15038 results for "cancer studies using rna-seq"

in 39.64 milliseconds.

• Personalized Breast Cancer Vaccines Based on Genome Sequencing

  This study is from a phase I clinical trial of neoantigen DNA vaccines in triple negative breast cancer patients with persistent disease following neoadjuvant chemotherapy. The exome and RNA sequences used to identify somatic mutations, predict neoantigens, and design vaccines is within.

  Study phs002787

• Application of organoid culture system of human gastrointestinal and thoracic cancer in genome medicine

  In order to establish preclinical models, we have established a kind of lung cancer tumoroids derived from a mucus-producing solid pulmonary adenocarcinoma patient. We performed whole exome sequencing and RNA sequencing to analyze genetic background of the tumoroids.

  Study JGAS000664

• Application of organoid culture system of human gastrointestinal and thoracic cancer in genome medicine

  In order to establish preclinical models, we have established a kind of lung cancer tumoroids derived from a mucus-producing solid pulmonary adenocarcinoma patient. We performed whole exome sequencing and RNA sequencing to analyze genetic background of the tumoroids.

  Study JGAS000653

• WGS of CTCs enriched using high-throughout microfluidic device from entire cancer patient leukopak

  Single-cell low-pass WGS analysis (illumina platform, PE150, 1-2x coverage) was performed on CTCs enriched using high-throughout microfluidic device from entire leukopak from patients with metastatic prostate cancer (GU-1 and GU-2) and metastatic hepatocellular carcinoma (HCC-1 and HCC-2).

  Study EGAS50000000723

• Paraganglioma Smart-Seq2 Single Nuclei Sequencing Data

  Paraganglioma is a rare neuroendocrine tumor that originates from chromaffin cells of the adrenal medulla or extra-adrenal paraganglia. This study aims to investigate the heterogeneity of this tumor and to identify potential biomarkers associated with its malignancy. To achieve this, we performed single-nucleus RNA sequencing of human paraganglioma samples using the SMART-Seq2 protocol.

  Study EGAS50000001184

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• A Tumour Organoid Biobank for Mapping Cancer Cell Vulnerabilities - RNA

  RNA sequencing data from cancer patient-derived organoids. Part of a study to include genomic and transcriptomic sequencing data, along with CRISPR screening data from cancer patient-derived organoids and matched tumour tissues. Some organoids were developed as part of the Human Cancer Models Initiative (HCMI) in collaboration with Cancer Research UK (CRUK). The study includes organoids derived from colorectal, oesophageal, ovarian, pancreatic, and stomach cancer samples.

  Dataset EGAD00001015470

• GTestimate: Improving relative gene expression estimation in scRNA-seq using the Good-Turing estimator

  This study introduces a novel scRNA-seq normalization method, which takes unobserved genes into account. To validate GTestimate we designed a cell targeted amplification strategy, enabling us to sequence a small set of cells twice, once at a "typical" sequencing depth and once at a "ultra-deep" sequencing depth.

  Study EGAS50000000915

• scRNA-seq of HSPC treated with gemcitabine and carboplatin

  4 samples of 2000000 HSPCs in 2 ml media each were then prepared and treated for 24 hours: carboplatin-high: 150 µg/ml carboplatin carboplatin-low: 18.75 µg/ml carboplatin gemcitabine: 25 ng/ml gemcitabine control: no drug Single-cells were subsequently extracted using the ddSEQ™ Single-Cell Isolator (Bio-Rad) and later sequenced using the SureCell™ Whole Transcriptome Analysis 3' Library Prep Kit (Illumina) on the NextSeq 500 System (Illumina) using the NextSeq 500/550 High Output Kit v2.5 150 Cycles (Illumina) all following the manufacturer's instructions. The raw FASTQ-files are available as read 1 and read 2 files from 4 lanes for each sample giving a total of 16 FASTQ-files. The FASTQ-files were also processed following the ddSeeker (Romagnoli, D., et al., BMC Genomics 2018, doi:10.1186/s12864-018-5249-x) and Drop-seq (Macosko, E.Z., et al., Cell 2015, doi:10.1016/j.cell.2015.05.002) protocols for processing scRNA-seq data to yield the final digital gene expression (dge) for each cell of each sample. This has resulted in one dge text file and one dge summary text file per sample. These 8 text-files with dge data are found in the zip-compressed analysis data-file.

