7188 results for "({!join from=dataset_studies to=id v=$q1}) OR ("transcriptome" OR "RNA-seq" OR "rna sequencing" OR "rna-sequencing")"

in 50.47 milliseconds.

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• High-throughput sequencing data for study of molecular drivers of resistance to castration in localised prostate cancer

  Aligned whole-genome sequencing and RNA-seq of localised prostate cancer for study 'Loss of SNAI2 in prostate cancer correlates with clinical response to androgen deprivation therapy'.

  Dataset EGAD00001006640

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Dataset for RNA and Exome sequencing of Glioblastoma samples

  This dataset contains RNA Seq, 10x scRNA Seq and Exome sequencing of glioblastoma samples. Sequencing was performed on a Illumina NovaSeq 6000 and Illumina HiSeq 4000. The sequencing was always paired.

  Dataset EGAD00001012235

• An Integrated Approach to Patient Stratification and Therapy Selection in Acute Myeloid Leukemia

  As more clinically-relevant genomic features of myeloid malignancies are revealed, it has become clear that targeted clinical genetic testing is inadequate for risk stratification. Here, we developed and validated a clinical transcriptome-based assay for stratification of acute myeloid leukemia (AML). Comparison of RNA-Seq to whole genome and exome sequencing revealed that as a standalone assay, RNA-Seq offered the greatest diagnostic return, enabling identification of expressed gene fusions, single nucleotide and short insertion/deletion variants, and whole-transcriptome expression information. Expression data were used to develop a novel risk score which, when combined with molecular risk guidelines, allowed for the re-stratification of 22.1 to 25.3% of AML patients from three independent cohorts into correct risk groups. Within the adverse-risk subgroup, we identified a subset of patients characterized by dysregulated integrin signaling and RUNX1 or TP53 mutation. We show that these patients may benefit from therapy with inhibitors of focal adhesion kinase (PTK2), demonstrating additional utility of transcriptome-based testing for therapy selection in myeloid malignancy.

  Dataset EGAD00001006701

• Evolutionary Analysis of Chronic Lymphocytic Leukemia Cells During Relapse After Allogeneic Hematopoietic Stem Cell Transplant

  We investigated the molecular dynamics driving relapse of chronic lymphocytic leukemia (CLL) following allogeneic hematopoietic stem cell transplant (allo-HSCT) through an integrated analysis of whole exome, bulk transcriptome, bulk methylome and single cell transcriptional data from paired leukemic samples representing 19 patients. We found that their clinical kinetics corresponded to distinct genetic and epigenetic evolutionary trajectories and suggest that the selection pressures of the post-transplant, immunologic bottleneck are distinct from those imposed by chemotherapy.In order to discover cancer antigens derived from annotated and unannotated protein-coding regions of the genome, we carried out ribosome profiling (Ribo-seq) and RNA-sequencing on CLL samples and isolated primary B cells from healthy donors. We discovered novel or unannotated open reading frames (nuORFs), their expression levels, as well as somatic mutations within them to predict potential neoantigens.

  Study phs001998

• Identification and characterization of tertiary lymphoid structures in brain metastases

  Brain metastases (BrM) are the most common cancers in the brain. We performed transcriptome-wide gene expression profiling combined with spatial immune cell profiling to characterize the tumor immune microenvironment in BrM from different primary tumors. We found that BrM from lung carcinoma and malignant melanoma showed overall higher immune cell infiltration as compared to BrM from breast carcinoma. RNA sequencing-based immune cell deconvolution revealed gene expression signatures indicative of tertiary lymphoid structures (TLS) in subsets of BrM from lung cancer and melanoma. This finding was corroborated by multiplex immunofluorescence staining of immune cells in BrM tissue sections. Detection of TLS signatures was associated with prolonged survival after BrM diagnosis in lung cancer patients. Our findings highlight the cellular diversity of the tumor immune microenvironment in BrM of different cancer types and suggest a role of TLS formation for BrM patient outcome.

  Study EGAS50000000563

• Single-cell omics data for COVID-19 patients

  Single-cell RNA-seq, single-cell ATAC-seq, and genotypes used in the analysis for the study "Altered and allele-specific open chromatin landscape reveal epigenetic and genetic regulators of innate immunity in COVID-19". The RNA-seq and ATAC-seq are raw data in FASTQ format while the genotypes are in the VCF format which was filtered and imputed (more details are available in the main text of the study).

  Dataset EGAD00001009331

• Paired RNA-Seq data of Primary lymphomas of the central nervous system (PCNSL)

  Primary lymphomas of the central nervous system (PCNSL) are diffuse large B-cell lymphomas (DLBCLs) which are confined to the central nervous system (CNS). Paired RNA-Seq sequencing was done on Illumina HiSeq2000 machines using Illumina TruSeq RNA library preparation kit. About 36 tumor samples were sequenced.

  Dataset EGAD00001007811

• Datasets of RNA-seq of tumor samples from clear cell renal cell carcinoma patients included in the Translational Program of the NIVOREN GETUG-AFU-26 trial

  RNA-seq analyses were performed on tumor tissue samples of 115 advanced clear cell renal cell carcinoma patients who participated in the NIVOREN GETUG-AFU-26 trial. The samples were obtained prior to treatment initiation. RNA-seq was performed to evaluate previously published gene expression signatures. These included: the IMmotion T effector (CD8A, EOMES, PRF1, IFNG and CD274) and the IMmotion Myeloid (IL-6, CXCL1, CXCL2, CXCL3, CXCL8, and PTGS2) gene signatures represent gene expression patterns associated with T effector cells and myeloid cells, respectively, while JAVELIN Renal 101 Immuno (T-cell receptor signaling: CD3G, CD3E, CD8B, THEMIS, TRAT1, GRAP2, CD247; T-cell activation, proliferation, and differentiation: CD2, CD96, PRF1, CD6, IL7R, ITK, GPR18, EOMES, SIT1, NLRC3; Natural killer cell mediated cytotoxicity: D2, CD96, PRF1, CD244, KLRD1, SH2D1A; Chemokine: CCL5, XCL2; and Other immune response genes: CST7, GFI1, KCNA3, PSTPIP1) represents gene expression patterns associated with both innate and adaptive immune response.

