7188 results for "({!join from=dataset_studies to=id v=$q1}) OR ("transcriptome" OR "RNA-seq" OR "rna sequencing" OR "rna-sequencing")"

in 136.80 milliseconds.

• QSEA – modelling of genome-wide DNA methylation from sequencing enrichment experiments

  We describe a new method, QSEA, for analyzing methylation enrichment data. We generated a benchmark experiment consisting of MeDIP-seq enrichment data, targeted BS-seq validation data, and RNA-seq data on five pairs of tumor and adjacent normal samples of non-small cell lung cancer patients. Details of the method and its performance on the data have been described in Lienhard et al. (2016).

  Study EGAS00001001822

• 46 patients primary malignant glioma cohort in Chinese population

  We recruited 46 Chinese patients with primary malignant glioma. All the patients were analyzed with whole-exome sequencing (WES) and 27 of them were analyzed with RNA-seq. We compared the molecular features between patients in different WHO grades. We used six-month progression-free survival (PFS6) status to group glioblastoma (GBM) patients to a good and a poor survival compared two groups genomic profiles.

  Study EGAS00001005583

• A single-cell transcriptional gradient in human cutaneous memory T cells restricts Th17/Tc17 identity

  We identified a gradated transcriptional program of coordinately regulated inflammation-suppressive genes in psoriatic resident memory T cells. This dataset includes bulk RNA-seq for CRISPR-based deactivation of two core components of this inflammation-suppressive program, ZFP36L2 and ZFP36, in human PBMCs. It also includes scRNA-seq of cutaneous immune cells from psoriasis patients before and during therapeutic IL-23 blockade.

  Study EGAS00001006716

• Using_genetics_to_identify_cell_types_and_mechanisms_underlying_susceptibility_to_primary_sclerosing_cholangitis

  Primary sclerosing cholangitis (PSC) is a T-cell mediated, chronic inflammatory condition of the biliary tree that is strongly associated with inflammatory bowel disease. Genome-wide association studies have identified 22 non-HLA genetic risk variants associated PSC. Identifying the genes impacted by these variants has proven difficult as the majority lie in non-coding regions of the genome. Knowledge of the genes and biological pathways these non-coding variants are perturbing is vital to understanding the disease biology. One means of assessing the impact of non-coding variants within disease associated loci upon genes is via colocalisation with eQTL. Many eQTL are cell-type specific, requiring the analysis of disease relevant cell types to detect colocalisation. We have collected PSC-relevant T-cell-subtypes from the peripheral blood of PSC patients via fluorescence activated cell sorting in preparation for RNA sequencing and mapping of eQTL. Samples were collected at the Norfolk and Norwich University Hopital, for which local ethical approval has been granted. Lysed cell samples will be transferred to WTSI and DNA/RNA will be extracted from lysed cell samples by T143 before genotyping (DNA) and custom library preparation and sequencing (RNA). This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001002642

• Genomic Studies of Bipolar Disorder in a Large Cohort from The Netherlands

  The transcriptomes of whole blood samples of a large cohort of individuals from the Netherlands were assayed using RNA-seq. These whole blood samples included patients diagnosed with schizophrenia or bipolar disorder, family members of patients, and healthy controls. Within the whole blood dataset, about 600 of the samples were sequenced to an average of 13.9 million mapped reads per sample, while about 2,000 were sequenced to an average of 5.9 million mapped reads per sample, in order to assess changes in power to detect eQTLs based on sample size. We find that expression, defined as the log transcripts per million reads (TPMs), is highly correlated when comparing the moderate (13.9M) and lower (5.9M) coverage datasets. Additionally, a subset of about 150 individuals provided fibroblast cell lines which were assessed for the levels of gene expression using RNA-seq at an average of 50 million mapped reads per sample. We use downsampling techniques to generate synthetic datasets derived from this real fibroblast RNA-Seq data to explore the relationship between coverage and number individuals in an eQTL analysis. Corresponding individual-level genotypes for the samples included in the expression matrix are also made available. The genotypes were derived from multiple other project cohorts, each using different genotyping platforms including OmniExpress Exome, Global Screening Array, Illumina550, and PsychChip. A Plink file set of these cohorts is provided here after merging the separate project file sets and extracting only the individuals who have expression data also provided here; quality control for SNP-missingness is recommended. We demonstrate in this study that given a fixed budget, eQTL discovery power can be increased by lowering the sequencing depth per sample to allow for an a greater number of individuals sequenced. 

  Study phs002856

• 'KOREAN' never-smoker female adenocarcinoma RNA-seq

  Multi-layered genomic studies such as the TCGA project have greatly advanced our understanding on molecular pathogenesis of lung cancer. For Asian nonsmoker patients, however, majority of studies have been limited to mutational analyses, emphasizing ethnic differences in driver mutations (e.g. more frequent EGFR mutations and ALK fusions). In essence, a comprehensive multi-layered characterization that could lead to molecular etiology and patient stratification scheme to be translated into clinical applications for this patient group is still missing. Here we report molecular profiling of tumor and matched normal tissues from 114 non-small-cell lung adenocarcinoma patients using whole exome sequencing, transcriptome sequencing, and array comparative genomic hybridization (CGH).

  Study EGAS00001003789

• Developing Allelic Imbalance Analysis from Single-Nucleus RNA-Seq Data

  Single-cell RNA-seq (scRNA-seq) is emerging as a powerful tool for understanding gene function across diverse cells. Recently, this has included the use of allele-specific expression (ASE) analysis to better understand how variation in the human genome affects RNA expression at the single-cell level. We reasoned that, because intronic reads are more prevalent in single-nucleus RNA-Seq (snRNA-Seq) and introns are under lower purifying selection, and are thus enriched for genetic variants, that snRNA-seq should facilitate single-cell analysis of ASE. Here we demonstrate how experimental and computational choices can improve the results of allelic imbalance analysis. We explore how experimental choices, such as RNA source, read length, sequencing depth, genotyping, etc., impact the power of ASE-based methods. We developed a new suite of computational tools to process and analyze scRNA-seq and snRNA-seq for ASE. As hypothesized, we extracted more ASE information from reads in intronic regions than those in exonic regions and show how read length can be set to increase power. Additionally, hybrid selection improved our power to detect allelic imbalance in genes of interest. We also explored methods to recover allele-specific isoform expression levels from both long- and short-read snRNA-seq. Overall, we provide an end-to-end experimental and computational approach for future studies.

  Study phs003749

• Knoll et al Identification of drug candidates targeting monocyte reprogramming in people living with HIV

  Introduction People living with HIV (PLHIV) are characterized by functional reprogramming of innate immune cells even after long-term antiretroviral therapy (ART). In order to assess technical feasibility of omics technologies for application to larger cohorts, we compared multiple omics layers. Methods Bulk and single-cell transcriptomics, flow cytometry, proteomics, chromatin landscape analysis by ATAC-seq as well as ex vivo drug stimulation was performed in a small number of blood samples derived from PLHIV and healthy controls from the 200-HIV cohort study. Results Single-cell RNA-seq analysis revealed that most immune cells in peripheral blood of PLHIV are altered in their transcriptomes and that a specific functional monocyte state previously described in acute HIV infection is still existing in PLHIV while other monocyte cell states are only occurring acute infection. Moreover, a reverse transcriptome approach on a rather small number of PLHIV was sufficient to identify drug candidates for reversing the transcriptional phenotype of monocytes in PLHIV. Discussion These scientific findings and technological advancements for clinical application of single-cell transcriptomics form the basis for the larger 2000-HIV multicenter cohort study on PLHIV, for which a combination of bulk and single-cell transcriptomics will be included as the leading technology to determine disease endotypes in PLHIV and to predict disease trajectories and outcomes.

  Study EGAS00001007460

• Dana-Farber Cancer Institute (DFCI) Wu Lab/Avicenne CLL RNA-Seq Study

  Chronic Lymphocytic Leukemia (CLL) is a hematological malignancy characterized by accumulation of CD5+ B cells in peripheral lymphoid organs, bone marrow and blood. Recently, the advent of large-scale whole-exome sequencing of hundreds of CLL samples has led to gain a comprehensive understanding of the mutational landscape of this clonal B cell malignancy, but the functional effects of the putative driver mutations thus discovered are largely unknown. In this study, we analyze RNA-seq data from CLL patients to characterize dysregulated biological pathways regarding the presence of recurrent mutations. Source of tumor is patients' PBMC isolated from peripheral blood using the Ficoll method. Purity was confirmed using flow cytometry flow (>80% in all cases).

  Study phs002335

• Multi-site tumor sampling highlights molecular intra-tumor heterogeneity in malignant pleural mesothelioma

  Background:Malignant pleural mesothelioma (MPM) is a heterogeneous cancer. Better knowledge of molecular and cellular intra-tumor heterogeneity throughout the thoracic cavity is required to develop efficient therapies. This study focuses on molecular intra-tumor heterogeneity using the largest series to date in MPM and is the first to report on the multi-omics profiling of a substantial series of multi-site tumor samples. Methods:Intra-tumor heterogeneity was investigated in 16 patients from whom biopsies were taken at distinct anatomical sites. The paired biopsies collected from apex, side wall, costo-diaphragmatic or highest metabolic sites as well as 5 derived cell lines were screened using targeted sequencing. Whole exome sequencing, RNA sequencing, and DNA methylation were performed on a subset of the cohort for deep characterization. Molecular classification, recently defined histo-molecular gradients, and cell populations of the tumor microenvironment were assessed. Results:Sequencing analysis identified heterogeneous variants notably in NF2, a key tumor suppressor gene of mesothelial carcinogenesis. Subclonal tumor populations were shared among paired biopsies, suggesting a polyclonal dissemination of the tumor. Transcriptome analysis highlighted dysregulation of cell adhesion and extracellular matrix pathways, linked to changes in histo-molecular gradient proportions between anatomic sites. Methylome analysis revealed contribution of epigenetic mechanisms in two patients. Finally, significant changes in the expression of immune mediators and genes related to immunological synapse, as well as differential infiltration of immune populations in the tumor environment were observed and led to a switch from a hot to a cold immune profile in three patients. Conclusions:This comprehensive analysis reveals patient-dependent spatial intra-tumor heterogeneity at the genetic, transcriptomic and epigenetic levels and in the immune landscape of the tumor microenvironment. Results support

  Study EGAS00001005328

• Patient tumour data (RNAseq, WGBS, ChIPseq, WGS)

  Content: 60 GB patient tumours and 4 normal brain samples combined in pairs by region (x2=8 total input samples). RNAseq: 1 lane per sample, total strand-specific rRNA-depleted (normal samples were combined = 2 lanes/samples per brain region). WGBS: 2 lanes per sample (normal samples were combined = 2 lanes/samples per brain region). ChIPseq (histone mark): a subset of 20 GB samples were profiled. For the same modification were multiplexed and sequenced on 4 lanes each (H3K27ac, H3K4me1) or a single lane (all others). WGS: used as matching input control for the 20 ChIPseq samples. Data type and technology: RNA-seq: PE 100bp sequenced on HiSeq2000. WGBS: PE 100bp sequenced on HiSeq2000/4000. ChIPseq: SE 50bp sequenced on HiSeq2000/4000. WGS: PE 150bp sequenced on HiSeq X.

  Dataset EGAD00001005492

• Ither2 RNA-Seq dataset - Implementation of pediatric precision oncology into clinical practice: The individualized Therapies for Children with cancer program “iTHER”

  iTHER is a prospective national precision oncology program aiming to define tumor molecular profiles in children and adolescents with primary very high-risk, relapsed, or refractory pediatric tumors in order to identify relevant aberrations to inform treatment.

