15038 results for "cancer studies using rna-seq"

in 35.18 milliseconds.

• RNA-Seq of GM adipose tissue samples

  This dataset contains 210 fastq files (RNA sequencing was performed in two centers) from 105 individuals (106 files in subcutaneous tissue and 104 files in visceral tissue). Of the 210 fastq files, 129 files are in PEx100 mode (appeared in a single fastq file) and 81 files are in PEx49bp mode (appeared in two separate fastq files). Sequencing was done on the Illumina HiSeq2000 platform.

  Dataset EGAD00001010253

• The Dynamic Immune Behavior of Primary and Metastatic Ovarian Carcinoma

  Single-cell RNA-seq data of prospectively collected normal ovarian tissue sample from 1 healthy individual and tumor tissue samples with or without chemotherapy from 19 HGSOC patients.

  Dataset EGAD50000000057

• scRNAseq sequencing reads and count matrices of murine splenocytes from diffuse large B-cell lymphoma

  Single-cell RNA-seq of 91 murine splenocytes from Bcl6tg/+ and Cd70-/-; Bcl6tg/+ diffuse large B-cell lymphoma mouse models and Cd70-/- and wild-type controls.

  Dataset EGAD00001012104

• Genomic Analysis of Medullary Thyroid Carcinoma

  Sequence data from two medullary thyroid carcinoma patients: WGS datasets generated from tumors and matched normal tissues and RNA-Seq from tumors are included.

  Dataset EGAD00001001618

• Transcriptomic profiles of neuroblastoma PDXs and primary tumors

  This dataset contains bam files for RNA-seq experiments for 6 neuroblastoma PDXs (Patient Derived Xenograft) and 3 pairs of neuroblastoma tumors at diagnosis and at relapse.

  Dataset EGAD00001003393

• Integrative genomic study of CML patients

  This dataset contains WES and RNA-Seq fastq files for 65 CML patient samples at various stages of disease progression.

  Dataset EGAD00001004179

• CPM table for OAK (GO28915)

  This dataset contains counts per million for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008629

• Count table for POPLAR (GO28753)

  This dataset contains counts for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008630

• Count table for OAK (GO28915)

  This dataset contains counts for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008628

• CPM table for POPLAR (GO28953)

  This dataset contains counts per million for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008631

• Whole-genome sequencing reveals genomic signatures associated with the inflammatory microenvironments in Chinese NSCLC patients

  We integrate genomic (whole-genome sequencing, WGS) and transcriptome (polyA-enriched RNA-Seq) sequencing from 90 NSCLC cases and comprehensively identified the distinct genomic features of Chinese NSCLC patients.

  Dataset EGAD00001004071

• macIDR validation data

  RNA-seq of 24 M-CSF differentiated human peripheral monocyte-derived macrophages (MDMs) activated with short exposure (3hours) to LPS, or long exposure (24 hours) to LPS, LPS with IFNγ, IFNγ, IL-4, IL-10, and dexamethasone.

  Dataset EGAD00001004584

• Mapping Systemic Lupus Erythematosus Heterogeneity at the Single Cell Level

  Patients with Systemic Lupus Erythematosus (SLE) display a complex blood transcriptome whose cellular origin is poorly resolved. Using single-cell RNA-seq, we profiled ~276,000 PBMCs from 33 children with SLE (cSLE) with different degrees of disease activity (DA) and 11 matched controls. Increased expression of Interferon-stimulated genes (ISGs) distinguished cSLE from healthy control cells. The high-ISG expression signature (ISGhi) derived from a small number of transcriptionally defined subpopulations within major cell types, including monocytes, CD4+ and CD8+ T cells, NK cells, cDCs, pDCs, B cells and especially plasma cells. Expansion of unique subpopulations enriched in ISGs and/or in monogenic Lupus-associated genes classified patients with the highest DA. Profiling of ~82,000 single PBMCs from adult SLE patients confirmed the expansion of similar subpopulations in patients with the highest DA. This study lays the groundwork for resolving the origin of the SLE transcriptional signatures and the disease heterogeneity towards precision medicine applications. Patient demographics, clinical and laboratory data and treatment are summarized and available. The genomic data for participant aHD2 will not be included in the dataset The study description is reprinted from Nehar-Belaid et. al. Nature Immunology, 2020, with permission from Nature Immunology Group

  Study phs002048

• Fecal microbiome predicts treatment response after the initiation of semaglutide or empagliflozin uptake

  To investigate the effect of semaglutide and empagliflozin initiation on the gut microbiome of type 2 diabetes patients. In addition, to analyze whether the pre-treatment gut microbiome can predict the treatment efficacy. Gut microbiome fecal samples donated at four timepoints (Baseline, Month 1, Month 3; Month 12) were studied using 16S ribosomal RNA gene sequencing and analysis.

  Study EGAS50000000531

• WES Profiles from the CheckMate-577 Clinical Trial

  The dataset contains WES profiles of 396 patients from the CheckMate-577 (CA209-577) clinical trial whose ICF allows data deposition into a public repository. The Allprep DNA/RNA FFPE kit was used to simultaneously purify genomic DNA and total RNA from formalin-fixed, paraffin embedded (FFPE) tissue sections. DNA was analyzed by Whole Exome Sequencing using Swift Biosciences Accel-NGS 2S Hyb DNA Library Kit for library preparation and hybridization using Agilent SureSelect All Exon v6, followed by sequencing on the Illumina NovaSeq platform with a 100bp paired-end strategy and a target read depth of 100M per tumor sample. Fastq files are included.

  Dataset EGAD50000002395

• Capture Hi-C on MM

  In situ promoter capture Hi-C on multiple myeloma cell line KMS11 in experimental triplicates. Hi-C libraries were prepared as previously described (Rao et al., 2014, http://dx.doi.org/10.1016/j.cell.2014.11.021). Promoter capture was based on 32,313 biotinylated 120-mer RNA baits (Agilent). Hi-C libraries were sequenced using Illumina HiSeq 2000 technology. The files are in FASTQ format.

  Study EGAS00001002614

• Adult B-precursor acute lymphoblastic leukemia transcriptomes

  Bone marrow or peripheral blood samples were collected of adult patients at first diagnosis of B-precursor acute lymphoblastic leukemia. RNA was isolated from mononuclear cells and subjected to mRNA library prep using Poly-A selection and sequencing on a NovaSeq 6000 system. Obtained gene expression profiles and gene fusion calls were used to allocate samples to molecular disease subtypes.

  Study EGAS00001006107

• A Phase Ib/II Study of Regorafenib and Paclitaxel in Beyond First-line Advanced Esophagogastric Carcinoma (REPEAT)

  Regorafenib showed promising results in gastric cancer. We aimed to assess the tolerability of regorafenib and paclitaxel in advanced esophagogastric cancer (EGC) patients refractory to first-line treatment and explore potential biomarkers.. We performed enzyme-linked immunosorbent assay measurements of galectin-1, RNA sequencing, and shallow wholegenome sequencing of metastatic tumor biopsies for biomarker analyses.

  Study EGAS00001006054

• SDR-seq_06_BCL

  Multiomic targeted scDNA-scRNA-seq (SDR-seq) of primary B-cell non-Hodgkin lymphomas. Aim is to link genomci variants to gene expression in single cells. Profiled two follicular lymphoma (FL) primary patient samples and one germinal center subtype diffuse large B-cell lymphoma (GCB) primary patient sample.

  Study EGAS50000000374

• Type I Interferon and Cycling Lymphocytes in Macrophage Activation Syndrome

  We performed immune profiling of peripheral blood mononuclear cells from patients with Still's disease and macrophage activation syndrome (MAS) using bulk RNA sequencing and single-cell RNA sequencing. Three groups were included in the study: healthy controls, patients with Still's disease without macrophage activation syndrome, and patients with Still's disease and macrophage activation syndrome. We found that macrophage activation syndrome is associated with transcriptomic signatures of interferon upregulation and cell cycling. We identified cycling lymphocytes within T cell and NK cell populations that are correlated with MAS disease activity. All sequencing data are available through dbGaP.