  Dataset EGAD50000001541

• A Pilot Study of Rapid Autopsy and Procurement of Tissue in Thoracic Malignancy Cancer Patients to Investigate Tumor Heterogeneity

  Integrated proteo-genomics studies to characterize tumor heterogeneity of metastatic lung adenocarcinoma and thymic carcinoma are lacking. We carried out whole exome sequencing, RNA sequencing, copy number estimation and mass spectrometry-based proteomics of 40 tumors from five rapid/warm autopsy patients. We found highly variable mutational heterogeneity that was largely driven by APOBEC-mutagenesis with the expression of APOBEC3B (Gene ID: 9582) and APOBEC3A_B (Gene ID: 100913187) due to underlying APOBEC3 region germline variants as the likely mediating mechanism. APOBEC3A_B expression was associated with increased immune tumor microenvironment and CD274 (Gene ID: 29126) expression while smoking was associated with increased APOBEC-mutagenesis in TP53 (Gene ID: 7157) mutant tumors with high APOBEC3B expression. Heterogeneity at the level of the transcriptome and proteome occurred in association with copy number heterogeneity, not APOBEC-induced mutational heterogeneity. Arm and focal copy number alterations (CNAs) occurred as an evolutionarily late event in a subset of patients, with corresponding changes in the transcriptome and proteome, implicating CNAs as a driving force of heterogeneity in the evolution of metastatic disease.

  Study phs001432

• Reproducibility of 10x Genomics single cell RNA sequencing method in the immune cell environment

  Study EGAS00001005905

• Single-Cell and Spatial Multi-Omics Highlight Effects of Anti-Integrin Therapy Across Cellular Compartments in Ulcerative Colitis

  This is a focused, nested case-control study within our larger cohort "Immunoprofiling of the Blood and Intestine and Creation of a Gut Cell Atlas". This sub-study is titled as "Single-cell and spatial multi-omics highlight effects of anti-integrin therapy across cellular compartments in ulcerative colitis”. We examined the impact of Vedolizumab (VDZ), an anti-integrin antibody therapy, on the cellular landscape of ulcerative colitis (UC). While VDZ is primarily recognized for its role in preventing lymphocyte migration to the gut, the extent of its influence on other cellular populations has not been fully characterized. We used single-cell RNA sequencing (scRNA-seq) and cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) to profile cells from both the blood and colon tissue samples. We pooled single-cell suspensions together before running scRNA-seq and CITE-seq, and subsequently deconvoluted the samples using the freemuxlet and demuxlet algorithms and variant call files (vcf) from bulk RNA-seq. This allowed us to assign cells to individual study subjects. We compared the cellular compositions of healthy individuals to those of UC patients undergoing treatment with VDZ or mesalamine (5-aminosalicylic acid/5-ASA). Our results revealed that VDZ induces significant changes in the variety and dynamics of mononuclear phagocytes within both the bloodstream and intestinal tissue, accompanied by subtle variations in lymphocyte populations. The dbGaP submission will provide raw sequencing data and participant phenotype data regarding disease and treatment status.

  Study phs003502

• RNA sequencing from patient-derived intestinal organoids

  RNA from the duodenal organoids was isolated using an RNeasy Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. RNA purity and concentration were measured using a NanoDrop One spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA). Preparation of the RNA library and transcriptome sequencing was conducted by Novogene Co., LTD (Cambridge, UK). Messenger RNA was purified from total RNA using polyA selection and subjected to library construction. Sequencing was performed on an Illumina platform, and 150 bp paired-end reads were generated.

  Study EGAS50000000338

• Proteogenomic Landscape of Squamous Cell Lung Cancer

  To provide a detailed analysis on how genomic and transcriptomic alterations related to proteome level changes in squamous cell lung cancer (SCC), we performed an integrated analysis incorporating DNA copy number, somatic mutations, expression RNA-sequencing, and expression proteomics in 108 SCC nested within clinical outcome, tumor pathology, and other clinically relevant data.

  Study phs001781

• BRCA Mutation Status Shapes the Microenvironment of Pancreatic Adenocarcinoma

  This study was established in order to address how the stromal landscape is influenced by BRCA-mutated and BRCA Wild-type (WT) pancreatic ductal adenocarcinoma (PDAC). A primary cohort of 12 PDAC patients (7 BRCA-WT and 5 germline BRCA-mut) was analyzed by laser-capture microdissection, RNA-sequencing and multiplexed immunofluorescence.

  Study phs002994

• Identification of the cause of juvenile parkinsonism in a case_SYNJ1

  This study aimed to elucidate the genetic causes underlying the Juvenile Parkinsonism diagnosed in a girl using whole-exome sequencing, analysis of CAG repeats, RNA sequencing analysis on fibroblasts, and metabolite identification. As a result, a homozygous missense mutation SNP T/C (rs2254562) in SYNJ1 and alteration in metabolism were identified.

  Study EGAS00001007686

• Ex vivo modeling of precision immuno-oncology responses in lung cancer

  Single-cell RNA-sequencing (scRNA-seq) data from paired lung cancer organoids and immune cells. The experiment was performed using the Single Cell 5' solution of 10X Genomics. The dataset includes 15 samples from 4 multiplexed experiments. The multiplexing was performed using the Feature Barcoding technology of 10X Genomics.