  Dataset EGAD00001010179

• RNA-seq dataset

  RNAseq FASTq files from 728 bulk pre-treatment tumors from IMvigor010.

  Dataset EGAD00001007575

• 20210729_EGA_BrainMet Saunus et al J Path (2015)

  Exome sequencing on HiSeq platform of 36 brain metastases with matched normal samples, 32 having matched RNA seq. Published Saunus et al J Path, (2015); https://doi.org/10.1002/path.4583

  Dataset EGAD00001007973

• OncoCis: Annotation of cis-regulatory mutations in cancer

  RNA-seq dataset used for the validation of CDK6 cis-regulatory mutation annotated by OncoCis. NB bam files for manuscript A_Proteomic_Chronology_of_Gene_Expression_through_the_Cell_Cycle_in_Human_Myeloid_Leukemia_Cells are now available at the following link:http://www.ebi.ac.uk/ena/data/view/ERP008483

  Dataset EGAD00001001019

• DAC_for_study__PDFs_RNA-seq_scRNA/TCR-seq

  Study: Pharmacologic inhibition of nonsense-mediated mRNA decay enhances anti-tumour immunity, R. Vendramin et al (2025), Cell Data details: Patient-derived fragments (PDFs) RNA-seq and scRNA/TCR-seq data; treatment: SMG1 inhibition (small molecule inhibitors) and knockdown of SMG1 (siRNA)

  Dac EGAC50000000725

• Gene Expression of Small Cell Carcinoma of the Ovary-Hypercalcemic Type (SCCOHT)

  Small cell carcinoma of the ovary-hypercalcemic type (SCCOHT) is a rare and aggressive form of ovarian cancer afflicting young women at a median age of 24 years. SCCOHTs are characterized by loss of protein expression of SWI/SNF chromatin remodeling ATPases SMARCA4 and SMARCA2 through mutation and epigenetic silencing, respectively. This study aims to establish gene expression profiles of this cancer through RNA-Seq of fourteen pathologically confirmed cases of SCCOHT tumors.

  Study phs001528

• Prospective Procurement of Solid Tumor Tissue to Identify Novel Therapeutic Targets

  Recent advances and insights into the molecular pathogenesis of cancer have led to the development of novel molecular and biologic targeted therapies for the treatment of advanced cancer patients. A critical challenge in extending these studies involves the identification and validation of new therapeutic targets for future cancer therapies. In this study, we performed whole exome and RNA-Seq analysis metastases to determine the nature and frequency of somatic mutations.

  Study phs001003

• Reference Profiles of ExRNAs in Normal Human Pregnancy

  In this study, we did a comprehensive exRNA profiling of plasma and serum specimens from healthy pregnant women, sampled at different gestational time points, and including subjects with diverse geographical and ethnic backgrounds. This study also contains samples from male and female healthy donors to provide a baseline. The aim of this study is to identify miRNAs that can predict the gestation age and to build a miRNA profile across gestation using small RNA-seq data.

  Study phs003182

• Blood Gene Signatures Associated with Stiffness After TKA

  In this study, we used PAXgene Blood RNA tubes collected from patients undergoing total knee arthroplasty (TKA) for osteoarthritis. Samples were collected with IRB approval and patient consent. We identified 8 patients with knee stiffness after TKA (cases) and 10 patients without post-TKA stiffness (controls). We isolated RNA from cases and controls for RNA-seq analyses, comparing samples collected the day of surgery and samples collected at 24 hours after surgery.

  Study phs002927

• RNAseq of 76 samples from Uveal Melanoma tumors

  Hotspot mutations in the spliceosome gene SF3B1 are reported in 20% of uveal melanomas. SF3B1 is involved in 3'-splice site (3'ss) recognition during RNA splicing; however, the molecular mechanisms of its mutation have remained unclear. Here we show, using RNA-Seq analyses of uveal melanoma, that the SF3B1 R625/K666 mutation results in deregulated splicing at a subset of junctions, mostly by the use of alternative 3'ss

  Study EGAS00001002932

• Genetic regulation of RNA splicing in human pancreatic islets

  Genetic variants that influence transcriptional regulation in pancreatic islets play a major role in the susceptibility to type 2 diabetes (T2D). For many susceptibility loci, however, the mechanisms are unknown. To this end, we examined splicing and gene expression QTLs (sQTLs and eQTLs) in pancreatic islets from 399 human donors from publicly available cohorts and in-house data. Here we provide newly generated RNA-seq data and genotyping array data from 101 donors.

  Study EGAS00001006440

• Integrating Genomic and Transcriptomic Data to Identify Breast Cancer Susceptibility Genes

  Genetic factors play an important role in the etiology of both sporadic and familial breast cancer. Since 2007, common genetic variants in ~200 loci have been identified in genome-wide association studies (GWAS) in relation to breast cancer risk. However, it is often difficult to translate GWAS findings to disease prevention and treatment since causal genes in the large majority of GWAS-identified loci are unknown. Furthermore, a large fraction of breast cancer heritability remains unexplained. Recent studies suggest that nearly 80% of disease heritability can be explained by genetic variants regulating gene expression. Herein, we propose three well-powered transcriptome-wide association studies (TWAS) to systematically investigate the association of breast cancer risk with gene expression across the transcriptome of African, Asian and European descendants. In Aim 1, we will perform RNA sequencing and high-density genotyping assays using normal breast tissue samples, and build race-specific gene expression prediction models using data from 1000 women of African, Asian and European descent. These models will be applied to the GWAS data generated from approximately 320,000 breast cancer patients and controls to impute gene expression for association analyses of predicted gene expression with risk of breast cancer overall, and by estrogen receptor and HER2 status. In Aim 2, we will select the top 50 genes identified in Aim 1 for in vitro functional assays to assess their influence on major cell functions related to cancer biology. In Aim 3, we will evaluate whether TWAS-identified genes may express differently in normal breast tissues and breast cancer tissues collected from African, Asian, and European descendants to assess whether these genes may contribute to racial differences in breast cancer risk by molecular subtypes. With strong methodology and a large sample size, we believe that this proposed study should be able to identify and characterize a large number of novel genes related to breast cancer risk. Uncovering breast cancer susceptibility genes will greatly improve the understanding of the genetic and biological basis for breast cancer and accelerate the translation of genetic findings to disease prevention and patient care.

  Study phs003535

• Spatial atlas of human atherosclerosis highlights role of the microvasculature in disease

  Atherosclerosis is a pervasive contributor to ischemic heart disease and stroke. Despite the advance of lipid lowering-therapies and antihypertensive agents, the residual risk of an atherosclerotic event remains high and developing therapeutic strategies has proven challenging. This is due to the complexity of atherosclerosis with a spatial interplay of multiple cell types within the vascular wall. Here we generate an integrative high-resolution map of human atherosclerotic plaques combining single-cell RNA-seq from multiple studies and spatial transcriptomics data from 12 human specimens, with different stages of atherosclerosis. We show cell-type and atherosclerosis-specific expression changes and spatially constrained alterations in cell-cell communication. We highlight the possible recruitment of lymphocytes via ACKR1 endothelial cells of the vasa vasorum, the migration of vascular smooth muscle cells towards the lumen by transforming into fibromyocytes, and cell-cell communication in the plaque region, indicating an intricate cellular interplay within the adventitia and the subendothelial space in human atherosclerosis.

  Study EGAS50000000660

• Spatial Transcriptomics Uncovers Tumor Microenvironment-Based Subtypes in Invasive Lobular Carcinoma

  Invasive lobular carcinoma (ILC) is the second most common histological subtype of breast cancer (BC); however, little is known about its tumor microenvironment (TME). Here, we investigated the spatial architecture of 43 hormone-receptor-positive, HER2-negative (HR+/HER2-) primary ILC samples, using spatial transcriptomics and detailed morphological annotation. By integrating morphology, spatial, and single-cell data, we mapped TME-related cell types, exploring their proximity to tumor cells and their enrichment in specific compartments. Clustering of spatial transcriptomics spots revealed significant inter- and intra-tumor heterogeneity, identifying pathways and cell types linked with disease outcomes. Morphological and gene expression data were finally integrated with a multimodal approach, leading to the identification of 4 new ILC subtypes based on TME heterogeneity. By using derived, specific gene expression signatures, these subtypes were identified and validated in external bulk RNA-seq/microarray datasets (SCAN-B and METABRIC), where differences in prognosis emerged.

  Study EGAS50000001001

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, Whole blood and various immune cell subsets from 119 Systemic Lupus Erythematosus (SLE), 65 Dermatomyositis & Polymyositis, 67 Systemic Sclerosis, 19 Mixed Connective Tissue Disease, 18 Sjogren's syndrome, 24 Rheumatoid Arthritis, 23 Behcet's disease, 18 Adult Onset Still���s Disease, 25 ANCA-associated Vasculitis, 16 Takayasu���s Arteritis and 141 healthy controls (C) were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, Mem_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, LDG, Neu). Whole genome sequencing was performed with whole blood samples. RNA-seq was performed with each immune cell subset samples. After filtering and normalization of the gene expression data, eQTL analysis was performed in each immune cell type. 15 immune cell subsets ATAC-seq was also performed in 8 SLE and HCs, each.

  Study JGAS000220

• RNA_seq_of_Toxoplasma_gondii_response_in_human_macrophages

  Toxoplasmosis is a zoonotic disease caused by a ubiquitous protozoan parasite called Toxoplasma gondii, which caninfect all mammal and bird species throughout the world. seroprevalence varies widely between countries. Studieshave estimated that between 7-34% of people in the UK have been infected with T. gondii. The vast majority of thesepeople will not have noticed any symptoms, however about 10% of people develop a mild to moderate self limitingflu-like illness. Following the acute active stage of the infection the parasite persists in the body in the form of cysts,particularly in heart and skeletal muscle and nervous system tissues, for many years, and usually for life. Inimmunocompetent persons these cysts do not pose a health risk. We will use RNA-seq to quantify the transcriptionalresponse of macrophages to T gondii infection.This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001001708

• Single_Cell_RNAseq_at_various_stages_of_HiPSCs_differentiating_toward_definitive_endoderm_and_endoderm_derived_lineages

  When comparing the differentiation capacities of pluripotent stem cell lines that have different genetic backgrounds, batch to batch experimental variablility poses a significant challenge, especially when trying to identify smaller effects. One way to address this issue is to differentiate several different lines in the same culture dish, thereby elimating experimental variation. In addition, it allows researchers to analyze many more lines with less experiments. Parallel single cell RNA-Seq exploits that individual cells are tagged and hence each cell can be reliably assigned to the donor of origin based on the genetic variants it contains. In addition, analyzing the genetic signature of single cells within a differentiating population can reveal differentation stages that are not easily detected in bulk RNAseq data. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001002278

• Molecular and clinical diversity in primary central nervous system lymphoma: a LOC network multi-omic PCNSL study

  Primary central nervous system lymphoma (PCNSL) is a distinct extranodal lymphoma presenting with limited stage disease but variable response rates to treatment despite homogenous pathological presentation. The likely underlying molecular heterogeneity and its clinical impact is poorly understood. The present dataset contents paired-ended whole-exome sequencing information (n=115; HyperExome Kapa hyperprep), paired-ended RNA-seq information (n=123; KAPA mRNA HyperPrep Kits), and paired-ended bisulfite sequencing (n=64; TruSeq Methyl Capture EPIC) from fresh-frozen tumor tissue immunocompetent, treatment naïve PCNSL patients. Additionally, the dataset includes single-ended RNA-seq (n=93; QuantSeq 3’ mRNA-Seq Library Prep Kit) from formalin-fixed, paraffin-embedded tissue of immunocompetent, treatment naïve PCNSL patients. All samples were sequenced in an Illumina NovaSeq 6000 instrument.