  Study phs003310

• Identification and Characterization of Skin-Resident Memory T cells in Patients with Melanoma-Associated Vitiligo

  Metastatic melanoma patients who develop melanoma-associated vitiligo, an autoimmune cutaneous side effect after receiving immunotherapy, have better overall survival than those who do not develop vitiligo. The objective of this study is to determine the tumor-specific memory T cell responses in the skin, tumor and blood of melanoma patients with vitiligo. Matched melanoma tumor, distant vitiligo-affected skin, and blood were collected and sorted for T cells to perform paralleled single-cell RNA sequencing (scRNA-seq) and single-cell TCR sequencing (scTCR-seq) on the day of tissue collection. The transcriptional analysis identified three resident memory T (TRM) cell subsets which were shared between tumors and vitiligo-affected skin. scRNA-seq identified CD8+ T-cell clonotypes in tumors that co-existed as TRM in skin and as effector memory T (TEM) cells in blood. This study revealed that long-term melanoma survivors maintained memory T cell responses as broadly-distributed TRM and TEM compartments. 

  Study phs002309

• Rapid Acceleration of Diagnostics - Digital Health Technologies' (RADx-DHT) Collection of General Research Use Datasets

  This individual-level collection of datasets contains all the RADx Digital Health Technologies (RADx-DHT) studies in dbGaP for General Research Use (GRU). Access to studies in this collection is on the RAPIDS platform. To request access to this study collection, select phs003666 in the dbGaP when submitting a data access request.

  Study phs003666

• Precision Interception of Gastric Cancer Precursors Through Molecular and Cellular Risk Stratification

  The GAstric Precancerous conditions Study (GAPS, NCT04191551) is a cross-sectional study of patients undergoing endoscopy who are at increased risk of gastric cancer. Enrolled patients are administered a standardized questionnaire, undergo clinical biopsy collection using the Sydney system, and consent for the collection of saliva, blood, and additional gastric tissue. All patients are scored for intestinal metaplasia using the operative link on gastric intestinal metaplasia (OLGIM) scoring system.

  Study phs003648

• Shot-gun stool metagenomics and colorectal cancer risk.

  This study aims to identify metagenomics biomarkers in colorectal cancer (CRC). The study includes 156 samples of shot-gun stool metagenomics, corresponding to 51 patients with CRC, 54 patients with high-risk adenoma, and 51 healthy controls. The sequencing libraries were prepared with 2 µg of total DNA using the Nextera XT DN Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing was performed at 150 nucleotides, paired-end, using an Illumina HiSeq 4000 platform.

  Study EGAS00001007025

• scRNA-seq dataset of patient and healthy donors

  scRNA-seq dataset on a patient (P) presenting with defects of immunity and four healthy donors (C1, C2, C3, C4). This dataset contains raw and processed files from scRNA-seq performed on samples using the 10x Genomics Chromium Controller with the Chromium Single Cell 3′ Reagent Kit (v3 chemistry). There are 15 paired-end fastq files (3 per patient/donor - I1, R1, R2) and 15 processed files generated with 10x Genomics Cell Ranger v3.0.2 software against GRCh38 human reference transcriptome (3 per patient/donor - barcodes.tsv.gz, features.tsv.gz, matrix.mtx.gz).

  Dataset EGAD00001008372

• Peripheral clonal expansion of T cells (scTCR-seq)

  Single-cell TCR-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005465

• B cell receptor silencing reveals origin and dependencies of high-grade B cell lymphomas with MYC and BCL2 rearrangements

  High-grade B cell lymphomas with MYC and BCL2 rearrangements (HGBCL-DH-BCL2) represent highly aggressive Germinal center (GC) derived B cell malignancies with dismal prognosis and limited therapeutic options. In the present study, we investigated the expression of BCR complex components, including immunoglobulin (IG) heavy (H) and light (L) chains, and CD79A and CD79B signaling subunits in HGBCL-DH-BCL2, scoring 65% of cases with undetectable IGH immunoreactivity (IGHUND). Transcriptomics (bulk RNA-seq) and genetic (whole exome/genome sequencing) analyses indicated that IGHUND and IGH+ HGBCL-DH-BCL2 lymphomas represent distinct biological entities. Specifically, IGHUND HGBCL-DH-BCL2 exhibit a GC DZ-like molecular program, and select subset-specific gene mutations pointing to distinct evolutionary trajectories respect to the IGH+ counterparts. IG profiling revealed that IGHUND HGBCL-DH-BCL2 preserved potentially productive, hypermutated IGH variable (V) gene rearrangements, indicating a selective advantage conferred to the malignant B cells by residual IGH molecules. Accordingly, disruption of the productively rearranged IGHG1 gene in BCRnull HGBCL-DH-BCL2 cell line model confirmed the dependency on IGH expression for optimal fitness. Using transcriptomics and in situ RNA-scope analysis, we reported that IGHUND HGBCL-DH-BCL2 originated from IG-class switched GC B cells, while IGH-expressing tumors were selected for continuous IGM expression. Moreover, while IGH+ HGBCL-DH-BCL2 favor IGM/IG-Kappa expression, IGHUND counterparts complete IG-Lambda light chain rearrangements. Notably, BCR silencing, caused by accelerated IGH turnover and reduced IGH expression, precedes HGBCL-DH-BCL2 onset, inducing RAG1/2-dependent IG light chain editing and eventually facilitating t(8;22)/IGL::MYC translocations. Finally, IGH silencing observed in HGBCL-DH-BCL2 cell models, which leads to intracellular retention/silencing of CD79B, results in reduced sensitivity to the CD79B-targeting antibody-drug conjugate Polatuzumab-vedotin. Collectively, HGBCL-DH-BCL2 originates from isotype-switched t(14;18)+ GC B cells that undergo IG light chain editing fuelling intra-clonal diversification, BCR silencing, and the acquisition of t(8;22) translocation, while preserving IGH dependency.

  Study EGAS50000001047

• Notch Signaling and Efficacy PD-1/PD-L1 Blockade in Relapsed Small Cell Lung Cancer

  Small cell lung cancer (SCLC) is a highly aggressive neuroendocrine (NE) cancer that accounts for approximately 15% of all lung cancer, with an annual incidence of more than 34,000 in the United States alone. SCLC is characterized by loss of function of p53 and RB and high tumor mutational burden, which suggests that these tumors could be immunogenic and respond to immune checkpoint blockade (ICB). However, the benefit from ICB in an unselected SCLC population is modest. In this study, we evaluated the genomic features associated with clinical outcomes in relapsed SCLC to gain insight into the underlying mechanisms of ICB response. Exome, RNA and TCR sequencing data from a prospective clinical trial of relapsed SCLC treated with durvalumab and olaparib and RNA-sequencing data for second cohort of relapsed SCLC cohort treated with nivolumab are included.   

  Study phs002176

• Childhood Cancer Data Initiative (CCDI): OncoKids - NGS Panel for Pediatric Malignancies

  This study aimed to systematically collect clinical, registry and genomic data on pediatric cancer patients, and to contribute to the CCDI Pediatric Data Ecosystem. Clinical, treatment and outcome data on 1,039 pediatric cancer patients whose molecular profile was characterized on OncoKids gene panel at Children's Hospital Los Angeles was abstracted and harmonized for submission to the NCI’s Cancer Data Service. The OncoKids panel was designed to detect DNA mutations and amplification in almost 200 oncogenes and tumor suppressor genes, a limited number of pharmacogenomic targets and 1,700 disease-associated gene fusions at the RNA level. The panel encompasses the vast majority of FDA’s relevant pediatric molecular target list, as well as additional genes associated with ultra-rare pediatric tumors. The final data elements included DNA/RNA sequence data, OncoKids test results, clinical data on demographics, diagnosis, comorbidity and adverse events and treatment data.

  Study phs002518

• Ongoing_mutagenesis_RNAseq

  One of the key questions to be explored is whether the biological processes generating specific mutational signatures continue to operate in the human cancer cell lines or simply reflect past mutagenic activity which is no longer operative. To address this question, we have extracted mutational signatures from 1,000 cancer cell lines of diverse cancer types. Several cell lines with mutational signatures of interest were selected, subcloned over a defined period of time and their genomes sequenced. The increased load of the mutations representative of a specific mutational signature within the genome of a subclone when compared to its parental clone was informative of the on-going mutational processes. To further study the recent observation that some of the clones belonging to a same cell line acquired differencet numbers of mutations over a set period of time, their RNA will be subjected to RNA-sequencing to study their differences.