  Study EGAS50000000593

• Elucidation of the association of the HPV integration and oropharyngeal cancer

  Whole-genome sequencing was performed using tumor and blood samples from 14 patients with HPV-associated oropharyngeal cancer. Bulk RNA sequencing was performed using tumor samples from 19 patients with HPV-associated oropharyngeal cancer and 17 patients with non-HPV-associated oropharyngeal cancer and normal tonsil samples from 2 healthy controls.

  Study JGAS000751

• RNA-sequence analysis in patients with inclusion body myositis

  This study aimed to elucidate the molecular features of inclusion body myositis (IBM). We performed RNA sequencing analysis of muscle biopsy samples from myositis patients with the pathological finding of CD8-positive T cells invading non-necrotic muscle fibers expressing major histocompatibility complex class I (IBM, polymyositis, and unclassifiable myositis), and controls.

  Study JGAS000068

• Oncogenic gene fusions in primary colon cancers

  This study represents RNA-sequencing data from 278 primary colon cancers obtained from fresh-frozen tumor sections. The project goal was to identify novel oncogenic gene fusions in these data. In addition, we studied the detected gene fusions at the molecular level and defined their effects on downstream pathways.

  Study EGAS00001002197

• The genomic landscape of primary cutaneous anaplastic large cell lymphoma (pcALCL)

  Primary cutaneous anaplastic large cell lymphoma (pcALCL) is the second most common variant of cutaneous T-cell lymphoma. We subjected tumor biopsies from patients with pcALCL to whole-genome sequencing, whole-exome sequencing and RNA-sequencing to investigate genomic alterations and deregulated gene expression in the disease.

  Study EGAS00001004429

• Comparison of fresh and slow-frozen cancer samples for different applications

  Surplus tissues from multiple solid human cancers directly slow-frozen after resection can subsequently be used for different types of methods including the establishment of 2D, 3D, and ex vivo cultures as well as single cell RNA sequencing (scRNAseq) with similar results when compared to freshly analyzed material.

  Study EGAS00001005891

• Natural Killer Cell Plasticity During IL-15-driven Homeostatic Proliferation

  Here we performed single-cell RNA sequencing to address repertoire stability and subset plasticity during IL-15 driven homeostatic proliferation. Sorted NK cell subsets representing discrete stages of NK cell differentiation are compared with the corresponding subsets after proliferation and further sorted into two subsets depending on the rate of proliferation.

  Study EGAS00001003946

• Transcriptomic signatures of CD4+ T cells from visceral leishmaniasis (VL) patients

  Bulk RNA-sequencing was performed on CD4+ T cells isolated from the blood of visceral leishmaniasis patients (n = 12) and endemic controls (EC; n = 12). CD4+ T cells were obtained by magnetic-activated cell sorting (MACS). Alterations in the transcripts of T helper (Th) cells during infection were identified.

  Study EGAS00001004152

• Personalised Mapping of Tumour Development in Synchronous Colorectal Cancer Patients

  We performed an in-depth characterisation of 12 tumours from 3 syCRC patients by analysing histopathological, whole genome sequencing and RNA-sequencing data. We assessed the extent of genetic overlap between synchronous tumours and examined associations between clinicopathological information and the molecular, microbial and immune features of each tumour genome.

  Study EGAS00001004413

• Smart-seq3 scRNA-seq of cells from primary (OV2295) and metastatic (OV2295R2) high-grade serous ovarian cancer cell-line

  In this project, single cells extracted from two high-grade serous ovarian cancer cell-lines, one primary (OV2295) and one metastatic (OV2295R2), where split into two 384 well plates and libraries were prepared using Smart-seq3 single cell RNA sequencing (Hagemann-Jensen et al, 2020).

  Study EGAS00001006868

• 3D-GSC_expression_profiles

  In this study, we used RNA-sequencing gene expression profiling in order to characterize specific phenotypic traits in DIPG-derived glioma stem cell (GSC) models. Twenty-two primary GSC models derived from biopsies collected at diagnosis were cultured in an ECM-mimicking compound before for RNA extraction and subsequent rRNA-depletion and sequencing .

  Study EGAS00001007182

• Adrenal scRNA sequencing data access

  Raw sequencing datasets for manuscript "Hybrid untargeted and targeted RNA sequencing facilitates genotype-phenotype associations at single-cell resolution".

  Dac EGAC50000000869

• Pseudogene RNAseq

  RNA sequencing to validate findings of somatic pseudogenes acquired during cancer development

  Dataset EGAD00001000732

• Deciphering molecular mechanisms underlying hematological malignancies and development of novel therapeutic approaches

  We aim to identify epigenomic features dysregulated in hematological malignancies through epigenetic analyses of hematological malignant cells. We also perform RNA sequencing to profile tumor cell-specific transcriptomes and target gene sequencing to profile somatic gene mutations in tumor cells. Regarding identified epigenomic abnormalities, we perform further analysis to determine whether they could be good candidates to translate into therapy development. To this end, we will modulate the activity of targets by using their activators and inhibitors in vitro and establish xenograft mouse models of hematological malignancies and manipulate their activity in vivo. Through these studies, we aim to develop new therapeutic agents or modalities that lead to improved patients��� prognosis.

  Study JGAS000603

• Transfer Learning Associates CAFs with EMT and Inflammation in Tumor Cells in Human Tumors and Organoid Co-Culture in Pancreatic Ductal Adenocarcinoma

  This study examined the transcriptional changes induced by cancer associated fibroblasts (CAFs) in pancreatic ductal adenocarcinoma patient-derived tumor organoids. We hypothesized that cancer associated fibroblasts impacted tumor cell transcription to promote tumorigenic behavior. Using patient-matched cells from 3 patients, we compared the transcriptional profiles of patient-derived organoids in monoculture to patient-derived organoids co-cultured with CAFs. Similarly, we looked at the transcriptional changes in matched patient-derived cancer associated fibroblasts grown in monoculture or co-cultured with patient-derived organoids. With a focus on intercellular crosstalk, we identified crosstalk between cancer associated fibroblasts and patient-derived organoids through VEGFA and NRP1. This was identified by bulk RNA sequencing and examined dynamically in organoid-CAF co-culture. This dbGaP deposit is the bulk RNA sequencing data for these 3 patients.