  Dataset EGAD00001008706

• BBMRI – BIOS – Freeze 2 – RNA-seq Counts

  Read counts determined using HTSeq-count for the BBMRI BIOS Freeze 2 RNAseq data

  Dataset EGAD00010001420

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• Clinical phenotype data

  Clinical data corresponding to the patients with ovarian cancer studied using scRNA-seq and bulk RNA-seq. Variables include molecular subtype, predicted immune phenotype, reviewing pathologist comment, final immune phenotype, histology characterization, and tumor stage.

  Dataset EGAD00001006973

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - RNAseq

  Ependymomas (EPN) are the third most common malignant brain cancer in children. Treatment strategies for pediatric EPN have remained unchanged over recent decades, with 10-year survival rates stagnating at just 67% for children aged 0-14 years. Moreover, patients who survive treatment for the most common subtype of pediatric EPN (posterior fossa A (PFA)), often suffer long-term neurological side effects as a result of therapy. It is evident that there is a need for safer, more effective treatments for pediatric EPN patients. There are ten distinct subgroups of EPN, each with their own molecular and prognostic features. To identify and facilitate the testing of new treatments for EPN, in vivo laboratory models representative of the diverse molecular subtypes are required. Here, we describe the establishment of a patient-derived orthotopic xenograft (PDOX) model of PFA EPN, derived from a metastatic cranial lesion. Patient and PDOX tumors were analyzed using immunohistochemistry, DNA methylation profiling, whole genome sequencing (WGS) and RNA sequencing. Both patient and PDOX tumors classified as PFA EPN by methylation profiling, and shared similar histological features consistent with this molecular subgroup. RNA sequencing revealed that gene expression patterns were maintained across the primary and metastatic tumors, as well as the PDOX. Copy number profiling revealed gains of chromosomes 7, 8 and 19, and loss of chromosomes 2q and 6q in the PDOX and matched patient tumor. No clinically significant single nucleotide variants were identified, consistent with the low mutation rates observed in PFA EPN. Overexpression of EZHIP RNA and protein, a common feature of PFA EPN, was also observed. Despite the aggressive nature of the tumor in the patient, this PDOX was unable to be maintained past two passages in vivo. Others who have successfully developed PDOX models report some of the lowest success rates for EPN compared to other pediatric brain cancer types attempted, with loss of tumorigenicity not uncommon, highlighting the challenge in propagating these tumors in the laboratory. Here, we discuss our collective experiences with PFA EPN PDOX model generation and propose potential approaches to improve future success in establishing preclinical EPN models

  Study EGAS00001006844

• Analysis of genes related to the oncogenesis, progression or effectiveness of drug therapies of urological tumors .

  To clarify the oncogenesis and the progression mechanism of urological tumors, we continuously collect tumor samples of our patients with high quality. Then we used them to comprehensive analyses such as genome sequencing or epi-genome sequencing. Through these analyses, we aim for elucidating the oncogenesis or for developing newly treatment strategies of each cancer.

  Study JGAS000303

• RNA-sequencing of ex vivo exhausted human antigen-specific T cells

  Tumor-specific T cells are frequently exhausted by chronic antigenic stimulation. To explore new pathways for reinvigoration of anti-tumor immune functions, we developed a human ex vivo exhaustion model by repetitive antigenic stimulation of primary CD8 T cells. This results in T cells that resemble patient-derived T cells in tumors on a phenotypic and transcriptional level.

  Study EGAS00001006794

• RNA sequencing of CAR-T cells with CD38-CD73-Tim-3-HLA-DR+ phenotype and others in infusion products of tisagenlecleucel for B-cell precursor acute lymphoblastic leukemia

  We enrolled 19 patients with BCP-ALL who took tisagenlecleucel, and infusion products and patient samples were obtained before and after CAR-T infusion. Single-cell analysis by CyTOF revealed that central memory CAR+ T cells increased in long-term responders, whereas PD-1highCD38highCXCR3+ effector CAR+ T cells were enriched in relapsed patients after CAR-T infusion. Furthermore, in long-term responders, CAR+ T cells obtained from infusion products were enriched with CD38-CD73-Tim-3-HLA-DR+ phenotype, and characterized by decreased ability to produce adenosine, and they showed more memory-like transcriptomic characteristics. We elucidated the characteristics of tisagenlecleucel related to a durable response, which could contribute to improving the clinical outcome.

  Study JGAS000760

• minION fastq files of 10 different tumor samples from the Master program (H021)

  Nanopore RNA Sequencing was done for 10 tumor samples. Direct cDNA sequencing was performed using the SQK-DCS109 kit (Oxford Nanopore Technologies). For analysis of a single sample on a MinION flow cell (version R9.4.1), 5 μg RNA was used as input. For multiplexing on a MinION flow cell, 2.5 μg RNA per sample was used as input, and the native barcoding expansion kit EXP-NBD104 was employed in conjunction with SQK-DCS109. After reverse transcription with Maxima H Minus Reverse Transcriptase (Thermo Scientific), second-strand synthesis was performed using the 2x LongAmp Taq Master Mix (New England Biolabs). The resulting double-stranded cDNA was subjected to end-repair and dA-tailing using the NEBNext Ultra End Repair/dA-Tailing Module (New England Biolabs). For multiplexed libraries, this step was followed by barcode ligation and library pooling. Next, libraries were quantified with a Qubit Fluorometer 3.0 (Life Technologies). Finally, sequencing adapters were added to the library preparations and ligated with Blunt/TA Ligase Master Mix (New England Biolabs), followed by further quality control using a Qubit. Samples ACC1 and ACC2 were analyzed on individual MinION flow cells, while the remaining eight samples were sequenced as multiplexed libraries on two MinION flow cells by pooling four samples for each run. Five ACC samples were also analyzed individually on Flongle flow cells

  Dataset EGAD00001008970

• RNA sequencing of periprostatic fat after a 6 month deep androgen deprivation therapy

  Androgen deprivation therapy treated patients (n=11) were recruited from an open label neoadjuvant phase II study in which patients with high-risk disease received a ‘supercastration’ regimen consisting of degarelix 240/80 mg subcutaneously every four weeks; abiraterone acetate 500 mg orally daily titrating upwards every two weeks by 250 mg to a final dose of 1000 mg daily; bicalutamide 50 mg orally daily; and prednisolone 5 mg orally twice daily for a total of 6 months (Australian New Zealand Clinical Trials Registry 12612000772842). Untreated patients with similar pre-treatment characteristics were obtained from a prospective prostatectomy biorepository22,23. Prior to ligation of the dorsal venous complex and prostate pedicles, the anterior prostate was defatted and the specimen was removed immediately, placed in a sterile container and transferred on ice for long-term storage in the vapour phase of liquid nitrogen. A total of 50–100 µg of adipose tissue was separated from fresh frozen samples stored at −160°C. RNA was isolated using the Qiagen RNeasy Lipid Tissue Mini Kit and eluted in 35 µL nuclease-free water. 0.5–1 µg of total RNA was used as the input for cDNA library synthesis using TruSeq RNA Sample Prep Kit v2 (Illumina), and libraries were constructed according to manufacturer’s instructions. Samples were sequenced on a HiSeq 2500 (Illumina) using 101 base paired-end chemistry, aiming for 50 million mapped paired-end reads per sample.

  Dataset EGAD00001004971

• The Role of CDX2 in Controlling ABCB1 Expression and Chemosensitivity in Human Colon Cancer

  This study reports the results of RNA sequencing (RNA-seq) experiments performed on two human colon cancer cell lines (HT-29, DLD-1) that were genetically engineered to achieve either the constitutive expression (in HT-29 cells) or the selective inactivation (in DLD-1 cells) of the transcription factor CDX2, a master regulator of embryonic gut development and a key regulator of multi-lineage differentiation in adult colon epithelial cells. Our previous studies had identified lack of CDX2 expression as a prognostic biomarker of poor prognosis and a predictive biomarker of benefit from adjuvant chemotherapy in Stage-II and Stage-III colon cancer patients (Dalerba et al., NEJM, 374:211-222, 2016; PMID: 26789870). The molecular basis of these associations, however, remained poorly understood. The present study was designed to identify which genes are under the transcriptional control of CDX2, in order to clarify their role in shaping colon cancer resistance to chemotherapy. Of the two lines included in this study, the first (HT-29) is CDX2-negative at baseline, and was infected with a lentivirus vector encoding for the cDNA of the human CDX2 gene under the control of a constitutive promoter (CMV). The second line (DLD-1) is CDX2-positive at baseline, and was infected with a series of lentivirus vectors encoding for CRISPR/Cas9 constructs designed to selectively inactivate the CDX2 gene. In both cases, infected cells were purified by fluorescence-activated cell sorting (FACS), based on the differential expression of a green fluorescent reporter (EGFP) that was also encoded by the lentivirus vectors, and transcribed in tandem with either the CDX2 cDNA (HT-29) or CRISPR/Cas9 gRNAs targeting CDX2 (DLD-1). The experiments were designed to include 3 experimental replicates per condition, and to compare the transcriptional profile of genetically engineered cells with that of autologous controls (i.e., HT-29 cells infected with an "empty" version of the same lentivirus vector used to over-express CDX2, DLD-1 cells engineered with a "non-targeting" CRISPR/Cas9 gRNA). In the specific case of DLD-1 cells engineered with CRIPSR-Cas9 constructs targeting CDX2, infected cells were sorted based on the differential expression of EGFP and then plated as single-cells, in order to sub-culture three isogenic clones, all of which were genetically sequenced to confirm bi-allelic knock-out of the CDX2 gene, and confirmed to lack CDX2 protein expression by Western blot. The results of our experiments demonstrate that, in human colon epithelial cells, CDX2 controls the expression of the ABCB1 efflux pump, by positively regulating the transcription of the corresponding gene.

  Study phs002903

• Whole exome and Transcriptome sequencing of treatment-naïve esophageal adenocarcinoma biopsies and matched peripheral blood mononuclear cells

  Exome sequencing was performed on n=28 treatment-naïve esophageal adenocarcinoma (EACs). Three to four biopsies sampling different areas of each tumor were pooled before nucleic acid extractions to mitigate the elevated heterogeneity described for EAC. WES was performed on EAC biopsies at 120X average coverage, with autologous PBMCs used as germline controls at 80X average coverage. Libraries were prepared from 30 ng of input DNA using the SureSelect QXT Human All Exon V7 kit (Agilent Technologies) and sequenced on the NextSeq 550 (Illumina), 2x150 bp. BCL files were demultiplexed to FastQ files using bcl2fastq2 software (Illumina). Three paired end sequencing batches were analyzed independently (Batch1: samples 8, 10, 11, 12, 15, 17, 18; Batch2: samples 20, 24, 25, 26, 27, 29, 30, 31, 33, 34 ; Batch3: samples 35, 37, 39, 40, 41, 43, 45, 48, 54, 55, 57). RNA sequencing was performed on n=26 treatment-naïve esophageal adenocarcinoma (EACs). Three to four biopsies sampling different areas of each tumor were pooled before nucleic acid extractions to mitigate the elevated heterogeneity described for EAC. RNAseq libraries were prepared on 50 ng of total RNA (with RNA integrity index RIN >=7) with the TruSeq Stranded mRNA library preparation kit (Illumina) in accordance with low-throughput protocol. After PCR enrichment (15 cycles) and purification of adapter-ligated fragments, the concentration and length of DNA fragments were measured using D1000 Screen Tape System (Agilent), obtaining a median insert size of 311 nucleotides. Then, RNAseq libraries were sequenced using the Illumina NovaSeq platform, 1x100 bp, obtaining on average 100 million single reads per sample.