  Study EGAS00001002364

• Experimental PfSPZ Vaccine in Adults Without Malaria

  The study was performed to evaluate whole-blood transcriptomic profiles via RNA-seq before, during, and after immunization with the PfSPZ Vaccine in malaria-naïve, healthy adults enrolled in VRC 312 (NCT01441167). VRC 312 was the second study of the PfSPZ Vaccine and the first study to evaluate intravenous (IV) administration of this vaccine. The study was an open-label evaluation of the safety, tolerability, immunogenicity, and protective efficacy of the vaccine at successively higher administered by the IV route. The highest dosages were evaluated for protection against a malaria challenge after 4 to 6 vaccinations. The primary objectives of the study were related to the safety and tolerability of the vaccine at the 4 different dosage levels when administered IV; the secondary objectives were related to PfSPZ vaccine-mediated protection against Plasmodium falciparum (Pf) challenge at the 3 higher dosage levels, and the exploratory objectives were related to the immunogenicity of the PfSPZ Vaccine and defining an immune correlate of protection. To further determine potential molecular correlates of immunogenicity and/or protection, RNA-seq was performed on whole blood collected from subjects in all dose groups at time points before, during, and after immunization.

  Study phs002422

• Cholesterol and Pharmacogenetics (CAP) Study

  The Cholesterol and Pharmacogenetics Study was a 6-week open label, non-randomized study of 40mg/day simvastatin treatment in 335 black and 609 white (944 total) men and women. Plasma lipids and lipoproteins were measured on two occasions prior to treatment and at 4 and 6 weeks of treatment. The study was designed to test for genetic associations with baseline measurements and changes in response to simvastatin treatment. Whole genome genotyping was performed on 592 white CAP study participants in two stages. In Stage 1, 304 were genotyped for 314,621 SNPs to tag for common genomic variation. In Stage 2, 290 participants were genotyped, including 280 who were genotyped for 620,901 SNPs. Two samples were excluded due to gender discrepancies. More recently, CAP self-reported black participants were genotyped on Illumina Omni2.5Exome chips. PolyA-selected strand-specific RNA-seq libraries were generated in several batches from lymphoblastoid cell lines (LCLs) derived from 268 white and 165 black CAP participants. The LCLs were exposed to sham buffer (control) or 2 uM activated simvastatin for 24 hours, producing a total of 866 100/101 bp paired end RNA-seq libraries sequenced on Illumina HiSeq 2000 machines.

  Study phs000481

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Whole transcriptome profiling of liquid biopsies from tumour xenografted mouse models: validation cohort

  While cell-free DNA (cfDNA) in liquid biopsies is widely being used and investigated, free circulating RNA (extracellular RNA, exRNA) has the potential to improve therapy response monitoring and cancer detection due to its dynamic nature. A fundamental open question hampering the initiation of large-scale liquid biopsy collections for tumour exRNA analysis is that it remains unclear in which blood subcompartment tumour-derived exRNAs primarily reside. We set out to develop a host-xenograft deconvolution framework, exRNAxeno, with cDNA mapping strategies to either a combined human-mouse reference genome or both species genomes in parallel, that can be applied to exRNA sequencing data from liquid biopsies of human xenograft mouse models, enabling to distinguish (human) tumoural RNA from (murine) host RNA, and as such to specifically analyse tumour-derived exRNA. Subsequently, the preferred exRNAxeno combination pipeline was applied to total exRNA sequencing data from blood platelets and three plasma fractions from a breast cancer patient-derived and neuroblastoma cell line-derived xenograft mouse model. We show that tumoural exRNA concentrations are not determined by plasma platelet levels, while host exRNA concentrations increase with platelet content. Furthermore, a large variability in exRNA levels and gene content across individual mice is observed. In general, the tumoural gene detectability in plasma is correlated with the RNA expression levels in the tumour tissue or cancer cell line. Our results unravel new aspects of tumour-derived exRNA biology in xenograft mouse models.

  Study EGAS00001006582

• Whole Exome Sequencing of Parathyroid Cancer Identifies Candidate Driver Mutations and Core Pathways

  Here we performed genomic characterization of twenty-nine sporadic parathyroid cancers using next generation whole exome sequencing. Thirty-three novel candidate driver genes for sporadic parathyroid cancer were proposed, in addition to previously known driver genes CDC73 and MEN1.

  Study phs001765

• mUM patient biopsies bulk RNAseq

  Tumour biopsies were obtained from uveal melanoma patients (n = 35) pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system

  Dataset EGAD50000001225

• Molecular Epidemiology of Colorectal Cancer (MECC) Metastasis Study: A Germline Variant on Chromosome 4q31.1 Associates with Susceptibility to Developing Colon Cancer Metastasis

  This study compared Ashkenazi Jewish individuals with Stage IV metastatic colon cancer to those with non-metastatic Stage I or II colon cancers. A genome-wide association study, using a 2-stage design, identified a significant association with rs60745952.

  Study phs001045

• Sleep Heart Health Study (SHHS-BioLINCC)

  Data Access NOTE: Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions.Related StudiesParent cohort phenotype data can be accessed through ARIC-BioLINCC, Framingham-BioLINCC, and CHS-BioLINCC. Objectives To determine the cardiovascular and other consequences of sleep-disordered breathing and to test whether sleep-disordered breathing is associated with an increased risk of coronary heart disease, stroke, all-cause mortality and hypertension by examining subjects from well-characterized and established epidemiologic cohorts. Background Obstructive sleep apnea syndrome (OSA) is a potentially debilitating condition characterized by repetitive episodes of apnea while asleep, nocturnal oxygen desaturation, excessive daytime sleepiness, and loud disruptive snoring. Epidemiologic data from middle-aged adults indicate that OSA is common, with prevalence rates of 4% in men and 2% in women. Prior studies implicated OSA as a risk factor for the development of hypertension, ischemic heart disease, congestive heart failure, stroke and consequently premature death. Questions arose as to whether an increased propensity for cardiovascular and cerebrovascular diseases was limited to only those with frank OSA or whether more subtle forms of sleep-disordered breathing (SDB) would also confer elevated risk. Further evidence was also needed to clarify whether, SDB, including OSA, is an independent risk factor for the development of cardiovascular or cerebrovascular disease. Known cardiovascular and cerebrovascular disease risk factors such as obesity and smoking are commonly present in those with SDB; therefore, apparent associations between SDB and cardiovascular and cerebrovascular diseases may have resulted from the effects of these concomitant risk factors. Moreover, there was no understanding as to whether such factors as race, age, gender, and prevalent cardiovascular or cerebrovascular disease might interact with SDB to alter future cardiovascular and cerebrovascular disease risk. Mechanisms underlying any propensity to develop cardiovascular or cerebrovascular disease with SDB had not been firmly established (Quan, et al., 1997, PMID: 9493915). Participants Participants in SHHS were recruited from nine existing NHLBI epidemiological studies in which data on cardiovascular risk factors had been collected previously. The “parent” cohorts included: Two sites of the Atherosclerosis Risk in Communities Study (ARIC) Three sites of the Cardiovascular Health Study (CHS) The Framingham Offspring Cohort The Strong Heart Study (SHS) sites in South Dakota, Oklahoma, and Arizona The New York Hypertension Cohorts The Tucson Epidemiologic Study of Airways Obstructive Diseases and the Health and Environment Study From these parent cohorts, a sample of participants who met the inclusion criteria (age 40 years or older; no history of treatment of sleep apnea; no tracheostomy; no current home oxygen therapy) was invited to participate in the baseline examination of the SHHS, which included an initial polysomnogram (SHHS-1). Several cohorts over-sampled snorers in order to increase the study-wide prevalence of sleep-disordered breathing. In all, 6441 individuals were enrolled between November 1, 1995 and January 31, 1998. During exam cycle 3 (January 2001-June 2003), a second polysomnogram (SHHS-2) was obtained in 3295 of the participants. Due to sovereignty issues, Strong Heart Study participants are not included in the shared SHHS data. Data from a total of 5839 participants (1920 ARIC, 1249 CHS, 997 Framingham Offspring and OMNI 1, and 1673 from other studies), consenting to share data are available. Design The Sleep Heart Health Study added in-home polysomnography to the data collected in each of the parent studies at a baseline SHHS exam and a follow-up approximately 4 years later. Using the Compumedics PS polysomnograph, sleep studies were obtained in an unattended setting, usually in the homes of the participants, by trained and certified technicians. The recording montage consisted of: C3/A2 and C4/A1 EEGs, sampled at 125 Hz right and left electrooculograms (EOGs), sampled at 50 Hz a bipolar submental electromyogram (EMG), sampled at 125 Hz thoracic and abdominal excursions (THOR and ABDO), recorded by inductive plethysmography bands and sampled at 10 Hz "airflow" detected by a nasal-oral thermocouple (Protec, Woodinville, WA), sampled at 10 Hz finger-tip pulse oximetry (Nonin, Minneapolis, MN) sampled at 1 Hz ECG from a bipolar lead, sampled at 125 Hz for most SHHS-1 studies and 250 Hz for SHHS-2 studies Heart rate (PR) derived from the ECG and sampled at 1 Hz body position (using a mercury gauge sensor) ambient light (on/off, by a light sensor secured to the recording garment)This montage provides data on the occurrence of sleep-disordered breathing, sleep stages, heart rate, oximetry and on arousals. Each participant in the parent studies was also asked to complete the Sleep Habits Questionnaire which covers usual sleep pattern, snoring, and sleepiness.