  Study phs003563

• P4HA1 Mediates Hypoxia-Induced Invasion in Human Pancreatic Cancer Organoids

  Pancreatic ductal adenocarcinoma (PDAC) is an aggressive malignancy defined by extensive invasion into the local tumor microenvironment and systemic metastasis. PDAC develops in a hypoxic microenvironment and adapts to survive under low oxygen conditions, including the activation of processes that may enhance the ability of cancer cells to invade locally or metastasize. Here we employ bulk RNA-sequencing of eight patient-derived organoid (PDO) cultures grown in hypoxia and normoxia to identify differentially expressed genes. PDOs were grown in Matrigel, transferred into collagen domes, then incubated in hypoxia or normoxia. Invasive organoids were individually collected from collagen domes grown in hypoxia and normoxia separately and processed for RNA-sequencing analysis. Using this dataset, prolyl 4-hydroxylase subunit alpha (P4HA1) was identified as a potential regulator of PDAC invasion in hypoxia. This dataset exists as a reference for gene expression of invasive organoids in hypoxia and normoxia.

  Study phs003961

• A proteogenomic atlas of the human neural retina

  The human neural retina is enriched for alternative splicing, and it is estimated that more than 10% of variants associated with inherited retinal diseases (IRDs) alter splicing. Previous research mainly used short-read RNA-sequencing techniques to investigate retina-specific splicing and splicing factors. However, this technique provides limited information about transcript isoforms. To gain a deeper understanding of the human neural retina and its isoforms, we generated a proteogenomic atlas that combines PacBio long-read RNA-sequencing data with mass-spectrometry and whole-genome sequencing data from three healthy human neural retina samples. About one third of the nearly 60,000 transcript isoforms were novel, and ten novel peptides that confirmed novel isoforms were detected. This study highlights the importance of studying tissue-specific transcriptomes in greater detail to better understand tissue-specific regulation and to identify disease-causing variants.

  Study EGAS50000000070

• Hepatitis B virus integrations promote local and distant oncogenic driver alterations in hepatocarcinogenesis

  This study contain the WGS and WEX aligned bam files and RNA-seq fastq files for human liver tumors.

  Dataset EGAD00001006426

• SARS-CoV2 mRNA-vaccination-induced Immunological Memory in Human Non-Lymphoid and Lymphoid Tissues

  This dataset includes combined single-cell RNA-Seq and T cell receptor profiling data for SARS-CoV-2 spike protein-reactive CD4+ T cells and NK cells from blood, liver, lungs, and bone marrow of human donors.

  Dataset EGAD50000000062

• Oxidative DNA damage and ubiquitin proteasome system dysfunction underpins neurodegeneration in young adults with a DNA repair disorder

  Deposited here are time series bulk RNA-seq data generated from XP patients and controls as well as rescued patient hiPSC cells during cortical neuronal differentiation.

  Dataset EGAD50000000230

• Oxidative DNA damage and ubiquitin proteasome system dysfunction underpins neurodegeneration in young adults with a DNA repair disorder

  Deposited here are time series bulk RNA-seq data generated from isogenic wild-type (WT), XPA and XPG gene knockouts hiPSC cells during cortical neuronal differentiation.

  Dataset EGAD50000000228

• Tumor Profiler Project - AML scRNA data

  The dataset contains single-cell RNA seq data from 23 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000823

• Genome editing strategies to generate working models in Polycystic Kidney Disease

  Bulk RNA-seq of genome-edited HEK293T cell lines engineered to model specific PKD1 variants. These clones were created with the purpose of enabling the exploration of genotype-phenotype correlations in Polycystic Kidney Disease (PKD)

  Dataset EGAD50000001694

• Human embryonic stem cells dopaminergic neurons scRNA-seq

  The dataset includes 2 samples of Single cell RNA-seq (10X Genomics) from Human Embryonic stem cells. 2 samples with 2 replicates of timepoints 17 and 28 of dopaminergic neuron differentiation.

  Dataset EGAD50000001592

• RNA-seq

  The RNA was extracted using the AS1390 PROMEGA kit according to the manufacturer’s instructions. The samples underwent sequencing using a Novaseq 6000 machine, equipped with an SP 200 cycles v1.5 cartridge. The sequencing process varied slightly across batches based on the input RNA and the library preparation kits used.

  Dataset EGAD50000002023

• WES, ultra-deep sequencing exome and RNAseq data of diseased liver samples

  1. Utra-deep exome sequencing data, illumina pair-end reads, fastq, 190 samples 2. WES data, illumina pair-end reads, fastq, 120 samples 3. RNA-seq data, illumina, pair-end reads, fastq, 20 samples

  Dataset EGAD00001004792

• Paired-end RNA-seq analysis of the Hypermutation and Malignant Progression in Low-grade Glioma Patients

  44 DNA samples were derived from the tumors of the low grade glioma patients and sequenced using Illumina RNAseq paired-end technology. Dataset contains 44 BAM files aligned to hg19 using Tophat 2.

  Dataset EGAD00001005387

• RNA-seq dataset

  HTG EdgeSeq fastq files of bulk baseline tumors from IMbassdor250: a randomised phase 3 trial comparing atezolizumab with enzalutamide vs enzalutamide alone in patients with metastatic castration-resistant prostate cancer.

  Dataset EGAD00001007685

• scMultiome

  This dataset gather scMultiomic data including RNA-seq and ATAC-seq in MM.1S in control and dex condition at 1h and 4h

  Dataset EGAD00001011140

• RNA-seq dataset of Ewing and Ewing-like-sarcoma tumoroid biobank reveals distinct drug sensitivities: translocation makes the difference

  Creation of living organoid biobank for ewing and ewing-like sarcomas

  Dataset EGAD00001015419

• Japanese liver cancer RNAseq

  RIKEN collection of RNA-seq reads for 458 liver cancer samples and matched normal liver from 247 donors.

