h treatment with 3µM NCT02 or DMSO (control) was analyzed using Illumina microarrays (HumanHT-12 v4 BeadChip).

  Dataset EGAD00010001936

• Ni_Vanuatu_Omni2.5

  Blood DNA samples from 1,433 contemporary ni-Vanuatu were genotyped on the Illumina Infinium Omni 2.5-8 array. Genotype calling was performed using the Illumina GenomeStudio software.

  Dataset EGAD00010002344

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• Average_hypermethylation_TF_sites

  Average hypermethylation on transcription factor binding sites based on nanopolish calls; only positions showing higher methylation than sample’s average methylation at enhancers were included when defining the average methylation level. Data from 6 individuals at different time points.

  Dataset EGAD00010002411

• Sequencing data for oesophageal and related samples - Normals release 2 (RNA)

  Dataset EGAD00001003838

• Sequencing data for oesophageal and related samples - Normals release 4 (RNA)

  Dataset EGAD00001004022

• Genotype data for African Esophageal squamous cell cancer cases and controls from South Africa

  This dataset contains the cleaned genotype data from 2173 African eosphageal squamous cell cancer cases and population controls. The genotype data was generated using the H3Africa Illumina Custom microarray.

  Dataset EGAD00010002575

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• mCEL-Seq2 analysis of human brain tissues and border regions

  mCEL-Seq2 analysis with reference mapping of human brain tissues and border regions

  Dataset EGAD50000000046

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Mutation detection of T follicular helper cell lymphomas

  Whole-exome sequencing data for study of tumor heterogeneity and immune-evasive microenvironment in T follicular helper cell lymphomas

  Study EGAS50000000276

• Sanger sequencing of MV4-11 cell lines targeting the TP53 R284 locus

  Sanger sequencing data of cell lines derived from bulk MV4-11 cells, targeting the R248 locus of TP53, consisting of either wildtype or homozygous mutant lines.

  Dataset EGAD50000000447

• Perturb-seq on CRC

  Systematic, genome-wide Investigation of enhancer regions in colorectal cancer. We used scRNA-seq with CRISPRi/dCas9 inhibition of 12,117 regions.

  Study EGAS50000000256

• CRC cell line RNA-seq

  RNA-Seq data for C32, CACO2, CL11, HT29, SW403, SW948 MSS CRC cell lines and HCEC-1CT normal colon cell line

  Dataset EGAD50000000297

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• 16SV4 ribosomal RNA gene sequencing data

  16SV4 ribosomal RNA gene sequencing data of GI samples and associated mixed community cultures collected from pediatric patients at risk for IBD.

  Dataset EGAD50000000485

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• scATAC-seq of sorted CD45+ cells from blood and tissues

  scATAC-seq by 10xGenomics Droplet Sequencing from two human donors. scATAC sequences are available for FACS-sorted CD45+ cells from blodd, skin and vat (visceral adipose tissue)

  Dataset EGAD50000000510

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• Center for Technology Licensing at Cornell University for data associated with Nature Medicine 2024 paper

  For data access to plasma/tumor/normal samples from the manuscript "Ultrasensitive plasma-based monitoring of tumor burden using machine learning-guided signal enrichment" from Widman et al. Nature Medicine 2024

  Dac EGAC50000000207

• Human dorsal root ganglia after plexus injury - RNA-fragment sequencing from histological slices dataset

  Transcriptome profiling of Human dorsal root ganglia after plexus injury based on low Input Total RNA-seq from FFPE material

  Dataset EGAD50000000959

• RNA-seq in LCLs derived from constitutional MLH1 epimutation carriers and non-carrier relatives

  RNA-seq in LCLs derived from constitutional MLH1 epimutation carriers and non-carrier relatives to investigate alterations in gene expression associated with MLH1 epimutation

  Dataset EGAD50000000712

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• CIRCLE-seq of PDO

  CIRCLE-seq data of PDAC 1 patient-derived organoid (PDO) - Unmapped reads, libraries were sequenced using the Illumina NextSeq500 with the NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles), generating around 10M paired end 150bp reads per sample

  Dataset EGAD50000000281

• WGS of PDO in depleted media

  Whole genome sequencing profiling of 7 PDAC patient-derived organoids (PDO) grown in a culture medium lacking both WNT3A and RSPO1- WGS unmapped reads, sequenced using NovaSeq 6000, 15x coverage 160 million reads per sample.

  Dataset EGAD50000000282

• H3Africa ACEGID Omni Array Phenotype

  Phenotype data for Lassa Fever cases and population controls from Nigeria and Sierra Leone associated with genotype data generated using Illumina Omni 2.5M and 5M.

  Dataset EGAD00001010922

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• Young-Boost Whole Exome Sequencing (WES)

  Datasets associated with Young Boost Trial for Breast Cancer patients. Whole Exome Sequencing (WES) performed on 109 Samples (75 Tumor and 34 Normal). WES was performed to identify potential predictive biomarkers for treatment response.

  Dataset EGAD50000001171

• Analysis of cell type contributions to cell free DNA in health and disease.

  This study looks at cell type contributions to cell free DNA in health and disease.

  Study EGAS50000000178

• Studying the cellular diversity of the human hypothalamus

  We use single-cell and spatial transcriptomics to catalogue cellular populations and their locations in the human hypothalamus

  Study EGAS50000000716

• H3K27Ac ChIP-seq of 9 cHL cell lines

  The dataset contains 36 ChIP-seq data for H3K27Ac and their corresponging inputs for 9 cHL cell lines. Data are raw paired-end fasq files for each histone and input, and for each cell line.

  Dataset EGAD50000001272

• South African breast cancer GWAS genotype data in VCF format

  South African breast cancer GWAS genotype data for 2823 female African breast cancer cases. The data was generated using the H3Africa Custom microarray and genotyped on the Illumina HiScan instrument. The dataset is in VCF format.

  Dataset EGAD00010002732

• Clinical and ctDNA data for IMpassion031

  Clinical and ctDNA data for IMpassion031, including survival, response, and ctDNA data from baseline through post-surgery time points. 222 samples run on Signatera assay. File type is csv.

  Dataset EGAD50000001420

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• DNAmet

  DNAmet analysis of olfactory mucosa (OM) cells derived from cognitively healthy and individuals with AD exposed to traffic-related ultrafine particles (UFPs) for 72h in submerged cultures. The UFPs used for exposures were: A0 and A20. Exposures were compared to the corresponding blank samples.

  Dataset EGAD50000001531

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• WGS data of isogenic wild-type RPE1

  Deposited here are WGS data generated from isogenic wild-type (WT) RPE1 untreated and treated with brequinar for 42 days (and other dNTP-pool disruptor compounds)

  Dataset EGAD50000001602

• WGS dataset for two NUP98-Rearranged Acute Myeloid Leukemia PDX samples

  This dataset includes whole genome sequencing of two patient-derived xenograft (PDX) samples with NUP98-Rearranged Acute Myeloid Leukemia. Bam files are provided for each sample.

  Dataset EGAD50000001563

• Meniere Disease Genomic Data Access Committee

  This Data Access Committee is responsible for reviewing and managing data access requests related to genomic variant files from whole exome sequencing of patients diagnosed with Meniere disease. This includes data from both familial and sporadic forms of the disease.

  Dac EGAC50000000708