  Study phs003637

• APCIM_Nanostring_HD

  Expression of immune related genes in 12 healthy donors. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002554

• CMF_RNA_sequencing

  RNA sequencing will be undertaken to reconstruct rearrangements at level of transcription to determine pathogenomic genomic events in chondromyxoid fibroma

  Study EGAS00001000470

• Premalignant SOX2 overexpression in the fallopian tubes of ovarian cancer patients: Discovery and validation studies

  To identify early driver mutations in ovarian cancer cells, we used dense whole genome sequencing of micrometastases and microscopic residual disease collected at three time points from a single patient during treatment for high-grade serous ovarian cancer (HGSOC). Laser capture microdissection of tumour islets was performed on samples prior to chemotherapy, after three cycles of chemotherapy and at recurrence. Long frament read whole genome sequencing was performed and mutations were identified. To our knowledge, this is the first longitudinal study that attempts to investigate spatial and temporal micro-heterogeneity in cancer.

  Study EGAS00001001909

• Atezolizumab monotherapy following dCRT indicated a promising cCR rate in patients with unresectable locally advanced esophageal squamous cell carcinoma (EPOC1802)

  The objective is to analyze tumor and normal cell exome sequencing of esophageal cancer patients participating in the Tenergy trial before treatment and RNA sequencing specimens of tumor biopsy specimens at three points before treatment, after radiation chemotherapy, and after atezolizumab administration, in order to search for biomarkers to predict treatment response. Exome sequencing of pretreatment tumor tissue (27 specimens) and normal tissue (27 specimens) from esophageal cancer patients participating in the Tenergy trial, and RNA sequencing of tumor biopsy specimens at three time points before treatment (28 specimens), after radiation chemotherapy (25 specimens) and after atezolizumab administration (25 specimens).

  Study JGAS000708

• Integrative Gene Regulatory Network Analysis Discloses Key Driver Genes of Fibromuscular Dysplasia

  Fibromuscular dysplasia (FMD) is a poorly understood vascular disease that can lead to hypertension, stroke, myocardial infarction and even death. In 2013 we initiated the DEFINE study (ClinicalTrials.gov Identifier: NCT01967511), which has now recruited > 440 subjects and which aims to unravel the pathobiological mechanisms of this disease. Here, by integrating DNA genotype and RNA sequence data from primary fibroblasts of 83 FMD patients and 71 matched healthy controls from the DEFINE study, and its precursor the CAUSE study, we inferred 18 gene regulatory co-expression networks, four of which were found to act together as an FMD-associated super network in the arterial wall. Molecular studies indicated that this super network, termed SN-A and with the top key driver gene UBR4, governs multiple aspects of vascular cell physiology and functionality, including collagen/matrix production. The effects of UBR4 knockdown were also investigated in commercially available aortic smooth muscle and fibroblast cell lines by RNA sequencing, and these results are included in these datasets.Note, that of the 154 subjects in this analysis, 62 did not provide consent to have their genomic data made publicly available. Therefore the human subject data available here is from the 92 study participants who provided written informed consent to share their deidentified genomic data publicly.

  Study phs003674

• A novel transcriptional signature identifies T-cell infiltration in high-risk paediatric cancer

  Background Molecular profiling of the tumour immune microenvironment (TIME) has enabled the rational choice of immunotherapies in some adult cancers. In contrast, the TIME of paediatric cancers is relatively unexplored. We speculated that a more refined appreciation of the TIME in childhood cancers, rather than a reliance on commonly used biomarkers such as tumour mutation burden (TMB), neoantigen load and PD-L1 expression, is an essential prerequisite for improved immunotherapies in childhood solid cancers. Methods We combined immunohistochemistry (IHC) with RNA-sequencing and whole genome sequencing across a diverse spectrum of high-risk paediatric cancers to develop an alternative, expression-based signature associated with CD8+ T-cell infiltration of the TIME. Further, we explored transcriptional features of immune archetypes, T-cell receptor sequencing diversity, assessed the relationship between CD8+ and CD4+ abundance by IHC and deconvolution predictions, and assessed common adult biomarkers such as neoantigen load and TMB. Results A novel 15-gene immune signature, Immune Paediatric Signature Score (IPASS), was identified. Using this signature, we estimate up to 31% of high-risk cancers harbour infiltrating T-cells. In addition, we showed that PD-L1 protein expression is poorly correlated with PD-L1 RNA expression and TMB and neoantigen load are not predictive of T-cell infiltration in paediatrics. Furthermore, deconvolution algorithms are only weakly correlated with IHC measurements of T-cells. Conclusions Our data provides new insights into the variable immune-suppressive mechanisms dampening responses in paediatric solid cancers. Effective immune-based interventions in high-risk paediatric cancer will require individualised analysis of the TIME.

  Study EGAS00001007029

• NCI's Collection of Studies for General Cancer Research

  This collection contains all of NCIs authorized individual-level genomic datasets currently in dbGaP that are approved for Cancer Research (DS-CA) use only and limitations outlined in the model Data Use Certification Agreement. Access to this study will include any additional authorized individual-level DS-CA datasets that become available. Renewal of this study is required annually. To request access to this study collection, select phs003967.v1.p1 in the dbGaP Authorized Access System.

  Study phs003967

• A fast, affordable and minimally-invasive diagnostic test for Cancer of Unknown Primary (CUP) using DNA methylation profiling

  CUP diagnosis on FFPE tissue and liquid biopsies (blood, pleural and peritoneal effusions) using cfRRBS (cell-free reduced representation bisulfite sequencing), a technique that allows for identification of the methylation profile starting from minimal amounts of highly fragmented DNA.

  Study EGAS50000000257

• Whole genome sequence analysis in patients with primary central nervous system lymphomas

  We performed target amplicon sequencing analysis in 28 patients with primary central nervous system lymphomas using target capture technology (NGS) on Cancer Panel to explore molecular targets.

  Study JGAS000258

• GBM Up and Down Responder EZH2 ChIPseq

  ChIPseq using anti-EZH2 with a sheared input DNA control to assess EZH2 genomic biding in one longitudinal pair of samples (pre- and post-treatment) from one UP and one DOWN responder GBM patient

  Dataset EGAD50000000134

• RNA sequencing of Non-Small Cell Lung Cancer and adjacent normal tissue

  RNA sequencing was performed on 108 NSCLC tumor samples and their paired adjacent normal tissues (n=21) to identify associations with clinical and immune characteristics.