  Dataset EGAD00001001880

• RNA Sequencing of Pulmonary Arterial Endothelial Cells in Pulmonary Hypertensive Patients and Controls

  The transcriptome of pulmonary arterial endothelial cells from healthy lungs and from lungs of patients with idiopathic pulmonary arterial hypertension have been analyzed and specific differences in disease-relevant pathways were identified. The genes identified as altered in these patients have direct effects on pulmonary arterial endothelial cell function. This finding may underlie the inability of the pulmonary vasculature to respond to and repair the damage observed in pulmonary hypertension.

  Study phs000998

• RNA sequencing from patient-derived intestinal organoids

  uman duodenal tissues for establishing organoid cultures used in this study were sourced from de-identified surgical specimens (n = 3) of the duodenum obtained from patients who had undergone biopsy procedures unrelated to CeD at Tampere University Hospital. The protocol was approved by the Ethics Committee of Tampere University Hospital, Tampere, Finland (ETL code R18082). RNA from the duodenal organoids was isolated using an RNeasy Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. RNA purity and concentration were measured using a NanoDrop One spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA). Preparation of the RNA library and transcriptome sequencing was conducted by Novogene Co., LTD (Cambridge, UK). Messenger RNA was purified from total RNA using polyA selection and subjected to library construction. Sequencing was performed on an Illumina platform, and 150 bp paired-end reads were generated.

  Dataset EGAD50000000492

• RNA sequencing of NK cells in human lung

  Human lung tissue-resident NK cells (trNK cells) are likely to play important roles in viral infections, inflammation and cancer. However, knowledge about lung trNK cells is lacking but is fundamental for exploiting these cells in therapeutic approaches. Here we analysed the transcriptome of CD69+CD49a+CD103+CD16-CD56bright, CD69+CD49a+CD103-CD16-CD56bright, CD69+CD49a-CD103-CD16-CD56bright, CD69-CD49a-CD103-CD16-CD56bright, and CD56dimCD16+NKG2A+CD57- NK cells isolated from human lung.

  Study EGAS00001003544

• Blood Transcriptome Profiling Links Immunity to Disease Severity in Myotonic Dystrophy Type 1 (DM1)

  Here, we explore the molecular signatures in RNA sequencing data from blood associated with disease severity as measured in Myotonic dystrophy type 1 (DM1) patients with less than 400 CTG-repeat length size in the DMPK gene in blood. These DM1 patients participated in the OPTIMISTIC study. This approach involved stratifying those within the OPTIMISTIC study into different patient groups with different degrees of disease severity (as measured by the muscle-impairment rating scale (MIRS)) and assessed at baseline. Patients were divided into groups with mild (MIRS 1–2) and severe (MIRS 3–5) neuromuscular symptoms with different DMPK repeat length characteristics. Therefore these .Bam files are baseline samples from this study.

  Dataset EGAD00001010010

• Total RNA sequencing of 32 chronic lymphocytic leukemia (CLL) patients

  Peripheral blood mononuclear cells (PBMC) of CLL patients were isolated by density-gradient centrifugation over Linfosep (Biomedics, Madrid, Spain). B cells were purified with a CD19+ magnetic-bead system (MidiMACS, Miltenyi Biotec, Bergish Gladbash, Germany) according to the manufacturers’ instructions. Mean B-cell purity was >99% and the mean percentage of CD5+/CD19+ cells after purification was >98%, as measured by flow cytometry. Total RNA was extracted from purified cells in a single step using TriPure Isolation Reagent (Roche Applied Science, Vilvoorde, Belgium).Whole transcriptome sequencing libraries were prepared using the TruSeq Stranded Total RNA Sample Preparation Kit (Illumina). Libraries underwent 2 × 76 bp paired-end sequencing on a HiSeq 2500 instrument (Illumina). The median number of paired-end reads was 60.5 million (range, 49.7-79.7 million).

  Dataset EGAD00001004047

• GnRH Agonist-Induced Ovarian Suppression and Ovarian Steroids in PMDD and Controls

  In this study, lymphoblastoid cell line cultures (LCLs) from women with premenstrual dysphoric disorder (PMDD) and asymptomatic controls were compared via whole-transcriptome sequencing (RNA-seq) during untreated (ovarian steroid-free) conditions and after estradiol and progesterone treatment. In untreated LCLs, pathway analysis of the LCL transcriptome revealed, among others, over-expression of ESC/E(Z) complex genes (an ovarian steroid-regulated gene silencing complex) with significant overexpression of MTF2, PHF19, and SIRT1 (P<0.05) in cells from women with PMDD compared with controls. Finally, mRNA expression of several ESC/E(Z) complex genes were increased by progesterone in controls only, and decreased by estradiol in PMDD LCLs.

  Study phs001344

• RNA and whole-exome sequencing of 22 patients with non-small cell lung cancer

  Whole exome sequencing from pre-treatment samples and matched blood normals from 22 patients. Of these individuals, on-treatment samples are available for a subset of 18 patients. RNA sequencing from pre-treatment samples from 21 patients. Of these individuals, on-treatment samples are available for a subset of 15 patients.