  Dataset EGAD00001010876

• Covacta RNAseq counts

  RNA-seq data from PAXgene extracted whole blood of patients enrolled in the COVACTA trial. This dataset includes read counts per gene. Read counts were generated for the Gencode v27 annotation using the summarize Overlaps method from bioC in mode “IntersectionStrict”

  Dataset EGAD00001011164

• Genomic Characterization CS-MATCH-0007 Arm N

  The CS-MATCH-0007 protocol is part of a collaboration between the Center for Cancer Genomics (CCG) and the Division of Cancer Treatment and Diagnosis (DCTD) to perform whole-exome sequencing, RNA sequencing and if possible, whole-genome, methylation and miRNA sequencing using pre-and post-treatment tumor biopsy specimens from patients enrolled on a treatment arm of the NCI-MATCH clinical trial (EAY131). The goal of this study is to identify the molecular basis for response and resistance to targeted therapies that are matched to specific genomic alterations found in their cancers. Arm N is one of the treatment sub-protocols within the NCI-MATCH Clinical Trial (EAY131) where patients with PTEN mutation, or deletion with PTEN expression on IHC, are treated with the drug GSK2636771. This subprotocol is one of the treatment arms included in the CS-MATCH-0007 protocol and will provide specimens for the program including DNA from tumor tissue and whole blood.

  Study phs002151

• NIDCD Otitis Media Genetic Susceptibility and Middle Ear Microbial Shifts

  The study funded by R01 DC015004 aims to: (1) Identify rare OM susceptibility variants within families and in probands; and (2) Identify differences in the middle ear microbiome due to OM susceptibility variants. This study will also elucidate mechanisms responsible for the formation and growth of cholesteatoma, and bony erosion and complications due to cholesteatoma e.g. intracranial, hearing/vestibular loss, facial nerve palsy. A better understanding of cholesteatoma pathogenesis will potentially reveal novel drug targets, which can lead to new non-surgical therapies for cholesteatomatous OM. Our specific aims for this administrative supplement are: Aim 1 -- Perform RNA-sequencing using cholesteatoma samples collected from Filipino and Colorado patients who will be screened for FUT2, SPINK5 and A2ML1 variants; and Aim 2 -- Using network analysis, identify bone-expressed proteins potentially interacting with FUT2, SPINK5 or A2ML1, then test protein expression in archival human temporal bone in direct contact with cholesteatoma.

  Study phs001941

• Identification and Characterization of Skin-Resident Memory T cells in Patients with Melanoma-Associated Vitiligo

  Metastatic melanoma patients who develop melanoma-associated vitiligo, an autoimmune cutaneous side effect after receiving immunotherapy, have better overall survival than those who do not develop vitiligo. The objective of this study is to determine the tumor-specific memory T cell responses in the skin, tumor and blood of melanoma patients with vitiligo. Matched melanoma tumor, distant vitiligo-affected skin, and blood were collected and sorted for T cells to perform paralleled single-cell RNA sequencing (scRNA-seq) and single-cell TCR sequencing (scTCR-seq) on the day of tissue collection. The transcriptional analysis identified three resident memory T (TRM) cell subsets which were shared between tumors and vitiligo-affected skin. scRNA-seq identified CD8+ T-cell clonotypes in tumors that co-existed as TRM in skin and as effector memory T (TEM) cells in blood. This study revealed that long-term melanoma survivors maintained memory T cell responses as broadly-distributed TRM and TEM compartments. 

  Study phs002309

• A Comprehensive Platform for Analyzing Longitudinal Multi-Omics Data

  PALMO (Platform for Analyzing Longitudinal Multi-omics data) is a platform for analyzing longitudinal data from bulk as well as single cell. It allows to identify inter-, intra-donor variations in genes over longitudinal time points. The analysis can be done on bulk expression dataset without known cell type information or single cell with cell type or user defined groups. It allows to infer stable and variable features in a given donor and each cell type or a user defined group. The outlier analysis can be performed to identify technical/biological perturbed samples in a donor or a participant. Further, differential analysis can be performed to decipher time-wise changes in gene expression in a cell type. The data that is available in the dbGaP is the demo longitudinal samples used in the study, which includes hashed raw fastq files for single-cell RNA-sequencing (scRNA-seq) and non-hashed fastq files for single-cell ATAC-sequencing (scATAC) experiment.

  Study phs003203

• Immune Response to Life-Threatening Respiratory Infections in Children and Young Adults

  This is a cross sectional study describing age-related differences in the nasal mucosal immune response to SARS-CoV-2. We collected nasal mucosal samples from six groups: healthy children, children infected with SARS-CoV-2, children infected with respiratory syncytial virus, children infected with influenza virus, healthy adults, and adults infected with SARS-CoV-2. Samples were obtained by mucosal scrape biopsy of the inferior turbinate using a sterile plastic curette. We performed bulk RNA-sequencing to obtain gene expression data. Clinical data was extracted from the electronic health record including: demographics, medical history, clinical presentation, duration of symptoms, intensive care unit admission, hospital and intensive care unit length of stay, type and duration of respiratory support at sample collection and peak illness. Our analysis described the host response to SARS-CoV-2 in the nasal mucosa in children and adults and compared it to the host response to respiratory syncytial virus and influenza virus.

  Study phs002579

• Integrative Somatic and Germline Computational Biology to Redefine Clinical Actionability in Solid Tumors

  Neuroendocrine tumors (NETs) are rare cancers that arise in the gastrointestinal tract and pancreas. The fundamental mechanisms driving gastroenteropancreatic NETs (GEP-NETs) growth remain incompletely elucidated; however, the heterogeneous clinical behavior of GEP-NETs suggests that both cellular lineage dynamics and tumor microenvironment influence tumor pathophysiology. Here, we performed single-cell RNA-sequencing (scRNA-seq) of fresh resections of GEP-NETs, including four pancreatic NETs, three small intestinal NETs, and one perigastric NET. We used single-cell sequencing to investigate the tumor and immune cellular landscapes of GEP-NET patients. Malignant GEP-NET gene and regulon expression was compared with normal, gastrointestinal endocrine cell differentiation and fate determination stages. We further characterized immune-immune and immune-tumor interaction networks within GEP-NETs, identifying novel therapeutic opportunities in the myeloid compartment of the microenvironment. Our findings highlight the transcriptomic heterogeneity that distinguishes the cellular landscapes of GEP-NET anatomic subtypes and reveal potential avenues for future precision medicine therapeutics.

  Study phs003141

• Ipilimumab and Decitabine in Treating Patients With Relapsed or Refractory Myelodysplastic Syndrome or Acute Myeloid Leukemia

  The NCI Experimental Therapeutics Clinical Trials Network (ETCTN)/Cancer Therapy Evaluation Program (CTEP) 10026 study (NCT02890329) tested combined ipilimumab and decitabine treatment in two cohorts: Arm A consisted of patients with relapsed acute myeloid leukemia (AML) after allogeneic hematopoietic stem cell transplantation. Arm B consisted of patients with advanced myelodysplastic syndrome (MDS) or AML that did not previously undergo stem cell transplantation. During the study, peripheral blood and bone marrow samples were obtained from study participants at study entry (screening), following the first lead-in cycle of decitabine monotherapy, during combined treatment with decitabine and ipilimumab, and at the end of treatment.This study tested the combination of the CTLA-4 blocking antibody ipilimumab and the DNA methyltransferase inhibitor decitabine in advanced myeloid disease in the transplant-naive and post-transplant context. The samples were used for bulk and single cell RNA sequencing (scRNA-seq) as well as whole exome sequencing (WES).

  Study phs003015

• MP2PRT-MNG: Identifying Novel Molecular Markers of Response to Radiotherapy in Meningiomas Using Samples from the RTOG-0539 (NCT00895622)

  The Molecular Profiling to Predict Response to Treatment (MP2PRT) program is part of the NCI's Cancer Moonshot Initiative. The aim of this program is the retrospective characterization and analysis of biospecimens collected from completed NCI-sponsored trials of the National Clinical Trials Network and the NCI Community Oncology Research Program. NRG RTOG (Radiation Therapy Oncology Group)-0539, which was a nonrandomized phase II cooperative group trial in 2009, was selected for inclusion in this program. NRG RTOG-0539 assigned patients with histologically confirmed diagnosis of meningioma to 1 of 3 risk groups based on 2007 WHO grade, resection extent, and recurrence status, and radiotherapy was given per protocol to the intermediate- and high-risk cases. Under the MP2PRT program, DNA methylation profiling, RNA sequencing, and whole exome sequencing were performed on clinical trial cases with available tissue for molecular analyte extraction and subsequent sequencing. Raw molecular data with metadata are available for this study.

  Study phs003707

• Nivolumab plus chemotherapy or ipilimumab in gastroesophageal cancer: CheckMate 649 biomarker analyses

  First-line nivolumab-plus-chemotherapy demonstrated superior overall survival (OS) versus chemotherapy for advanced gastroesophageal adenocarcinoma (CheckMate 649). Nivolumab-plus-ipilimumab provided durable responses and higher survival rates versus chemotherapy; however, the prespecified OS significance boundary was not met. To identify biomarkers predictive of differential efficacy outcomes, exploratory analyses were performed using whole-exome sequencing and RNA sequencing. Nivolumab-based therapies demonstrated improved efficacy versus chemotherapy in hypermutated and, to a lesser degree, Epstein Bar Virus-positive tumors compared with chromosomally unstable and genomically stable tumors. Within the KRAS-altered subgroup, only patients treated with nivolumab-plus-chemotherapy demonstrated improved OS benefit versus chemotherapy. Low stroma gene expression signature scores were associated with OS benefit with nivolumab-based regimens; high regulatory T-cell signatures were associated with OS benefit only with nivolumab-plus-ipilimumab. Our analyses suggest that distinct and overlapping pathways contribute to the efficacy of nivolumab-based regimens in gastroesophageal adenocarcinoma.

  Study EGAS50000000747

• High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Molecular characterization of high-grade B-cell lymphoma, not otherwise specified (HGBCL-NOS), is hindered by its rarity, evolving definition, and poor diagnostic reproducibility. To address this challenge, we analyzed 92 HGBCL-NOS tumors collected across Lymphoma/Leukemia Molecular Profiling Project sites. These tumors were profiled using whole-genome sequencing (WGS) or whole-exome sequencing (WES) to identify somatic mutations, WGS or low-pass WGS to detect copy number alterations, targeted capture sequencing to assess MYC and BCL2 structural variants, and RNA sequencing. The genetic features of HGBCL-NOS were compared to those of diffuse large B-cell lymphoma (DLBCL-NOS) and EBV-negative adult Burkitt lymphoma (BL). DLBCL-NOS tumors underwent targeted capture sequencing using a panel of 125 genes recurrently mutated in aggressive B-cell lymphomas. BL biopsies were drawn from the Burkitt Lymphoma Genome Sequencing Project and had available WGS (dbGaP Study Accession: phs000527.v18.p6).