  Study EGAS50000000246

• Genome-Wide Association Study of Sporadic and Familial Testicular Germ Cell Tumors

  Case-Control Study:Testicular germ cell cancer has been increasing among men during most of the 20th century. Despite this increase, the etiology of testicular cancer is poorly understood. To better understand the molecular epidemiology of testicular cancer, the National Cancer Institute and the Department of Defense are conducting a case-control study of testicular cancer among military servicemen. The project includes obtaining biosamples and questionnaire data from all participants. Pre-diagnostic serum samples are available from the approximately 1,000 cases and 1,000 controls enrolled in the study. Multiple-Case Family Study:In a parallel project, we are also studying families in which 2 or more testicular cancers have occurred. Among those men diagnosed with testicular cancer, about 1-3 percent report a family history of the disease (FTGCT). Brothers of affected individuals are 8 to 10 times more likely to develop testicular cancer, and men whose fathers had testicular cancer are four times more likely to develop testicular cancer, when compared with the relatives of men who have never had testicular cancer. Large-scale genetic linkage studies have failed to identify one or more rare, highly-penetrant testicular susceptibility genes. Rather, it appears that these familial clusters are due to the combined effects of multiple more common genes with low penetrance (so-called "polygenic inheritance"). Our cohort of FTGCT families was assembled to characterize this syndrome's clinical phenotype, and to discover the full range of cancer susceptibility loci that influence TGCT pathogenesis.

  Study phs001303

• MIBS MGS

  Metagenomic sequencing of the human gut in Maastricht IBS studies, cases and controls.

  Study EGAS00001001924

• RNAseq samples of patients with anti-PD-1 resistant HNSCC from a non-randomized, open-label phase 1b clinical trial

  Immune checkpoint blockade (ICB) is an effective treatment for a subset of patients with head and neck squamous cell carcinoma (HNSCC); however, the majority remain refractory. In a nonrandomized, open-label Phase 1b clinical trial, participants with recurrent and/or metastatic (R/M) HNSCC who had progressed on ICB were treated with low-dose 5-azacytidine (5-aza) daily for either 5 or 10 days, in combination with durvalumab and tremelimumab. The primary objective was to determine the biologically effective dose of 5-aza. In this study, RNA sequencing (RNA-seq) was performed on baseline and on-treatment samples from eight participants, and transcriptomic changes were analyzed to assess the impact of low-dose 5-aza treatment.

  Study EGAS50000000728

• PCa-LINES

  PCa-LINES: Ribo-minus RNA-seq of 4 patient samples and 2 PCa cell lines ---- Detection of fusion transcripts and their genomic breakpoints from RNA sequencing data Youri Hoogstrate, Malgorzata A. Komor, René Böttcher, Job van Riet, Harmen J. G. van de Werken, Stef van Lieshout, Ralf Hoffmann, Evert van den Broek, Anne S. Bolijn, Natasja Dits, Daoud Sie, David van der Meer, Floor Pepers, Chris H. Bangma, Geert J. L. H. van Leenders, Marcel Smid, Pim French, John W.M. Martens, Wilbert van Workum, Peter J. van der Spek, Bart Janssen, Eric Caldenhoven, Christian Rausch, Mark de Jong, Andrew P. Stubbs, Gerrit A. Meijer, Remond J.A. Fijneman, Guido Jenster bioRxiv 2021.05.17.441778; doi: https://doi.org/10.1101/2021.05.17.441778 https://www.biorxiv.org/content/10.1101/2021.05.17.441778v1

  Study EGAS00001004613

• Cancer sequencing for somatic variant calling

  This dataset includes WES and RNAseq for 11 patients with metastatic melanoma, lung, kidney, and stomach cancers, enrolled in phase I clinical trials of TIL ACT (NCT03475134 & NCT04643574). WES was performed on matched cancer and healthy tissues, whereas RNAseq was performed on cancer tissues, using Illumina HiSeq 2500/4000 and Illumina NextSeq 550 systems.

  Study EGAS00001007101

• Analytical study of protein function and RNA expression involved in predicting treatment efficacy and adverse event development in lung cancer radiotherapy.

  The purpose of this study is to elucidate the functions of DNA repair proteins and RNA expression that are involved in the therapeutic efficacy and adverse events of radiotherapy for lung cancer at our hospital. In particular, this is an exploratory study to identify proteins and RNAs involved in the expression of proteins that are likely to be involved in the prediction of radiotherapy response and adverse events.

  Study JGAS000545

• Chip-exo and Chip-nexus for five TFs in three colorectal cancer cell lines

  Chip-exo and Chip-nexus for FOXA1, HNF4A, KLF5, MYC, and TCF7L2 in colorectal cancer cell lines LoVo, GP5D, COLO320DM

  Dataset EGAD00001004099

• RNA sequencing of BCP-LBL and EM B-ALL patients samples

  In order to perform comprehensive transcriptomics and gene fusion analyses of a cohort of BCP-LBL and extramedullary (EM) manifestations of B-ALL patients, we performed RNA sequencing of 16 tissue samples from BCP-LBL and EM B-ALL patients. Because the material was available as FFPE, and had a relative low quality, we used a capture-based approach, where NGS libraries obtained from total RNA were captured in 4-plex, using a whole exome capture panel.

  Dataset EGAD50000002047

• Bulk RNA-sequencing of rhabdomyosarcoma tumour tissue (2025-09-30)

  This study investigates high-risk rhabdomyosarcoma (RMS) using multiple single-cell and spatial genomic technologies. We generated and analysed single-cell and single-nucleus RNA-sequencing, chromatin accessibility, and spatial transcriptomics data from primary tumours and validation samples. These datasets characterise cellular diversity within rhabdomyosarcoma and identify cell states associated with aggressive disease. The data support research into tumour biology, risk stratification, and therapeutic target discovery. This repository houses the bulk RNA sequencing of RMS tumours data. . This dataset contains all the data available for this study on 2025-09-30.

  Dataset EGAD00001015718

• Single-cell RNA-sequencing of rhabdomyosarcoma tumouroids (2025-09-30)

  This study investigates high-risk rhabdomyosarcoma (RMS) using multiple single-cell and spatial genomic technologies. We generated and analysed single-cell and single-nucleus RNA-sequencing, chromatin accessibility, and spatial transcriptomics data from primary tumours and validation samples. These datasets characterise cellular diversity within rhabdomyosarcoma and identify cell states associated with aggressive disease. The data support research into tumour biology, risk stratification, and therapeutic target discovery. This repository houses the single-cell RNA sequencing of RMS tumouroids data. . This dataset contains all the data available for this study on 2025-09-30.

  Dataset EGAD00001015708

• Bulk RNA-sequencing of rhabdomyosarcoma tumour tissue (2025-09-30)

  This study investigates high-risk rhabdomyosarcoma (RMS) using multiple single-cell and spatial genomic technologies. We generated and analysed single-cell and single-nucleus RNA-sequencing, chromatin accessibility, and spatial transcriptomics data from primary tumours and validation samples. These datasets characterise cellular diversity within rhabdomyosarcoma and identify cell states associated with aggressive disease. The data support research into tumour biology, risk stratification, and therapeutic target discovery. This repository houses the bulk RNA sequencing of RMS tumours data. . This dataset contains all the data available for this study on 2025-09-30.

  Dataset EGAD00001015714

• Kidney_tumour_DNA

  This is a bulk DNA and RNA sequencing study of human renal tumours

  Study EGAS00001002486

• Combination_Immune_Checkpoint_Inhibition_in_Australian_Rare_Cancers_WES

  Combination immune checkpoint inhibition (ICI) with anti-CTLA-4 and anti-PD-1 blockade has demonstrated significant clinical activity across tumour types. Rare cancer patients have limited treatment options due to the scarcity of studies of novel treatment options, so they are often offered chemotherapies untested in their disease. ONJ2016-001/CA209-538 is a prospective, multicentre clinical trial of combination ICI (ipilimumab and nivolumab) in patients with advanced rare cancers, including biliary tract, adrenocortical, rare gynaecological and neuroendocrine cancers (https://clinicaltrials.gov/ct2/show/NCT02923934). The primary endpoint is clinical benefit rate (complete response + partial response + stable disease >3 months) by RECIST 1.1. This study involves generation and analysis of pre-treatment formalin fixed paraffin embedded (FFPE) tumour DNA sequencing data, paired with germline DNA sequencing data, to potentially identify genomic biomarkers that may associate with clinical benefit or other clinical efficacy / toxicity metrics.