  Dataset EGAD00001008733

• Whole exome and transcriptome analysis of UV-exposed epidermis and carcinoma in situ reveals early drivers of carcinogenesis

  Squamous cell carcinoma in situ (SCCIS) is a prevalent precancerous lesion that can progress to cutaneous squamous cell carcinoma (cSCC). Although SCCIS is common, its pathogenesis remains poorly understood. To better understand SCCIS development, we performed laser-captured microdissection of human SCCIS and adjacent epidermis to isolate genomic DNA and RNA for next generation sequencing. Whole exome sequencing (WES) identified UV-signature mutations in multiple genes including Notch 1-3 (GeneID:4851, GeneID:4853, GeneID:4854) in the epidermis and SCCIS and oncogenic TP53 (GeneID:7157) mutations in SCCIS. Novel gene families, including SCHLAFEN genes, contained UV/oxidative-signature disruptive (UVD) epidermal mutations that manifested positive selection in SCCIS. The frequency and distribution of NOTCH and TP53 mutations indicate that NOTCH mutations may precede TP53 mutations. RNA sequencing identified 1166 differentially expressed genes; the top 5 enriched GO biological processes included: 1) immune response, 2) epidermal development, 3) protein phosphorylation, 4) regulation of catalytic activity, and 5) cytoskeletal regulation. The NEURL1 ubiquitin ligase, which targets Notch ligands for degradation, was upregulated in SCCIS. Neuralized 1 protein was found to be elevated in SCCIS suggesting that increased levels could represent a novel mechanism for downregulating Notch during UV-induced carcinogenesis. The data from DNA and RNA sequencing of epidermis and SCCIS provide insights regarding SCCIS formation.

  Study phs002019

• RNA-seq of oropharynx cancer cases from University of Michigan

  This dataset consists of 67 bulk RNA-seq data (sorted aligned BAM files) from formalin-fixed paraffin-embedded (FFPE) oropharynx tumor samples from the University of Michigan (UM). Samples were collected as part of the UM Head and Neck SPORE between 2008-2014. Library preparation was performed using the ribo-depletion method with the FastSelect kit and sequenced on the NovaSeq 6000 at the UM Advanced Genomics Core, resulting in 150bp paired-end reads. Raw reads were trimmed using Cutadapt (v3.4) and aligned to hg38 and high-risk HPV genomes using STAR (v2.7.9a). 62 of 67 samples were determined to be HPV RNA-positive.

  Dataset EGAD50000001306

• SCANDARE HNSCC 3' Tag RNA-seq

  SCANDARE (NCT03017573) is a multicentric biobanking study, enrolling adult patients with newly diagnosed head and neck squamous cell carcinoma (HNSCC), triple negative breast cancer (TNBC), ovarian and cervical cancer. Tumor tissue and blood samples are collected at several time points during patient's journey, including at diagnosis, post-neoadjuvant chemotherapy in case of neoadjuvant treatment, at surgery, at recurrence and at disease progression following treatment initiated at recurrence. Since its launch in 2017 at Institut Curie, SCANDARE has enabled the longitudinal collection and preservation of samples for in-depth analyses. Here, we describe molecular alterations in 264 FFPE samples at baseline from 90 HNSCC patients using 3'-tag RNA-seq technology, with FASTQ files deposited in the dataset.

  Dataset EGAD50000001655

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  arious peripheral blood immune cell subsets from 5 rheumatoid (RA) donors were collected ("CD16p_Mono", "CL_Mono???, "DN_B", "Fr_II_eTreg???, "mDC???, "Mem_CD4" , "Naive_B" , "Naive_CD4" , ???Neu", "NK" , "pDC" , "Plasmablast", ???SM_B", "Tfh", "Th1", "Th17", "Th2" , "USM_B"). The patients were analyzed again longitudinally after abatacept treatment. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000602

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  Various peripheral blood immune cell subsets from 39 healthy volunteers and 50 rheumatoid (RA) donors were collected ("CD16p_Mono", "CL_Mono???, "DN_B", "Fr_II_eTreg???, "mDC???, "Mem_CD4" , "Naive_B" , "Naive_CD4" , ???Neu", "NK" , "pDC" , "Plasmablast", ???SM_B", "Tfh", "Th1", "Th17", "Th2" , "USM_B"). 15 RA patients were analyzed longitudinally. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000598

• Brain transcriptome of hereditary cerebral haemorrhage with amyloidosis–Dutch type (HCHWA-D)

  HCHWA-D is an early onset hereditary form of Cerebral Amyloid Angiopathy (CAA) caused by a point mutation resulting in an amino acid change (NP_000475.1:p.Glu693Gln) in the Amyloid Precursor Protein (APP). Post-mortem brain tissue (9 patients and 9 age-related controls; frontal and occipital cortex) was used for next generation sequencing of RNA (RNA-Seq with ribosomal RNA depletion).

  Study EGAS00001002730

• RNA-seq and Hi-C data of a chromothripsis patient's iPS cells

  This dataset contains RNA-seq and Hi-C data files of induced pluripotent stem (iPS) cells and iPS cell-derived neural progenitors (NPCs) derived from a germline chromothripsis patient and both parents. iPS cells of the patient (cell lines 14 and 15), the father (lines 23 (with two replicates) and 32) and mother (line 30) were differentiated to NPCs and RNA was collected on day 0, day 7 and day 10 of differentiation. In addition, Hi-C data for two iPS cell-derived NPC lines from the patient (14 and 15) and two lines from the father (23 and 32) was generated.

  Dataset EGAD00001002242

• BLUEPRINT EpiVar RNA-seq for Naive naive CD4+ T-cells

  BLUEPRINT EpiVar RNA-seq for Naive naive CD4+ T-cells

  Study EGAS00001000752

• TXT_CD138N_15

  TPM matrices of counts from RNA sequencing (RNAseq) from longitudinal CD138(–) BM fractions.

  Dataset EGAD00001011145

• SNF_RNAseq_CD138n_20f

  TPM matrices of counts from RNA sequencing (RNAseq) from baseline CD138(–) BM fractions.