  Study EGAS50000000932

• Pooled Mutant KRAS-Targeted Long Peptide Vaccine Combined with Nivolumab and Ipilimumab for Patients with Resected MMR-p Colorectal and Pancreatic Cancer

  We developed INtraCEllular Reverse Transcription with Sorting and sequencing (INCERTS), an approach to combine molecular indexing of receptor repertoires within intact cells and fluorescence-activated cell sorting (FACS). We demonstrate that INCERTS enables efficient processing of millions of cells from pooled human peripheral blood mononuclear cell (PBMC) samples while retaining robust association between T cell receptor (TCR) sequences and cellular phenotypes. We used INCERTS to discover antigen-specific TCRs from patients with cancer immunized with a novel mutant KRAS peptide vaccine. After ex vivo stimulation, 28 uniquely barcoded samples were pooled prior to FACS into peptide-reactive and non-reactive CD4+ and CD8+ populations. Combining complementary patient-matched single-cell RNA sequencing (scRNA-seq) data enabled retrieval of full-length, paired TCR alpha and beta chain sequences for future validation of therapeutic utility. Data available through dbGaP include scRNA-seq with matched TCR-seq.

  Study phs003425

• Single Cell Transcriptional Analysis of Human Adenoids Identifies Molecular Features of Airway Microfold Cells

  We aimed to characterize the cellular composition and molecular features of the human adenoid, a mucosa-associated lymphoid tissue located in the upper airway, with a focus on epithelial populations involved in immune surveillance. To this end, we performed single-nucleus RNA sequencing (snRNA-seq) on adenoid tissue obtained from 6 human donors (age 2 – 14; 3 males and 3 females) undergoing routine adenoidectomy. The donor cohort includes clinically annotated samples with no known immunodeficiency or chronic airway disease.Our analysis uncovered distinct epithelial populations, including transcriptionally defined immature and mature microfold (M) cells, and a previously unrecognized interferon-stimulated epithelial population enriched for antiviral response genes, which we term WISP cells (Waldeyer's ring Interferon-Stimulated Population). We validated key transcriptomic findings through multiplex immunofluorescence microscopy in independent donor tissues, confirming the spatial localization of WISP and M cells and their predicted interactions with specific immune subsets.

  Study phs004103

• Parent-of-origin dependent DNA methylation and gene expression in the human placenta

  DNA methylation is globally reprogrammed after fertilization and the parental genomes have similar DNA methylation profiles after implantation except at the germline differentially methylated regions (gDMRs). We, and others, have previously shown that there are a large number of transient gDMRs in human blastocysts, whose differential methylation is lost in embryonic tissues after implantation. In this study we employed genome-wide allelic DNA methylation analyses of highly purified trophoblast cells from human placentas. ~40% of the transient-in-embryo gDMRs maintained their parent-of-origin-dependent biased allelic methylation. RNA sequencing-based allelic expression analyses revealed that some of the placental-specific gDMRs were associated with novel imprinted genes. This approach identified the first examples of X-linked gDMRs specific to the placenta. These findings highlight the unique regulation of allelic DNA methylation in the human placenta, which is important for understanding normal placental development and the pathogenesis of pregnancy complications.

  Study JGAS000038

• Adjuvant nivolumab in resected esophageal or gastroesophageal junction cancer: exploratory biomarker analyses from CheckMate 577

  Adjuvant nivolumab demonstrated a significant improvement in disease-free survival (DFS; primary endpoint) versus placebo in patients with resected esophageal or gastroesophageal junction cancer and residual pathologic disease following neoadjuvant chemoradiotherapy (CRT) in the phase III CheckMate 577 study, leading to global approval and widespread adoption. Exploratory biomarker analyses were performed using whole-exome sequencing, RNA sequencing, and immunohistochemistry. Hazard ratios for DFS favored nivolumab versus placebo in patients with higher inflammation and proliferation gene expression signature scores; lower M2 macrophage, endothelial, and stromal GES scores; and higher densities of CD3+/CD8- T cells and natural killer cells. Assessments of pre-CRT and post-CRT tumor tissue found post-CRT increases in programmed death ligand 1 combined positive score in 51% of patients, which appeared to be associated with greater DFS benefit. Through these analyses, we identified patient subpopulations that appear to derive improved DFS benefit from adjuvant nivolumab in this setting.

  Study EGAS50000001663

• Epigenomics and Single-cell Sequencing Define a Developmental Hierarchy in Langerhans Cell Histiocytosis

  Langerhans cell histiocytosis (LCH) is a rare neoplasm predominantly affecting children. It occupies a hybrid position between cancers and inflammatory diseases, and it provides an attractive model for studying cancer development. To explore the molecular mechanisms underlying the pathophysiology of LCH and its characteristic clinical heterogeneity, we investigated the transcriptomic and epigenomic diversity in primary LCH lesions. Using single-cell RNA sequencing, we identified multiple recurrent types of LCH cells within these biopsies, including putative LCH progenitor cells and several subsets of differentiated LCH cells. We confirmed the presence of proliferative LCH cells in all analysed biopsies using immunohistochemistry, and we defined an epigenomic and gene-regulatory basis of the different LCH cell subsets by chromatin accessibility profiling. In summary, our single-cell analysis of LCH uncovered an unexpected degree of cellular, transcriptomic, and epigenomic heterogeneity among LCH cells, indicative of complex developmental hierarchies in LCH lesions.

  Study EGAS00001003822

• Improving CLL Vγ9Vδ2-T cell fitness for cellular therapy by ex vivo activation and ibrutinib

  We studied whether Vγ9Vδ2-T cells can exploited as autologous effector lymphocytes in chronic lymphocytic leukemia (CLL). Healthy controls (HC) Vγ9Vδ2-T cells were activated by and had potent cytolytic activity against CLL cells, however CLL-derived Vγ9Vδ2-T cells proved dysfunctional with respect to effector cytokine production and cytotxicity. Dysfunction of Vγ9Vδ2-T cells was reversible upon activation with autologous monocyte-derived dendritic cells (mODCs). RNA sequencing confirmed that Vγ9Vδ2-T cells from CLL patients have a transcriptional profile that is distinct from HC Vγ9Vδ2-T cells prior to ex vivo expansion, although the profile after ex vivo expansion is similar between CLL and HC Vγ9Vδ2-T cells. Gene expression profiling implicated alterations in both synapse formation and exhaustion as conceivable contributors to compromised Vγ9Vδ2-T cell function in CLL patients. Taken together, CLL-mediated dysfunction of autologous Vγ9Vδ2-T cells is fully reversible, resulting in potent cytotoxicity towards CLL cells.

  Study EGAS00001003193

• A spatiotemporal organ-wide gene expression and cell atlas of the developing human heart

  The process of cardiac morphogenesis in humans is incompletely understood. Its full characterization requires a deep exploration of the organ-wide orchestration of gene expression with a single-cell spatial resolution. Here, we present a molecular approach that reveals the comprehensive transcriptional landscape of cell types populating the embryonic heart at three developmental stages, and which maps cell type-specific gene expression to specific anatomical domains. Spatial Transcriptomics identified unique gene profiles corresponding to distinct anatomical regions in each developmental stage. Human embryonic cardiac cell types identified by single-cell RNA-sequencing confirmed and enriched the spatial annotation of embryonic cardiac gene expression. In situ sequencing was then used to refine these results and create spatial subcellular map for the three developmental phases. Finally, we generated a publicly available web resource of the human developing heart to facilitate future studies on human cardiogenesis.

  Study EGAS00001003996

• Comprehensive Genomic and Transcriptomic Analysis of Rare Cancers for Guiding of Therapy (H021)

  Here we analyzed the molecular profiles and clinical outcomes of 1,310 patients (proportion of rare cancers, 75%) enrolled in a prospective observational study by the German Cancer Consortium that applies whole-genome/exome and RNA sequencing to inform the care of adults with incurable cancers. Based on 472 single and six composite biomarkers, a cross-institutional molecular tumor board provided evidence-based management recommendations, including diagnostic reevaluation, genetic counseling, and experimental treatment, in 88% of cases. Recommended therapies were administered in 362 of 1,138 patients (31.8%) and resulted in significantly improved response and disease control rates (23.9% and 55.3%, respectively) compared to previous therapies, translating into a progression-free survival ratio >1.3 in 35.7% of patients.

  Study EGAS00001004813

• The Acquisition of Molecular Drivers in Pediatric Therapy-Related Myeloid Neoplasms

  Pediatric therapy-related myeloid neoplasms (tMN) occur in children after exposure to cytotoxic therapy and have a dismal prognosis1-4. The somatic and germline genomic alterations that drive these myeloid neoplasms in children and how they arise have yet to be comprehensively described. We use whole exome, whole genome, and/or RNA sequencing to characterize the genomic profile of 85 pediatric tMN cases (tMDS: n=29, tAML: n=56). Our data show that Ras/MAPK pathway mutations, alterations in RUNX1 or TP53, and KMT2A rearrangements are frequent somatic drivers, and we identify cases with aberrant MECOM expression secondary to enhancer hijacking. Unlike adults with tMN5-7, we find no evidence of pre-existing minor tMN clones (including those with TP53 mutations), but rather the majority of cases were unrelated clones arising as a consequence of cytotoxic therapy. These studies also uncover rare cases of lineage switch disease rather than true secondary neoplasms.

  Study EGAS00001004850

• Genomic landscape and PD-1 blockade in Natural-killer/T cell lymphoma

  Natural killer/T-cell lymphoma (NKTL) is an aggressive malignancy with a predilection for Asian, Mexican and South American populations. With the exception of Japan, it is the most common mature T-cell lymphoma in Asia. NKTL presents as extranodal disease and mostly affects the upper aerodigestive tract. Neoplastic cells are invariably infected by the Epstein-Barr virus (EBV) and characterized by a cytotoxic phenotype. The genetic landscape of NKTL has been recently unraveled by discoveries describing recurring mutations altering the JAK-STAT pathway, epigenetic modifiers, the DDX3X gene and genetic predisposition in the HLA-DPB1 gene.The genomic landscape of NKTL has been interrogated by whole-exome sequencing, targeted sequencing and single nucleotide polymorphism arrays, but has yet been studied with whole-genome sequencing (WGS). In this study, we will use a combination of WGS, targeted-capture sequencing (TCS) and RNA sequencing data to explore the genetic landscape and its relevance to immunotherapy in NKTL

  Study EGAS00001003828

• Integrative molecular analysis of pediatric Anaplastic large cell lymphoma reveals subtypes with distinct immune suppression signatures.

  Anaplastic large cell lymphoma (ALCL) is a peripheral T-cell lymphoma accounting for 10–15% of all childhood lymphomas. While more than 90% of the ALCL cases contain ALK-rearrangement, these tumors possess significant inter-tumor molecular heterogeneity that contributes to distinct morphologic differences and clinical impact. To gain insight into the molecular heterogeneity within ALK+ ALCL, we performed whole-exome sequencing, RNA-sequencing, and methylome analysis of 42 primary pediatric ALK+ ALCL patients. Our data showed that ALK+ALCLs was subclassified into two subtypes based on ALK gene expression, methylation profiles, and somatic mutation patterns. ALK-low samples had more highly methylated gene regions while enriched with immune infiltration. ALK-high samples were enriched with somatic copy number alteration and high expression of MYC and PD-L1. These data indicate that ALK expression, somatic mutations, and aneuploidy status are negatively associated with immune infiltration, stipulating that ALK expression status might be associated with resistance to immune checkpoint inhibitors.