  Study EGAS00001005709

• BulkRNAseq - Notch Signaling Maintains a Progenitor-Like Subclass of Hepatocellular Carcinoma

  To identify the Notch signaling components expressed in both the human cancer cells and mouse stromal cells that typically comprise PDX tumors, we performed bulk RNA sequencing. Our results demonstrate that a JAG1-NOTCH2 signaling axis within the human cancer cell population drives the Notch dependency in the super-responder models, with NOTCH2 serving as the functionally relevant receptor.

  Study EGAS50000000515

• Uncovering Inversion Formation in the Human Genome and its Impact to Disease

  The relevance of inversions for disease causation, speciation and adaptation is broadly recognized, although the prevalence of inversions is unknown. In humans, de novo inversions are associated with congenital anomalies in approximately 9.6% of patients. Yet, despite the biological relevance of inversions, their molecular features, formation mechanism, impact to the genomic structure of carriers, as well as their contribution to clinical phenotypes, have not been further explored. Inversions are typically classified as balanced reciprocal events generated by ectopic recombination, although recent studies reveal a distinct picture whereby inversions originate from mechanisms that concomitantly generate copy number variants (CNVs). Surprisingly, those complex inversions underlie as much as 30% of neurodevelopmental-associated CNVs. The hypothesis of this project are: inversions are often generated de novo by mechanisms other than ectopic recombination a relevant fraction of inversions are associated with complex genomic rearrangements (CGRs), often overlooked in sporadic diseases, and inversions are a "hidden" type of structural variation for which contribution to a clinical phenotypes has been under assessed due to the lack of appropriate detection tools. A combined strategy using multiple genomic tools will be applied to characterize inversions and associated genomic alterations in individuals with neurodevelopmental disorders and controls: whole genome sequencing (WGS) with short-and long-reads; genome mapping; classical cytogenetics; and array CGH. This project will establish common ground to bridge studies of rare and common diseases, human evolution, and population genetics.

  Study phs002999

• Integration of T Cell Repertoire, CyTOF, genotyping and symptomatology data reveals subphenotypic variability in COVID-19 Patients

  A total of 61 patients (33 mild and 28 severe) with a median age of 51 years who recovered from COVID-19 were included in this study (Table 1). All collected samples were confirmed in diagnosis of COVID-19 by RT-PCR and positive IgG serolog. For the 61 patients, TCR-seq, CyTOF, and genotyping data were generated and analyzed in separate studies, as part of larger cohorts. In total, there are 143 variables, with 129 being quantitative (TCRseq and CyTOF metrics) and 13 being qualitative (symptomatology and genotyping). For more information about cohort characteristics, data adquisition an pre-processing, please visit PMID: 39227859, 36969980 and 37287057.

  Dataset EGAD50000000840

• Whole Exome and RNA sequencing of synchronous female bilateral breast cancers

  Study EGAS00001006910

• NCI-Maryland Prostate Cancer Case-Control Study

  The study seeks to examine the genetic and ancestral basis of prostate cancer-associated inflammation using a genome-wide association approach. The study population are the participants of the NCI Maryland Prostate Cancer Case-Control study. This study recruited both African American and European American men, and investigated the causes for the excessive burden of prostate cancer among African American men in more general terms. We measured 82 blood-based immune-oncology markers, and genotyped the participants using the HumanOmni5-Quad BeadChip, which provides a significant genome coverage for genetically-admixed and diverse populations, to evaluate the genetic basis and evidence for causality of any immune-inflammation marker that is associated with prostate cancer risk. We want to assess how germline genetics influence the abundance levels of these 82 markers in African American and European American men, which may contribute to differences between them.

  Study phs002939

• ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001231

• Fastq data for ChIP-Seq (H3K27ac) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27ac) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001403

• ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001233

• Fastq data for ChIP-Seq (Input) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (Input) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001409

• ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001232

• ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001234

• ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001229

• Fastq data for ChIP-Seq (H3K4me1) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me1) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001406

• ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001230

• Fastq data for ChIP-Seq (H3K27me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001404

• Fastq data for ChIP-Seq (H3K9me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K9me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001408

• Fastq data for ChIP-Seq (H3K36me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K36me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001405

• Fastq data for ChIP-Seq (H3K4me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001407

• March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies (Canadian Epigenetics, Environment and Health Research Consortium), Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001959

• Profiling of 27 type 2 diabetes GWAS loci using next-generation (NG) capture C in a human beta-cell model

  Most type 2 diabetes association signals are due to variants that impact gene regulation but identifying the genes they impact is challenging. We generated interaction profiles at 27 T2D GWAS loci using next-generation (NG) capture C (6 replicates) in the human beta-cell model, EndoC-betaH1, along with chromatin accessibility profiling using ATAC-Seq (9 replicates).

  Dataset EGAD00001008655

• Tumor inflammation and mutational burden are differentially associated with response to nivolumab or nivolumab plus ipilimumab in metastatic colorectal cancer

  Nivolumab alone and in combination with ipilimumab demonstrated durable clinical benefit in patients with previously treated microsatellite instability-high/mismatch repair-deficient metastatic colorectal cancer in the phase 2 CheckMate 142 study. Exploratory biomarker analyses of tumor and microbiome samples from CheckMate 142 were performed to evaluate associations between various biomarkers and the efficacy of nivolumab monotherapy and nivolumab plus ipilimumab combination in these patients. Higher expression of inflammation-related gene expression signatures was associated with improved response per investigator assessment and survival benefit with nivolumab monotherapy. In contrast, higher tumor mutational burden, tumor indel burden and degrees of microsatellite instability were associated with improved response per investigator assessment and survival benefit with nivolumab plus ipilimumab. While interpretation is limited by the exploratory nature of these analyses, they suggest that tumor antigenicity rather than baseline tumor inflammation might be important for the combinatorial efficacy. Validation of these findings in larger, randomized studies is necessary.

  Study EGAS50000000416

• Origins and functional consequence of somatic mitochondrial DNA mutations

  Recent sequencing studies have extensively explored the somatic alterations present in the nuclear genomes of cancers. Although mitochondria control energy metabolism and apoptosis, the origins and impact of cancer-associated mutations in mitochondrial DNA (mtDNA) are unclear. Here, we analysed somatic alterations in mtDNA from 1,675 tumors across 31 histologies. We identified 1,907 somatic substitutions, which exhibited dramatic replicative strand bias, predominantly C>T and A>G on the mitochondrial heavy strand. This strand-asymmetric signature differs from those found in nuclear cancer genomes but matches the inferred germline process shaping primate mtDNA sequence content. Numbers of mtDNA mutations showed considerable heterogeneity across tumor types. Missense mutations were selectively neutral and often gradually drifted towards homoplasmy over time. In contrast, mutations resulting in protein truncation undergo negative selection and were almost exclusively heteroplasmic. Our findings indicate that the endogenous mutational mechanism has far greater impact than any other external mutagens in mitochondria, and is fundamentally linked to mtDNA replication.

  Study EGAS00001000968

• Impact of mutational profiles on response of primary oestrogen receptor-positive breast cancers to oestrogen deprivation

  Presurgical studies allow study of the relationship between mutations and response of estrogen receptor positive (ER+) breast cancer to aromatase inhibitors (AIs) but have been limited to small biopsies. Here in Phase I of this study, we perform exome sequencing on baseline, surgical core-cuts and blood from 60 patients (40 AI treated, 20 Controls). In poor responders (based on Ki67 change) we find significantly more somatic mutations than good responders. Subclones exclusive to baseline or surgical cores   occur in approximately 30% of tumours. In Phase II we combine targeted sequencing on another 28 treated patients with Phase I. We find six genes frequently mutated: PIK3CA, TP53, CDH1, MLL3, ABCA13 and FLG with 71% concordance between paired cores. TP53 mutations are associated with poor response. We conclude that multiple biopsies are essential for confident mutational profiling of ER+ breast cancer and TP53 mutations are associated with resistance to oestrogen deprivation therapy.