  Dataset EGAD00001011142

• Gene_regulation_of_human_CD4__Treg_cells_

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole genome sequence data for ChM-seq (118 H3K4me3, 118 H3K27ac and 6 inputs), ATAC-seq (114 samples) and whole transcriptome (141 samples). All individuals were genotyped (130 samples) using coreExome Illumina SNP chip array. The final quality filtered set included 123 individuals with RNA-seq data, 73 with ATAC-seq, 91 with H3K27ac ChM-seq and 88 with H3K4me3 ChM-seq data. A total of 62 individuals had QCed data for all the assays.

  Study EGAS00001003516

• RNA-seq data from Non Small Cell Lung Cancer (NSCLC) samples

  RNA-seq data from Non Small Cell Lung Cancer (NSCLC) samples

  Study EGAS00001004032

• Nasopharyngeal RNASeq Comparing SARS-CoV-2+ Patients and SARS-CoV-2 Negative Control Subjects

  The goal of this analysis was to compare RNAs enriched in the upper respiratory tract of SARS-CoV-2 patients and SARS-CoV-2 negative controls. RNA-sequencing of RNA isolated from the viral transport medium associated with nasopharyngeal swab samples from SARS-CoV-2+ patients and SARS-COV-2 negative controls.

  Study phs002433

• A Sequential Window of Opportunity Trial of Anti-PD-L1/TGF-β trap (M7824) Alone and in Combination with TriAd Vaccine and N-803 for Resectable Head and Neck Squamous Cell Carcinoma not Associated with Human Papillomavirus Infection

  This submission includes the whole exome and bulk RNA sequencing associated with the correlative study of clinical specimens from a prospective clinical study of neoadjuvant bintrafusp alfa in patients with newly diagnosed, surgically resectable oral cavity or laryngeal squamous cell carcinoma. 

  Study phs002849

• Spatiotemporal Analysis of the Human Cerebellum

  We sought to characterize neural progenitors within spatially demarcated regions of the human cerebellum at a molecular level during neurogenesis. We used laser-capture microdissection to enrich for cells within the ventricular zone and subventricular zone regions of the rhombic lip, external granule cell layer and Purkinje cell layer, then performed RNA-sequencing on the enriched samples.

  Study phs001908

• Vulnerabilities of Midbrain Dopaminergic Neurons to Parkinson's Disease Revealed by Single-Cell Genomics

  We developed a novel protocol for the enrichment of midbrain DA neurons from frozen tissue. We subsequently performed single-nuclei RNA-sequencing on enriched samples from postmortem midbrain tissue from human, macaque, tree shrew, rat, and mouse. We identified vulnerable and resistant populations from these data and associated genetic enrichments and differential expression changes.

  Study phs002879

• Single Cell and Spatial Transcriptomic Profiling of Haemophilus ducreyi Infection

  We investigated the immune response in end-point pustules formed by Haemophilus ducreyi in volunteers using an experimental infection model. Six volunteers were infected in the skin of the upper arm at three sites with 41-85 CFU of H. ducreyi loaded on an allergy testing device; a sham-inoculated (e.g., wound) site was also performed. Five volunteers (4 men and 1 woman; 2 Asians and 3 Whites; aged 27-46 years) formed pustules 6-8 days post infection; 1 volunteer spontaneously resolved all sites. If a volunteer formed pustules, biopsies were performed to collect their pustule and wound sites. Biopsy pairs for all 5 pustule formers were subjected to single cell (sc) RNA-seq. Sequencing libraries were prepared using the 10X Genomics Single-cell 3' RNA-seq kit. Spatial transcriptomics was performed on biopsy pairs from 4 of the 5 pustule formers. Ten micron sections were placed on 10X Genomics Visium slides for fresh-frozen tissue, and libraries were prepared with the 10X Genomics Visium spatial 3' gene expression kit. All samples were sequenced on an Illumina NovaSeq 6000. Count tables were produced with CellRanger and SpaceRanger, respectively, and Seurat was used to analyze the data. We identified 13 major cell types by scRNA-seq; the proportion of some immune cell subsets was increased in pustules compared to wound sites. We also localized the major cell types within the tissue by using the scRNA-seq data to deconvolve the spatial transcriptomic data. The FASTQ files and count tables from CellRanger and SpaceRanger are provided.

  Study phs003754

• Comprehensive genomic analysis of patient derived orthotopic xenograft model in primary central nervous system lymphoma

  The purpose of this study is to investigate genetic background of orthotopic xenograft cells and aseess consistency with parent tumor cells. For exome sequencing, we used two distinct PCNSL cells (YML9 and YML11). We also performed RNA sequencing for 7 PCNSL patient tumor cells to compare NF-kB pathway activation.

  Study JGAS000178

• Multi-modal single-cell analysis of salivary glands from patients with Sjogren's syndrome

  Sjogren's syndrome (SS) is an autoimmune disease that causes salivary gland dysfunction due to immune-mediated destruction. In this study, we apply multi-modal single-cell technologies - single-cell RNA sequencing and T-cell receptor sequencing - to salivary gland lesions, aiming to uncover transcriptional signatures and TCR sequence linked to autoantibody profiles.

  Study JGAS000808

• Investigation of relapse prediction in infants with MLL-rearranged Acute Lymphoblastic Leukemia

  In infants with ALL, accurate relapse prediction would enable treatment strategies that take relapse risk into account, with potential benefits for both low- and high-risk patients. Through analysis of bone marrow biopsies taken at initial diagnosis, we show that single-cell RNA sequencing can predict future relapse occurrence.

  Study EGAS00001003986

• Gene expression profile of mesothelial-derived carcinoma-associated fibroblasts

  RNA-sequencing was carried out on ascetic fluid-isolated mesothelial cells from low-grade serous ovarian cancer patients, high-grade serous ovarian cancer patients, chemotherapy-treated high-grade serous ovarian cancer patients and control mesothelial cells obtained from non-oncologic patients to identify differentially expressed genes associated to mesothelial-to-mesenchymal transition process.