  Study EGAS00001004189

• Myoepithelial progenitors as founder cells of hyperplastic human breast lesions upon PIK3CA transformation

  The myoepithelial (MEP) lineage of human breast comprises bipotent and multipotent progenitors in ducts and terminal duct lobular units (TDLUs). We here assess whether this heterogeneity impacts on oncogenic PIK3CA transformation. Single cell RNA sequencing (scRNA-seq) and multicolor imaging reveal that terminal ducts represent the most enriched source of cells with ductal MEP markers including a-smooth muscle actin (a-SMA), keratin K14, K17 and CD200. Furthermore, we find neighboring CD200high and CD200low progenitors within terminal ducts. When sorted and kept in ground state conditions, their CD200low and CD200high phenotypes are preserved. Upon differentiation, progenitors remain multipotent and bipotent, respectively. Immortalized progenitors are transduced with shp53 and mutant PIK3CA. Upon transplantation, CD200low MEP progenitors distinguish from CD200high by the formation of multilayered structures with a hyperplastic inner layer of luminal epithelial cells. We suggest a model with spatially distributed MEP progenitors as founder cells of biphasic breast lesions with implications for early detection and prevention strategies.

  Study EGAS00001005933

• SARS‐CoV‐2 receptor ACE2 and TMPRSS2 are primarily expressed in bronchial transient secretory cells

  The SARS‐CoV‐2 pandemic affecting the human respiratory system severely challenges public health and urgently demands for increasing our understanding of COVID‐19 pathogenesis, especially host factors facilitating virus infection and replication. SARS‐CoV‐2 was reported to enter cells via binding to ACE2, followed by its priming by TMPRSS2. Here, we investigate ACE2 and TMPRSS2 expression levels and their distribution across cell types in lung tissue (twelve donors, 39,778 cells) and in cells derived from subsegmental bronchial branches (four donors, 17,521 cells) by single nuclei and single cell RNA sequencing, respectively. While TMPRSS2 is strongly expressed in both tissues, in the subsegmental bronchial branches ACE2 is predominantly expressed in a transient secretory cell type. Interestingly, these transiently differentiating cells show an enrichment for pathways related to RHO GTPase function and viral processes suggesting increased vulnerability for SARS‐CoV‐2 infection. Our data provide a rich resource for future investigations of COVID‐19 infection and pathogenesis.

  Study EGAS00001004419

• The Proteogenomic Subtypes of Acute Myeloid Leukemia

  Acute myeloid leukemia (AML) is an aggressive blood cancer with poor prognosis. We report a comprehensive proteogenomic analysis of bone-marrow biopsies from 252 uniformly treated AML patients to elucidate the molecular pathophysiology of AML in order to inform future diagnostic and therapeutic approaches. In addition to in-depth quantitative proteomics, our analysis includes cytogenetic profiling and DNA/RNA sequencing. We identify five proteomic AML subtypes, each reflecting specific biological features spanning genomic boundaries. Two of these proteomic subtypes correlate with patient outcome, but none are exclusively associated with specific genomic aberrations. Remarkably, one subtype (Mito-AML), which is only captured in the proteome, is characterized by high expression of mitochondrial proteins and confers poor outcome, with reduced remission rate and shorter overall survival upon treatment with intensive induction chemotherapy. Functional analyses reveal that Mito-AML is metabolically wired towards stronger complex I dependent respiration and is more responsive to treatment with the BCL2 inhibitor venetoclax.

  Study EGAS00001005950

• Resolving the immune landscape of human prostate at a single cell level in health and cancer

  The prostate gland produces prostatic fluid, high in zinc and citrate and essential for the maintenance of spermatozoa. Prostate cancer is a common condition with limited treatment efficacy in castration-resistant metastatic disease, including with immune checkpoint inhibitors. We used single-cell RNA-sequencing to perform an unbiased assessment of the cellular landscape of human prostate and identified a previously unappreciated subset of tumour-enriched androgen receptor-negative luminal epithelial cells, with increased expression of cancer-associated genes. We also found a variety of innate and adaptive immune cells in normal prostate that were transcriptionally perturbed in prostate cancer. An exception was a unique, prostate-specific, zinc transporter-expressing macrophage population (MAC-MT), that contributed to tissue zinc accumulation in homeostasis, but showed enhanced inflammatory gene expression in tumours, including T cell-recruiting chemokines. Remarkably, enrichment of the MAC-MT signature in cancer biopsies was associated with improved disease-free survival, suggesting beneficial anti-tumour functions.

  Study EGAS00001005787

• Molecular Profiling Reveals Unique Immune and Metabolic Features of Melanoma Brain Metastases

  There is a critical need to improve our understanding of the pathogenesis of -melanoma brain metastases (MBM). Thus, we performed RNA sequencing on 88 resected MBMs and 42 patient-matched extracranial metastases; tumors with sufficient tissue also underwent whole-exome sequencing, T-cell receptor sequencing, and IHC. MBMs demonstrated heterogeneity of immune infiltrates that correlated with prior radiation and post-craniotomy survival. Comparison with patient-matched extracranial metastases identified significant immunosuppression and enrichment of oxidative phosphorylation (OXPHOS) in MBMs. Gene-expression analysis of intracranial and subcutaneous xenografts, and a spontaneous MBM model, confirmed increased OXPHOS gene expression in MBMs, which was also detected by direct metabolite profiling and [U-13C]-glucose tracing in vivo IACS-010759, an OXPHOS inhibitor currently in early-phase clinical trials, improved survival of mice bearing MAPK inhibitor-resistant intracranial melanoma xenografts and inhibited MBM formation in the spontaneous MBM model. The results provide new insights into the pathogenesis and therapeutic resistance of MBMs.

  Study EGAS00001003672

• Adult human kidney organoids originate from CD24+ cells and represent an advanced model for adult polycystic kidney disease

  Adult kidney organoids have been described as strictly tubular epithelial and termed tubuloids. While the cellular origin of tubuloids has remained elusive, here we report that they originate from a distinct CD24+ epithelial subpopulation. Long-term-cultured CD24+-derived tubuloids represent a functional human kidney tubule. We show that kidney tubuloids can be used to model the most common inherited kidney disease, namely autosomal dominant polycystic kidney disease (ADPKD), reconstituting the phenotypic hallmark of this disease with cyst formation. Single-cell RNA sequencing of CRISPR/Cas9 gene-edited PKD1 and PKD2 knockout tubuloids and human ADPKD and control tissue show similarities in upregulation of disease-driving genes. Furthermore, in a proof of concept, we demonstrate that tolvaptan, the only approved drug for ADPKD, shows a significant effect on cyst size in tubuloids but no effect in a pluripotent-stem-cell-derived model. Thus, tubuloids derive from a tubular epithelial subpopulation and represent an advanced model for ADPKD disease modeling.

  Study EGAS00001006551

• A longitudinal single-cell atlas of treatment response in pediatric AML

  Pediatric acute myeloid leukemia (pAML) is a disease characterized by heterogeneous cellular composition, driver alterations and prognosis. Characterization of this heterogeneity and how it affects treatment response remains relatively understudied in pediatric patients. We therefore used single-cell RNA sequencing and single-cell ATAC sequencing to profile 684,031 diagnosis, remission and relapse cells from 28 patients representing different pAML subtypes. Analysis revealed that at diagnosis, cellular compositions differed between distinct subgroups. Upon relapse, cellular hierarchies transitioned towards a more primitive state regardless of subtype. These primitive cells were distinct compared to cells at diagnosis, having underrepresentation of transcriptional programs involved in myeloid differentiation while programs commonly found in other lineages were overrepresented. In a subset of patients, this appeared to accompany the appearance of a B-lymphoid-like hierarchy. Together, our data reveal the emergence of apparent subtype-specific plasticity upon treatment and inform on potential novel therapeutic angles to target these cell populations.

  Study EGAS00001007323

• Pediatric Patient-Derived-Xenograft development in MAPPYACTS – international pediatric cancer precision medicine trial in relapsed and refractory tumors

  Pediatric patients with recurrent and refractory cancers are in most need for new treatments. This study developed patient-derived-xenograft (PDX) models within the European MAPPYACTS cancer precision medicine trial (NCT02613962). To date, 131 PDX models were established following heterotopical and/or orthotopical implantation in immunocompromised mice: 76 sarcomas, 25 other solid tumors, 12 central nervous system tumors, 15 acute leukemias, and 3 lymphomas. PDX establishment rate was 43%. Histology, whole exome and RNA sequencing revealed a high concordance with the primary patient’s tumor profile, human leukocyte-antigen characteristics and specific metabolic pathway signatures. A detailed patient molecular characterization, including specific mutations prioritized in the clinical molecular tumor boards are provided. Ninety models were shared with the IMI2 ITCC Paediatric Preclinical Proof-of-concept Platform (IMI2 ITCC-P4) for further exploitation. This new PDX biobank of unique recurrent childhood cancers provides an essential support for basic and translational research and new treatments development in advanced pediatric malignancies.

  Study EGAS00001007327

• Whole transcriptome RNA sequencing as comprehensive diagnostic tool for acute myeloid leukemia.

  BackgroundAcute myeloid leukemia (AML) is characterized by uncontrolled proliferation of malignant hematopoietic cells in the bone marrow that are arrested in differentiation. In AML pathogenesis, hematopoietic progenitor cells acquire multiple genetic aberrations often occurring in the same set of genes that ultimately lead to malignant transformation. In the WHO classification 2016, six AML classes with different prognosis are identified by chromosomal translocations measured by standard cytogenetics. All balanced translocations produce fusion genes, except for t(3;3)/inv(3;3), which lead to overexpression of MECOM/EVI1 associated with poor prognosis. For accurate risk assessment of cytogenetically normal AML, four genes need to be screened to distinguish AML with mutated NPM1 in the absence of FLT3 mutations and AML with bi-allelic CEBPA mutations, which have a favorable prognosis, and AML with RUNX1 mutations which have a poor prognosis. Recently, a full genomic classification system has been proposed by Papaemmanuil et al. (NEJM 2016). In this system, the same six classes with chromosomal translocations are identified by standard cytogenetics as well as five additional classes characterized by genetic mutations in 14 different genes. AimThe aim of the study was to investigate whether whole transcriptome RNA-sequencing (RNAseq) can be used as single technology for classification of AML. MethodA panel of 100 AML were analyzed and a bio-informatics pipeline called HAMLET (Human AML Expedited Transcriptomics) was developed in which 4 modules are integrated to detect (1) fusion genes, (2) small variants in 13 recurrently mutated genes, (3) internal tandem duplications in FLT3 (FLT3-ITD) and partial tandem duplications in KMT2A (KMT2A-PTD) and (4) overexpression of MECOM/EVI1. All mutations that were called by HAMLET were validated by diagnostic data as available for all 100 AML or targeted PCR followed by Sanger or next generation sequencing on all positive AML and at least an equal number of negative cases. Results & discussionThe data showed that HAMLET accurately identified all genetic aberrations with high sensitivity and specificity. In addition, in 7 AML, fusion transcripts were detected that are not measured by standard cytogenetics including three cases that lack any class-defining lesion according to Papaemmanuil et al. Moreover, overexpression of MECOM/EVI1 was detected in two AML with inv(3) as well as in five cases without inv(3)/t(3;3), and a gene signature was measured to distinguish AML with CEBPA mutations with favorable prognosis. In conclusion, HAMLET provides a comprehensive and flexible pipeline for RNAseq analysis to retrieve all relevant information for current classification of AML as well as additional information that may improve classification in the future.