  Study EGAS00001001940

• A biobank of patient-derived pediatric brain tumor models

  Brain tumors are the leading cause of cancer-related death in children. Genomic studies have provided insights into molecular subgroups and oncogenic drivers of pediatric brain tumors that may lead to novel therapeutic strategies. To evaluate new treatments, better preclinical models adequately reflecting the biological heterogeneity are needed. Through the Children’s Oncology Group ACNS02B3 study, we have generated and comprehensively characterized 30 patient-derived orthotopic xenograft models and 7 cell lines representing 14 molecular subgroups of pediatric brain tumors. Patient-derived orthotopic xenograft models were found to be representative of the human tumors they were derived from in terms of histology, immunohistochemistry, gene expression, DNA methylation, copy number, and mutational profiles. In vivo drug sensitivity of targeted therapeutics was associated with distinct molecular tumor subgroups and specific genetic alterations. These models and their molecular characterization provide an unprecedented resource for the cancer community to study key oncogenic drivers and to evaluate novel treatment strategies.

  Study EGAS00001002536

• Whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing data from nasal cells of COVID-19 patients

  Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dataset EGAD50000000398

• Bell_activation_timecourse

  We purified human naive and memory B cells from PBMCs. We stimulated them with IgM cross-linker providing BCR stimulation, multimeric CD40L that engages costimulatory receptor CD40 on the B cell, and cytokines IL-2 and IL-21. To comprehensively characterise activation dynamics of naive and memory B cells, we performed single-cell RNA sequencing (scRNA-seq) and B cell receptor sequencing (BCR-seq) in resting cells (day 0), before the first division (day 1), at the time of the first division (day 3) and following the full B cell differentiation (day 6)

  Dataset EGAD50000002115

• GEI Studies - Psoriasis

  The GEI Studies Project was started as an NIH consortium involving 5 disease groups with funding provided through the Genes, Environment, and Health Initiative (GEI). The objective of the project was to optimize strategies for identifying rare variants as a follow up to genome-wide association studies (GWAS) using next-generation sequencing technology. One of the five targeted diseases, Psoriasis, is a multifactorial skin disease characterized by epidermal hyperproliferation and chronic inflammation that affects approximately 2% of Americans. Because only about one-third of all patients with psoriasis have a relative who is also affected with the disorder, psoriasis is not widely recognized as a genetic disease. However, previous research on families and identical twins has shown psoriasis has a strong genetic component, although environmental factors (such as infections, stress, and injuries) are also important. Although no definite psoriasis gene has yet been identified, research during the last ten years has revealed over forty potential gene locations that may contribute to the disease. Large amounts of data generated using next-generation sequencing technology would provide a more detailed characterization of sequence variation which would in turn increase the likelihood of detecting causative loci. With the presumption that rare variants are frequently the cause of a large portion of phenotypic variation, it was necessary to use large sample sets. In the main body of this study, we sequenced 4,966 samples (812 dermatologist-diagnosed cases of purely cutaneous psoriasis (PsC), 1,497 cases of rheumatologist-diagnosed psoriatic arthritis, 665 cases of cutaneous psoriasis with uncertain psoriatic arthritis status (PsV) and 1,992 controls) across 5.7 Mb of sequence containing 100 psoriasis candidate loci and 769 genes. For each candidate locus, we considered sequences within 250 kb of the strongest association signal. Within this window, three strategies were employed. For ten of the strongest psoriasis signals, we used a whole-region approach which included non-coding intergenic and intronic sequence. For four established loci of lesser significance, we targeted all full transcription units within the +/- 250 kb interval. For the remaining signals, we targeted the exons of all transcription units within the +/- 250 kb interval. Due to complexities of high-efficiency targeting of HLA genes we selected 5 specific candidate genes for sequencing near the HLA-C gene.

  Study phs000766

• APCIM_Nanostring_FAP

  Expression of immune related genes in 12 familial adenomatous polyposis patients. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002553

• Single Nuclei RNA sequencing batch 2

  This dataset includes the 2 extra normal samples adjacent to PTC tumors that were multiplexed and profiled using kits from different batches.

  Dataset EGAD00001011364

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Modulation of Lung Immune Responses to Viral Infection-Microbiome Interactions with Respiratory Organoids

  Here, we colonized bronchial epithelial air-liquid interface tissue cultures with 58 different individual microbes. Following 18 and 48 hours of colonization, we performed bulk RNA-seq of the host epithelial cells (n=3). Overall, we found significant microbial species-level and strain-level variation in host gene expression changes for innate immunity and epithelial barrier genes. Of particular interest, we found significant heterogeneity in stimulation of host interferon and antiviral interferon-stimulated genes.Study registered in ImmPort under accession # SDY2281.

  Study phs003627

• Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application

  We established hypoimmunogenic human induced pluripotent stem cells (iPSCs) to minimize the immune rejection caused by mismatches of HLA type. Here, we optimized the protocol for good manufacturing practice (GMP)-compatible CRISPR-Cas9 genome editing to deplete the three gene locus (HLA-A, HLA-B, and CIITA genes) simultaneously in HLA homozygous iPSCs. RNA-seq and flow cytometry analyses confirmed the successful depletion of HLAs, and lineage-specific differentiation into cardiomyocytes was verified.

  Study EGAS50000001194

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, various peripheral blood immune cell subsets from 136 systemic lupus erythematosus (SLE) and 89 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA, Naive_CD8, Naive_B, SM_B, USM_B, DN_B, Plasmablast, NK, CD16p_Mono, CL_Mono, Neu, mDC, pDC, TEMRA_CD8, CM_CD8, EM_CD8, NC_Mono, Int_Mono, LDG). RNA-seq was performed with each cell subset samples.

  Study JGAS000627

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, 24 peripheral blood immune cell subsets from 50 Systemic Sclerosis and 48 Healthy Controls were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono, Int_Mono, NC_Mono, mDC, pDC). RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000296

• Comprehensive molecular profiling of pulmonary pleomorphic carcinoma

  Information regarding the molecular features of pulmonary pleomorphic carcinoma (PPC) is insufficient. Here, we performed next-generation sequencing to determine the genomic and transcriptomic profiles of PPC. Whole exome sequencing (WES) of fresh-frozen tissue samples and target-capture sequencing of formalin-fixed-paraffin-embedded (FFPE) samples were performed. Fresh-frozen tissue samples and FFPE samples were subjected to WES and target-capture sequencing as normal control, respectively. Fresh-frozen tissue samples and 56 FFPE samples were subjected to RNA-seq.

  Study JGAS000297

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  Various peripheral blood immune cell subsets from 89 healthy volunteers and 136 systemic lupus erhythematosus (SLE) donors were collected (Naive_CD4, Mem_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, NK, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, Neu, LDG). 22 SLE donors were analyzed longitudinally. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000486

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• Paired exome analysis in urothelial carcinoma

  In this study we characterized genomic alterations in two to five metachronous tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth), Ultra deep targeted sequencing (~6,809x mean read depth) and whole transcriptome RNA-seq was performed for all samples. In addition multiregional WES was performed on 8 adjacent regions from a single tumor.

  Study EGAS00001001686

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• BAM files of total RNA-Seq data of POPS control samples (GRCh37)

  Placental biopsies (n = 64 female placentas, n = 67 male placentas) were selected from healthy pregnancies from the POPs cohort. A quality control process was also applied for the RNA-Seq datasets: reads were trimmed with Trim Galore!, which uses cutadapt internally and were mapped to the same version of human genome reference (hg19). TopHat2, a splice-aware mapper built on top of Bowtie2 short-read aligner, was used in the mapping process in which so-called two-pass (or two-scan) alignment protocol was applied to rescue unmapped reads from the initial mapping step. In the second mapping, previously unmapped reads were re-aligned to the exon-intron junctions detected in the first-mapping by TopHat2 and were combined across all 131 placenta samples. The initial and second mapped reads were merged by samtools

  Dataset EGAD00001003462

• A Comprehensive Catalogue of Somatic Mutations from a Human Cancer Genome

  We previously reported the whole-genome sequencing of the well-studied human malignant melanoma cell line, COLO-829, and a lymphoblastoid cell line from the same individual, providing the first comprehensive catalogue of somatic mutations from an individual cancer (Pleasance et al. (2010) Nature 463, 191). This initial study was carried out using the Illumina Genome Analyzer II, largely using paired-end reads of 75 bases from standard Illumina paired-end libraries. Here we report the results of sequencing the genomes of COLO-829 and its matched lymphoblastoid sample using HiSeq2000 with v3 cluster-generation and sequencing chemistries. This has significantly improved the evenness and completeness of genomic coverage, particularly in areas of extreme sequence composition that were underrepresented in the initial study.