  Study EGAS00001003747

• Childhood Cancer Model Atlas

  we establish a single-site collection of 243 cell lines, including 207 paediatric cancer cell lines representing 14 distinct extracranial and brain childhood tumour types. We subjected 164 paediatric cancer cell lines to multi-omic analyses across three dimensions (DNA-sequencing, RNA-sequencing, DNA methylation) to classify them based on clinically relevant molecular subtypes.

  Study EGAS00001006320

• Single-cell analysis of the multicellular ecosystem in viral carcinogenesis by HTLV-1

  Single-cell RNA sequencing (scRNA-seq), antibody-derived tag sequencing (scADT-seq) and T/B-cell receptor (TCR/BCR) sequencing (scTCR/BCR-seq) on peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Study EGAS00001004936

• Multiomics analyses of Parkinson's disease midbrains

  Understanding the key pathological mechanisms underlying Parkinson's Disease pathology is fundamental for the development of novel and more effective therapeutic strategies. In this study, post-mortem human midbrain tissue from a cohort of 13 PD patients and 10 controls was analyzed with a set of multi-omics technologies including small RNA sequencing, transcriptomics and proteomics profiling.

  Study EGAS00001004966

• RNA-Seq - Characterization of a Breast Patient-derived Tumor Organoid biobank from an underserved population of patients

  RNA-seq datasets of patient and patient-derived organoids

  Study EGAS50000000683

• GBM cancer stem cell lines -RNA-seq and WGS data

  Glioblastoma stem cell lines have been profiled for RNA-seq and WGS

  Study EGAS00001003700

• van Hijfte GBM dataset 2022/A (single-nucleus RNA-seq)

  van Hijfte GBM dataset 2022/A (single-nucleus RNA-seq) 1x GBM

  Study EGAS00001006920

• SNF_RNAseq_CD138p_20

  TPM matrices of counts from RNA sequencing (RNAseq) from baseline CD138+ enriched BM fractions.

  Dataset EGAD00001011148

• TXT_CD138P_15

  TPM matrices of counts from RNA sequencing (RNAseq) from longitudinal CD138+ enriched BM fractions.

  Dataset EGAD00001011144

• Characterizing the cell-free transcriptome in a humanized DLBCL patient-derived tumor xenograft model for RNA-based liquid biopsy in a preclinical setting

  This study explores the cell-free transcriptome in a humanized DLBCL patient-derived tumor xenograft (PDTX) model. Blood plasma samples (n=171) derived from a DLBCL PDTX model including 27 humanized (HIS) PDTX, 8 HIS non-PDTX and 21 non-HIS PDTX NOD-scid IL2Rgnull mice were collected during humanization, xenografting, treatment, and sacrifice. The mice were treated with either R-CHOP, huCD20-Fc-AFN-CHOP, or phosphate-buffered saline (PBS). RNA was extracted using the miRNeasy serum/plasma kit and sequenced on the NovaSeq 6000 platform using the SMARTer Stranded Total RNA-seq pico v3 kit.

  Study EGAS50000000566

• Transcriptome analysis of endometrial organoids derived from patients with Mayer-Rokitansky-Küster-Hauser syndrome

  The Mayer-Rokitansky-Küster-Hauser (MRKH) syndrome is characterized by agenesis of the uterus and upper part of the vagina in females with normal ovarian function. The cause of the disease is still enigmatic. Here, we developed organoid cultures from endometrium found in uterine rudiment horns of MRKH patients. Phenotypically they share great similarity between healthy control organoids and are fully hormone responsive. Transcriptome analysis using RNA-seq identified possible disease-causing pathways altered in MRKH patients during development of the female reproductive tract. Thus, the organoid cultures provide a powerful research model for further insight into disease-causing alterations.

  Study EGAS00001005908

• Pulmonary atypical carcinoid multi-omic dataset on up to 42 tumours from same patient

  Pulmonary atypical carcinoid. DNA WES and RNA-Seq on 42 tumour samples collected at autopsy, 10x Chromium linked read whole genome sequencing on four tumours plus one normal sample, and targeted DNA sequencing on two clinical biopsies and one blood plasma sample. Note – RNA-Seq dataset features complex batch effect attributable to tissue processing artefacts, as described in "Complex patterns of genomic heterogeneity identified in 42 tumor samples and ctDNA of a pulmonary atypical carcinoid patient" - Robb et al., 2022 and detailed in Supplementary Table S3. Note – RNA-Seq dataset features complex batch effect attributable to tissue processing artefacts, as described in "Complex patterns of genomic heterogeneity identified in 42 tumor samples and ctDNA of a pulmonary atypical carcinoid patient" - Robb et al., 2022 and detailed in Supplementary Table S3.

  Dataset EGAD00001009296

• Single-cell/single-nucleus RNA-seq of diffuse hemispheric gliomas, H3G34-mutant.

  9 DHG-H3G34 patient samples were sequenced by paired-end scRNA-sequencing using the Smart-Seq2 protocol on a NextSeq 500 sequencer (Illumina). Illumina bcl2fastq 1.5 was used for demultiplexing. This dataset contains the resulting 9,408 fastq files of 4,704 single cells/nuclei sequenced.

  Dataset EGAD50000000760

• Paired-end RNA-seq analysis of the 3D evolution of glioma cell populations. Part 1.

  Dataset includes 160 double-stranded RNAseq libraries collected from 16 patients with adult diffuse glioma. The majority of these samples were spatially-mapped during sample collection, enabling the genomic information derived from them to be mapped in 3D space.

  Dataset EGAD00001005222

• GCP Challenges in Hepatology

  raw RNAseq data from blood plasma of patients diagnosed with liver disease. Total RNA libraries were prepared using the SMARTer Stranded Total RNA-Seq-Kit v3 - Pico Input Mammalian (Takara Bio). Libraries were paired-end sequenced (2x100) o a NovaSeq 6000 instrument using NovaSeq S2 or S1 kit (Illumina).

  Dataset EGAD50000000775