  Study EGAS00001003096

• BLUEPRINT RNA-seq of Epigenetic programming during monocyte to macrophage differentiation and trained innate immunity

  Monocyte differentiation into macrophages represents a cornerstone process for host defense. Concomitantly, immunological imprinting of either tolerance or trained immunity determines the functional fate of macrophages and susceptibility to secondary infections. Transcriptomes and epigenomes in four primary cell types: monocytes, in vitro differentiated naïve, tolerized and trained macrophages were characterized. Inflammatory and metabolic pathways were modulated in macrophages, including decreased inflammasome activation, and pathways functionally implicated in trained immunity were identified. Strikingly, β-glucan training elicits an exclusive epigenetic signature, revealing a complex network of enhancers and promoters. Analysis of transcription factor motifs in DNase I hypersensitive sites at cell-type specific epigenetic loci unveiled differentiation and treatment specific repertoires. Altogether, this study provides a resource to understand the epigenetic changes that underlie innate immunity in humans.

  Study EGAS00001000953

• Epigenomes and Transcriptomes of Brain Samples of Schizophrenics and Controls

  We examined the effects of antipsychotic medications on the cell-specific epigenomics and transcriptomics in the frontal cortex of schizophrenic subjects. We performed ChIP-seq (H3K4me3 and H3K27ac) and RNA-seq on neuronal and non-neuronal nuclei of postmortem frontal cortex samples from two cohorts of schizophrenics, either previously treated or not with antipsychotic medications, and control subjects individually matched by sex and age. In total, we tested 29 schizophrenics (15 untreated and 14 treated patients) and their matched control samples. Two replicates were produced on each brain sample for each assay. ChIP-seq data were generated using MOWChIP-seq (Zhu et al., PMID: 31666743) and RNA-seq data were produced using the combination of SMART-seq2 (Picelli et al., PMID: 24385147) and a Nextera XT DNA library preparation kit. The filename contains the information on the experimental group, the number of the sample within the group, the type of the brain nuclei, the epigenomic/transcriptomic data set (either H3K27ac or mRNA), and the number of replicate. For example, “SCZ-1-untreated-neuron-H3K4me3-R1” refers untreated schizophrenic sample #1, replicate 1 ChIP-seq data on H3K4me3.

  Study phs002487

• Experimental PfSPZ Vaccine in Adults Without Malaria

  The study was performed to evaluate whole-blood transcriptomic profiles via RNA-seq before, during, and after immunization with the PfSPZ Vaccine in malaria-naïve, healthy adults enrolled in VRC 312 (NCT01441167). VRC 312 was the second study of the PfSPZ Vaccine and the first study to evaluate intravenous (IV) administration of this vaccine. The study was an open-label evaluation of the safety, tolerability, immunogenicity, and protective efficacy of the vaccine at successively higher administered by the IV route. The highest dosages were evaluated for protection against a malaria challenge after 4 to 6 vaccinations. The primary objectives of the study were related to the safety and tolerability of the vaccine at the 4 different dosage levels when administered IV; the secondary objectives were related to PfSPZ vaccine-mediated protection against Plasmodium falciparum (Pf) challenge at the 3 higher dosage levels, and the exploratory objectives were related to the immunogenicity of the PfSPZ Vaccine and defining an immune correlate of protection. To further determine potential molecular correlates of immunogenicity and/or protection, RNA-seq was performed on whole blood collected from subjects in all dose groups at time points before, during, and after immunization.

  Study phs002422

• Cholesterol and Pharmacogenetics (CAP) Study

  The Cholesterol and Pharmacogenetics Study was a 6-week open label, non-randomized study of 40mg/day simvastatin treatment in 335 black and 609 white (944 total) men and women. Plasma lipids and lipoproteins were measured on two occasions prior to treatment and at 4 and 6 weeks of treatment. The study was designed to test for genetic associations with baseline measurements and changes in response to simvastatin treatment. Whole genome genotyping was performed on 592 white CAP study participants in two stages. In Stage 1, 304 were genotyped for 314,621 SNPs to tag for common genomic variation. In Stage 2, 290 participants were genotyped, including 280 who were genotyped for 620,901 SNPs. Two samples were excluded due to gender discrepancies. More recently, CAP self-reported black participants were genotyped on Illumina Omni2.5Exome chips. PolyA-selected strand-specific RNA-seq libraries were generated in several batches from lymphoblastoid cell lines (LCLs) derived from 268 white and 165 black CAP participants. The LCLs were exposed to sham buffer (control) or 2 uM activated simvastatin for 24 hours, producing a total of 866 100/101 bp paired end RNA-seq libraries sequenced on Illumina HiSeq 2000 machines.

  Study phs000481

• Functional Enhancer Elements Drive Subclass-Selective Expression From Mouse to Human Neocortex

  A complete epigenomic map of human brain cell types will be necessary to fully understand their genetic regulation, and to create the next generation of non-species-restricted genetic tools for their functional characterization. Here we performed both bulk and single-nucleus ATAC-seq studies of fresh human neocortical samples excised during neurosurgery, in order to discover the functional genomic elements that discriminate cell types. This dataset contains 78 bulk layer-dissected ATAC-seq samples, and 3660 single-nucleus ATAC-seq samples from fresh acutely isolated human neurosurgical samples. Furthermore, from these data we identified and validated several enhancers for use in AAV context. We also provide validation single cell RNA-seq for 456 human acutely labeled neurosurgical neurons labeled by 3 unique enhancer-AAV vectors, and single cell RNA-seq for 1483 mouse neurons labeled in vivo by 11 unique enhancer-AAV vectors. Together these datasets provide high-resolution maps of single human neocortical cell types, as well as proof of the functional utility of the genomic elements discovered. As a whole these data will be important to furnish the next generation of cell type-specific functional tools and therapies in neuroscience.  

  Study phs002292

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Acetalax and bisacodyl triple-negative breast cancer RNA-Seq

  Analysis of gene expression in triple negative breast cancer xenografts exhibiting good or bad response upon acetalax and bisacodyl treament.

  Study EGAS50000000618

• Sequence data of 28 Samples (19 chronic lymphocytic leukemia, 9 control)

  Sequence data of 28 Samples (19 chronic lymphocytic leukemia, 9 control) Including RNA-Seq and ChIP-Seq of following histone modifications: H3, H3K4me1, H3K4me3, H3K9ac, H3K9me3, H3K27ac, H3K27me3, H3K36me3 Project see: http://www.cancerepisys.org/

  Dataset EGAD00001003421

• Mapping Systemic Lupus Erythematosus Heterogeneity at the Single Cell Level

  Patients with Systemic Lupus Erythematosus (SLE) display a complex blood transcriptome whose cellular origin is poorly resolved. Using single-cell RNA-seq, we profiled ~276,000 PBMCs from 33 children with SLE (cSLE) with different degrees of disease activity (DA) and 11 matched controls. Increased expression of Interferon-stimulated genes (ISGs) distinguished cSLE from healthy control cells. The high-ISG expression signature (ISGhi) derived from a small number of transcriptionally defined subpopulations within major cell types, including monocytes, CD4+ and CD8+ T cells, NK cells, cDCs, pDCs, B cells and especially plasma cells. Expansion of unique subpopulations enriched in ISGs and/or in monogenic Lupus-associated genes classified patients with the highest DA. Profiling of ~82,000 single PBMCs from adult SLE patients confirmed the expansion of similar subpopulations in patients with the highest DA. This study lays the groundwork for resolving the origin of the SLE transcriptional signatures and the disease heterogeneity towards precision medicine applications. Patient demographics, clinical and laboratory data and treatment are summarized and available. The genomic data for participant aHD2 will not be included in the dataset The study description is reprinted from Nehar-Belaid et. al. Nature Immunology, 2020, with permission from Nature Immunology Group

  Study phs002048

• Single cell transcriptomic landscape of pediatric B-cell acute lymphoblastic leukemia: dissection of transcriptional heterogeneity and B-cell developmental state

  Introduction: Genomic analyses of bulk ALL samples have improved our understanding of the genetic basis and risk stratification of B-ALL, but do not directly examine intratumor heterogeneity or enable inference of leukemia developmental state and cell of origin. Methods: We profiled 89 B-ALL samples by single-cell RNA-seq (scRNA-seq) (10X Genomics 5’v2) and compared them to a scRNA-seq reference map of normal human B-cell development. Results: Analysis of heterogeneity of inferred DNA copy number alterations at single cell level showed that aneuploid ALL with near haploidy and hyperdiploid harbor chromosomal losses or gains in all blasts, consistent with early, synchronous origin rather than sequential accumulation. Intra-sample heterogeneity was driven by five gene expression signatures: cell cycle, metabolism, differentiation, inflammation, refining leukemic subtyping. An atlas of B cell development was established to map B-ALL samples to specific developmental states. Hyperdiploid samples resembled pro-B cells, while MEF2D-r and TCF3::PBX1 showed high pre-B abundance. Patients with high early lymphoid abundance had poorer outcomes. Conclusions: Understanding variation in transcriptional programs and developmental states of B-ALL blasts by sc transcriptome refines existing clinical and genomic classifications and provides novel prognostic markers.

  Study EGAS00001007512

• RNAseq data to study PRPF6 regulated splice forms in colon cancer cell lines

  Alternative splicing plays critical roles in differentiation, development, and cancer (Pettigrew et al., 2008; Chen and Manley, 2009). The recent identification of specific spliceosome inhibitors has generated interest in the therapeutic potential of targeting this cellular process (van Alphen et al., 2009). Using an integrated genomic approach, we have identified PRPF6, an RNA binding component of the pre-mRNA spliceosome, as an essential driver of oncogenesis in colon cancer. Importantly, PRPF6 is both amplified and overexpressed in colon cancer, and only colon cancer cells with high PRPF6 levels are sensitive to its loss. Our data clearly point to an important role for PRPF6 in colon cancer growth and suggest that a better understanding of its role in alternative splicing in colon cancer is warranted. To determine the specific alternative splice forms that PRPF6 regulates in colon cancer, we plan three experiments: 1. The first involves knocking down expression of PRPF6 in two different cancer cell lines with 3 different siRNAs, and then completing RNA-seq to determine the gene expression changes that occur relative to a non-targeting control siRNA. Because of the role for PRPF6 in pre-mRNA splicing, we especially want to quantify the changes in splice-specific forms of all genes genome-wide to identify genes whose splicing is altered upon PRPF6 knockdown. 2. The second involves immunoprecipitating PRPF6 from two different cancer cell lines and isolating any RNA that is bound to PRPF6, since PRPF6 is an RNA-binding protein. We then want to carry out RNA-seq to identify which RNA molecules co-immunoprecipitated with PRPF6. This will help us determine possible functions for PRPF6 in regulating colon cancer growth. 3. The third involves overexpressing PRPF6 in cell lines and then carrying out RNA-seq to identify any changes in splice-specific gene expression. This will allow us to determine whether increased PRPF6 expression is sufficient to drive alternative splicing changes.

  Study EGAS00001000761

• Tumor-reactive heterotypic CD8 T cell clusters from clinical samples

  Emerging evidence suggests a correlation between CD8+ T cell-tumor cell proximity and anti-tumor immune response. However, it remains unknown whether these cells exist as functional clusters that can be isolated from clinical samples. By conventional and imaging flow cytometry, we show here that from 21/21 human melanoma metastases, we could isolate heterotypic clusters, comprising CD8+ T cells interacting with one or more tumor cells and/or antigen-presenting cells (APCs). Single-cell RNA-sequencing revealed that T cells from clusters were enriched for gene signatures associated with tumor reactivity and exhaustion. Clustered T cells exhibited increased TCR clonality indicative of expansion, while TCR-matched T cells showed more exhaustion and co-modulation when conjugated to APCs than to tumor cells. T cells that were expanded from clusters ex vivo exerted on average 9-fold increased killing activity towards autologous melanomas, which was accompanied by enhanced cytokine production. Upon adoptive cell transfer into mice, T cells from clusters showed improved patient-derived melanoma control, which was associated with increased T cell infiltration and activation. Together, these results demonstrate that tumor-reactive CD8+ T cells are enriched in functional clusters with tumor cells and/or APCs and that they can be isolated and expanded from clinical samples. Typically excluded by single cell gating in flow cytometry, these distinct heterotypic T cell clusters serve as a valuable source to decipher functional tumor-immune cell interactions, while they may also be therapeutically explored.