  Study EGAS00001000245

• Study of biomarkers implicated in radio-immunotherapy response in metastatic cancer

  RNA sequencing data of tumors from 53 patients with advanced or metastatic cancer

  Dataset EGAD50000001644

• Neoantigen study samples for prostate cancer

  Whole exome sequencing and RNA sequencing data from 30 patients with prostate cancer.

  Dataset EGAD00001005713

• Long read mRNA sequencing of human neural retinal samples - Usher syndrome transcript landscape

  Long-read (PacBio) RNA sequencing dataset of three neural retinal samples. Three PacBio libraries were prepared according the 'standard workflow' optimized for sequencing transcripts centered around 2kb. Additionally one Library (input HNR_S2) was prepared according an optimized 'long workflow' to enrich for larger transcripts up to >10kb. To further enhance the capture of full-length transcripts for USH2A and ADGRV1 (USH2C) genes, we also employed a targeted enrichment approach using the Samplix Xdrop System, followed by PacBio long-read sequencing. USH2A and ADGRV1 enrichment was performed by targeting '5- mid and 3' targets of the respective genes. Finally, we also added ONT (Oxford Nanopore technology) long-read mRNA sequencing of three independent neural retina samples. These data were used for the validation of events observed from the Iso-Seq and Samplix data. The ONT datasets contain sequencing data of the Usher-associated genes. Files are raw BAM, and CRAM format files generated by a Sequel II machine. Additionally, the ccs3 BAM format files are included.

  Dataset EGAD50000000720

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• DNA-seq BAM files from 16 patients affected by acute intermittent porphyria

  Paired-end BAM files from 16 patients affected by acute intermittent porphyria. Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001006951

• DAC for Studies of "Genetics and Genomics of Cardiovascular Diseases" Group at MDC Berlin, Germany

  DAC for Studies of "Genetics and Genomics of Cardiovascular Diseases" Group at MDC Berlin This is an umbrella DAC.

  Dac EGAC50000000481

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• Multimodal cell-free DNA whole-genome TAPS is sensitive and reveals specific cancer signals

  This study presents a methodology for detecting circulating tumor DNA (ctDNA) using deep whole-genome TET-Assisted Pyridine Borane Sequencing (TAPS), a less destructive alternative to bisulphite sequencing. The method enables simultaneous analysis of genomic and methylomic data for multi-cancer detection and monitoring minimal residual disease. In a diagnostic accuracy study across various cancer types, it achieved 85.3% sensitivity and 88.8% specificity, with validation done using matched tumour biopsies. Additionally, in silico validation showed strong discrimination at low ctDNA levels. The approach also successfully tracks tumour burden and ctDNA shedding from precancerous lesions post-treatment, making it ready for further clinical testing.

  Study EGAS50000000715

• Loss of RREB1 in pancreatic beta cells reduces cellular insulin content and affects endocrine cell gene expression

  Genome-wide studies have uncovered multiple independent signals at the RREB1 locus associated with altered type 2 diabetes (T2D) risk and related glycemic traits. However, little is known about the function of the zinc finger transcription factor RREB1 in glucose homeostasis or how changes in its expression and/or function influence diabetes risk. We studied its function using three transcriptomic strategies, profiling gene expression when RREB1 is knocked out or knocked down in the Endo-betaH1 cell line, in addition to the in vitro differentiation in hiPSCs.

  Dataset EGAD00001009740

• Proteogenomic Landscape of Squamous Cell Lung Cancer

  To provide a detailed analysis on how genomic and transcriptomic alterations related to proteome level changes in squamous cell lung cancer (SCC), we performed an integrated analysis incorporating DNA copy number, somatic mutations, expression RNA-sequencing, and expression proteomics in 108 SCC nested within clinical outcome, tumor pathology, and other clinically relevant data.

  Study phs001781

• DAC for study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer."

  This is Data Access Committee will oversee data sharing for sequence data in the EGA study: "Combination pembrolizumab and radiotherapy induces systemic anti-tumor immune responses in immunologically-cold non-small cell lung cancer." This dataset includes 116 bam files from whole exome sequencing on the Illumina HiSeq2500, 102 fastq files from RNA sequencing on the Illumina NovaSeq 6000. The samples analyzed include tumor/normal DNA samples and tumor RNA samples from 72 individuals with non-small cell lung cancer treated with pembrolizumab and SBRT or pembrolizumab alone on the NCT02492568 trial.

  Dac EGAC50000000202

• Integrated Somatic and Germline Molecular Properties Dictating Biological and Clinical Phenotypes in Cancer

  We performed single-nuclei matched RNA- and ATAC-sequencing of frozen biopsies from normal adjacent tissue, primary and metastatic esophageal adenocarcinoma specimens. The data was then further stratified into a tumor microenvironment and malignant compartment and was computationally analyzed to reveal cancer cell subtypes and programs driving malignancy.

  Study phs003438

• RNASeq profiles from Indian HFrEF Cohort

  The dataset contains whole transcriptomics profiling from a cohort of 49 HFrEF patients. The myocardium samples were collected from these patients during heart transplant of LVAD implantation procedure. The RNA samples were collected in RNAlater. Total transcriptome libraries were prepared using TruSeq Stranded Total RNA Library Prep with Ribo-Zero Gold kit and sequenced on Illumina HiSeq4000.

  Dataset EGAD50000001196

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - RNAseq

  Ependymomas (EPN) are the third most common malignant brain cancer in children. Treatment strategies for pediatric EPN have remained unchanged over recent decades, with 10-year survival rates stagnating at just 67% for children aged 0-14 years. Moreover, patients who survive treatment for the most common subtype of pediatric EPN (posterior fossa A (PFA)), often suffer long-term neurological side effects as a result of therapy. It is evident that there is a need for safer, more effective treatments for pediatric EPN patients. There are ten distinct subgroups of EPN, each with their own molecular and prognostic features. To identify and facilitate the testing of new treatments for EPN, in vivo laboratory models representative of the diverse molecular subtypes are required. Here, we describe the establishment of a patient-derived orthotopic xenograft (PDOX) model of PFA EPN, derived from a metastatic cranial lesion. Patient and PDOX tumors were analyzed using immunohistochemistry, DNA methylation profiling, whole genome sequencing (WGS) and RNA sequencing. Both patient and PDOX tumors classified as PFA EPN by methylation profiling, and shared similar histological features consistent with this molecular subgroup. RNA sequencing revealed that gene expression patterns were maintained across the primary and metastatic tumors, as well as the PDOX. Copy number profiling revealed gains of chromosomes 7, 8 and 19, and loss of chromosomes 2q and 6q in the PDOX and matched patient tumor. No clinically significant single nucleotide variants were identified, consistent with the low mutation rates observed in PFA EPN. Overexpression of EZHIP RNA and protein, a common feature of PFA EPN, was also observed. Despite the aggressive nature of the tumor in the patient, this PDOX was unable to be maintained past two passages in vivo. Others who have successfully developed PDOX models report some of the lowest success rates for EPN compared to other pediatric brain cancer types attempted, with loss of tumorigenicity not uncommon, highlighting the challenge in propagating these tumors in the laboratory. Here, we discuss our collective experiences with PFA EPN PDOX model generation and propose potential approaches to improve future success in establishing preclinical EPN models

  Study EGAS00001006844

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Dac EGAC00001000741

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391