  Study EGAS50000000785

• Single_cell_characterization_of_T_cell_lymphoma_

  Lymphomas are types of blood cancer derived from lymphocytes, and can be classified into two main categories, Hodgkin's lymphomas (HL) and non-Hodgkin lymphomas (NHL). T-cell lymphoma is a type of NHL that develops from T lymphocytes and accounts for 10-15% of total NHL cases. As a rare disease, T-cell lymphoma is functionally, pathologically, and clinically complex and heterogeneous. The 2016 revision of the WHO classification has listed 29 subtypes of mature T/NK-cell neoplasms, among which over 25 are T lymphocyte in origin. These subtypes of T-cell lymphomas have different biological behaviours and clinical prognosis. Clinically, T-cell lymphoma ranges from indolent (slow-growing) to aggressive (fast-growing and spreading) disease. According to the guideline booklet provided by the Lymphoma Research Foundation (https://lymphoma.org/aboutlymphoma/nhl/), indolent T-cell lymphoma subtypes include adult T-cell leukaemia/lymphoma (ATLL), cutaneous T-cell lymphoma (CTCL), and mycosis fungoides (MF), while the aggressive subtypes include anaplastic large cell lymphoma (ALCL), angioimmunoblastic T-cell lymphoma (AITL), peripheral T-cell lymphoma (PTCL), and T lymphoblastic lymphoma (TLBL). PTCL and ALCL represent the most common subtypes of aggressive T-cell lymphoma whereas TLBL is a rare and aggressive subtype mostly diagnosed in children. In this study, we will use single cell RNA sequencing and single cell multiomic methods three aggressive T-cell lymphoma subtypes (ALCL, PTCL and TLBL) and try to gain a deeper insight into the genotypic and phenotypic features of these T-cell lymphomas.

  Study EGAS00001005750

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Breast Cancer Genome Guided Therapy Study (BEAUTY)

  The Breast Cancer Genome Guided Therapy Study (BEAUTY) is a prospective neoadjuvant clinical study enrolling 140 women with Stage I-III breast cancer. The goals of this study were to 1) perform comprehensive sequencing of germline and tumor tissues (exome and RNA seq), 2) identify genomic alterations and perturbed pathways associated with response/resistance to standard chemotherapy, and 3) develop patient-derived xenograft (PDX) for testing of therapeutic regimens chosen on the basis of alterations identified by genetic sequencing.

  Study phs001050

• Modulation of Lung Immune Responses to Viral Infection-Microbiome Interactions with Respiratory Organoids

  Here, we colonized bronchial epithelial air-liquid interface tissue cultures with 58 different individual microbes. Following 18 and 48 hours of colonization, we performed bulk RNA-seq of the host epithelial cells (n=3). Overall, we found significant microbial species-level and strain-level variation in host gene expression changes for innate immunity and epithelial barrier genes. Of particular interest, we found significant heterogeneity in stimulation of host interferon and antiviral interferon-stimulated genes.Study registered in ImmPort under accession # SDY2281.

  Study phs003627

• Spatial heterogeneity, stromal phenotypes, and therapeutic vulnerabilities in colorectal cancer peritoneal metastasis

  Peritoneal metastases (PM) in colorectal cancer (CRC) portend a poor prognosis. We sought to elucidate molecular features differentiating primary tumors (PTs) from PMs and actionable targets facilitating transcoelomic dissemination and progression. We performed multi-omic profiling of 217 samples from 136 patients, including 56 primary tumor (PT) and 120 PMs comprising 25 matched PT-PM pairs. Whole exome, and bulk RNA-seq analysis was conducted to identify underlying genomic aberrations and transcriptomic differences between primary and peritoneal lesions.

  Study EGAS50000000813

• Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application

  We established hypoimmunogenic human induced pluripotent stem cells (iPSCs) to minimize the immune rejection caused by mismatches of HLA type. Here, we optimized the protocol for good manufacturing practice (GMP)-compatible CRISPR-Cas9 genome editing to deplete the three gene locus (HLA-A, HLA-B, and CIITA genes) simultaneously in HLA homozygous iPSCs. RNA-seq and flow cytometry analyses confirmed the successful depletion of HLAs, and lineage-specific differentiation into cardiomyocytes was verified.

  Study EGAS50000001194

• Comprehensive molecular profiling of pulmonary pleomorphic carcinoma

  Information regarding the molecular features of pulmonary pleomorphic carcinoma (PPC) is insufficient. Here, we performed next-generation sequencing to determine the genomic and transcriptomic profiles of PPC. Whole exome sequencing (WES) of fresh-frozen tissue samples and target-capture sequencing of formalin-fixed-paraffin-embedded (FFPE) samples were performed. Fresh-frozen tissue samples and FFPE samples were subjected to WES and target-capture sequencing as normal control, respectively. Fresh-frozen tissue samples and 56 FFPE samples were subjected to RNA-seq.

  Study JGAS000297

• Analysis of genomic alterations in dedifferentiated liposarcoma

  Multiomics analysis of rare cancers to identify genetic alterations related with pathogenesis and prognosis. To identification of genetics alterations of Dedifferentiated liposarcoma, DNAs and RNAs were extracted from dedifferentiated liposarcoma and paired non-cancer (normal) tissues. NGS libaraies were prepared by using Agilent SureSelect XT Human All Exon V5 + IncRNA kit for whole exome sequencing (WES) and TruSeq Stranded mRNA Prep kit or TruSeq RNA Access Library Prep kit (RNA seq). Sequencing was perfomred by Illumina HiSeq 2500.

  Study JGAS000182

• Genomic, transcriptomic and epigenomic profiling of GCTB

  Giant cell tumor of bone is a rare bone neoplasm driven by oncogenic hotspot G34W/L/V mutations in the non-canonical histone variant H3.3. This study provides primary data of genomic (WGS), transcriptomic (RNA-seq) and epigenomic (histone mark ChIP-seq, WGBS, ATAC-seq) profiling of primary GCTB samples from several cohorts in Germany and Korea. We confirm the H3.3-G34 mutations as sole genetic drivers of GCTB, and describe the epigenetic alterations in mutant GCTB stromal cells.

  Study EGAS00001003730

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• ATAC-seq dataset of Single cell RNA sequencing reveals induced bifurcated differentiation after RUNX1::RUNX1T1 depletion in patient-derived leukemic blasts

  In this study, we demonstrate that primary AML cells harboring the chromosomal translocation t(8;21) are critically dependent on the corresponding fusion gene, RUNX1::RUNX1T1, to suppress differentiation and maintain stemness. Silencing RUNX1::RUNX1T1 expression using siRNA-loaded lipid nanoparticles induces significant changes in chromatin accessibility, redirecting the leukemia-associated transcriptional network towards a myeloid differentiation program. Single-cell analyses reveal that this transcriptional reprogramming is associated with the depletion of immature stem and progenitor-like cell populations, accompanied by an expansion of granulocytic and eosinophilic/mast cell-like populations with impaired self-renewal capacity.

  Dataset EGAD00001015509

• Genomic characterisation of SDH deficient renal cell carcinoma - RNA

  SDH deficient renal cell carcinomas are a rare and recently defined subtype of kidney cancer, often associated with an inherited mutation in one of the SDH gene subunits. This dataset sought to understand the genomic events that underpin tumour formation, from putative cell of origin, characterisation of the tumour microenvironment, to the genomic evolution of these rare tumours. We performed whole genome and RNA sequencing of 4 patients with SDH deficient renal cell carcinomas, including one patient who had an additional paraganglioma. An addition patient in this cohort had the initial diagnosis revised to a clear cell renal cell carcinoma.

  Dataset EGAD00001008470

• A Tumour Organoid Biobank for Mapping Cancer Cell Vulnerabilities - RNA

  RNA sequencing data from cancer patient-derived organoids. Part of a study to include genomic and transcriptomic sequencing data, along with CRISPR screening data from cancer patient-derived organoids and matched tumour tissues. Some organoids were developed as part of the Human Cancer Models Initiative (HCMI) in collaboration with Cancer Research UK (CRUK). The study includes organoids derived from colorectal, oesophageal, ovarian, pancreatic, and stomach cancer samples.

  Dataset EGAD00001015470

• Whole Genome, RNA, and ChIP Sequencing of matched brain tumor-normal pairs (ICGC)

  Whole Genome Seq: Illumina HiSeq sequence data (with >30x coverage) were aligned to the hg19 human reference genome assembly using BWA (Li and Durbin, 2009);duplicate reads were removed from the final BAM file. No realignment or recalibration was performed. Paired-end RNA sequencing reads were mapped to the hg19 assembly of the human reference genome using BWA.Each ChIP-seq library was sequenced with two complete lanes on the Illumina HiSeq 2500 in the 101-bases paired-end rapid mode and aligned to hg19 using bwa.This resulted in the following coverage values (genome-wide, after deduplication, including all uniquely mapping reads):GBM103 macroH2A1: 17x H3K36me3: 20xMB59 macroH2A1: 11x H3K36me3: 11x

  Dataset EGAD00001000664

• Deep single-cell RNA sequencing data for 11138 T cells from tumour, adjacent normal tissue and peripheral blood of treatment-naive CRC patients. The DATA ACCESS AGREEMENT is provided at https://github.com/zhangyybio/single-T-cell-data-access. Applicants can request access to the data by directly downloading it or by sending an email to cancerpku@pku.edu.cn. The process that is used to approve an application includes verifying the institution, participants and research purposes of the application. In general this process will take about two weeks. In principal, any scientific research program complying with the laws and bioethic regulation policies of China will be approved.

  T cells are central players in cancer immunotherapy1, yet some of their fundamental properties such as development and migration within tumours remain elusive. The enormous T cell receptor (TCR) repertoire, required for recognising foreign and self-antigens2,3, could serve as lineage tags to track these T cells in tumours4. Here, we obtained transcriptomes of 11,138 single T cells from 12 colorectal cancer (CRC) patients and developed STARTRAC (Single T-cell Analysis by Rna-seq and Tcr TRACking) indices to quantitatively analyse dynamic relationships among 20 identified T cell subsets with distinct functions and clonalities. While both CD8+ effector and “exhausted” T cells exhibited high clonal expansion, they were independently connected with tumour-resident CD8+ effector memory cells, implicating a TCR-based fate decision. Of the CD4+ T cells, the majority of tumour-infiltrating Tregs showed clonal exclusivity, whereas certain Treg clones were developmentally linked to multiple TH clones. Notably, we identified two IFNG+ TH1-like clusters in tumours, the GZMK+ TEM and CXCL13+ TH1-like clusters, which were associated with distinct IFN-γ-regulating transcription factors, EOMES/RUNX3 and BHLHE40, respectively. Only CXCL13+BHLHE40+ TH1-like cells were preferentially enriched in tumours of microsatellite-instable (MSI) patients, which might explain their favourable response rates to immune-checkpoint blockade. Furthermore, we found IGFLR1 to be highly expressed in both CXCL13+BHLHE40+ TH1-like and CD8+ exhausted T cells and possessed co-stimulatory functions. Our integrated STARTRAC analyses provides a powerful avenue to comprehensively dissect the T cell properties in CRC, which could shed new insights into the dynamic relationships of T cells in other cancers

  Study EGAS00001002791

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338