  Dataset EGAD00001006080

• Single-cell characterization of human GBM reveals regional differences in tumor-infiltrating leukocyte activation

  Raw sequencing files from scRNA-seq dataset used in Schmassmann et al. 2023. Single-cell characterization of human GBM reveals regional differences in tumor-infiltrating leukocyte activation. Elife 12 (https://elifesciences.org/articles/92678) Dataset content: 14 samples from 5 donors File type: paired-end fastq files Technology: Illumina sequencing Experimentation used: scRNA-seq using the 10X technology

  Dataset EGAD50000000434

• TRACERx 100: metastatic samples

  Whole exome sequencing of 10 metastatic biopsies from four TRACERx100 patients (see EGA dataset EGAS00001002247), collected either after relapse or death. The data from these samples are initially published with Abbosh, C. et al. Phylogenetic ctDNA analysis depicts early stage lung cancer evolution. Nature http://dx.doi.org/10.1038/nature22364 (2017). Abstract: Earlier detection of relapse following primary surgery for non-small cell lung cancer and the characterization of emerging subclones seeding metastatic sites might offer new therapeutic approaches to limit tumor recurrence. The potential to non-invasively track tumor evolutionary dynamics in ctDNA of early-stage lung cancer is not established. Here we conduct a patient-specific approach to ctDNA profiling in the first 100 lung TRACERx (TRAcking Cancer Evolution through therapy (Rx)) study participants, including one patient co-recruited to the PEACE (Posthumous Evaluation of Advanced Cancer Environment) post-mortem study. We identify independent predictors of ctDNA release in early-stage non-small cell lung cancer and perform tumor volume limit of detection analyses. Through blinded profiling of post-operative plasma, we observe evidence of adjuvant chemotherapy resistance and identify patients destined to experience recurrence of their lung cancer. Finally, we show that phylogenetic ctDNA profiling tracks the subclonal nature of lung cancer relapse and metastases, providing a new approach for ctDNA driven therapeutic studies.

  Study EGAS00001002415

• MutWP1__CRUK_Grand_Challenge_Mutographs_of_Cancer__head___neck

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, the International Agency for Research on Cancer is coordinating the recruitment of 5000 individuals with cancer (colorectal, renal, pancreatic, oesophageal adenocarcinoma or oesophageal squamous cancers) across 5 continents to explore whether different mutational signatures explain marked variation in incidence. In brief, through an international network of collaborators around the world, biological materials are collected, along with demographic, histological, clinical and questionnaire data. Whole genome sequences of tumour-germline DNA pairs are generated at the Wellcome Trust Sanger Institute. Non-tumour DNA is also studied for some cancer types. Somatic mutational signatures are subsequently extracted by non-negative matrix factorisation methods and correlated with risk factors data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001005450

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• Sequencing of in vitro generated macrophages and T cells

  Monocyte derived macrophages were polarised into M1 or M2 using IFNg+ ILP or IL-4 respectively (n =4) . Pan T cells were cultured with or without IL-2 for 4 days (n=4 - 6). Pan T cells were co-cultured with THP1 tumour cells for 20 hours in the presence or absence of ImmTAC molecules and in the presence or absence of M2 macrophages. Sorted T cells and macrophage populations prior and post co-culture were analysed by bulk RNA sequencing (60 million reads per sample) using the Illumina NovaSeq system.

  Study EGAS50000000837

• The polarity and specificity of antiviral T lymphocyte responses determine susceptibility to SARS-CoV-2 infection in cancer patients and healthy individuals

  We monitored patient's anti SARS-CoV-2 immune responses using an in vitro cross presentation assay. The goal of this study was to identify immune correlates of clinical protection against SARS-CoV-2 infection. Briefly, peripheral blood mononuclear cells of patient were divided into a monocyte and lymphocyte. Monocyte were differentiated into monocyte derived dendritic (mo-DC)cells using GM-CSF and Interferon alpha. Mo-DC were then loaded with SARS-CoV-2 culture lysates , or VeroE86 lysates. SARS-CoV-2 loaded mo-DC were then used to stimulates their autologous lymphocytes and T cell cytokine secretion was monitored in the supernatant. We discriminated patients producing IL-2 and patients producing IL-5. RNA sequencing was performed for 18 patients, to identify gene profile associated with IL-2 or IL-5 production.

  Dataset EGAD00001008538

• Subtype specific studies of breast cancer progression. Milan cohort.

  The aim of this study is to compare DCIS and IBC in a subtype stratified manner in several genomic levels (gene expression, copy number, methylation).The data in this archive is supplementary to previously published data.

  Study EGAS00001004390

• Dataset for leiomyosarcoma-EXON

  Rare cancer sequencing data of 96 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008885

• Dataset for bone_cancer-EXON

  Rare cancer sequencing data of 87 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008865

• Dataset for hematopoietic_malignancy-WHOLE_GENOME

  Rare cancer sequencing data of 49 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008881

• Dataset for leiomyosarcoma-WHOLE_GENOME

  Rare cancer sequencing data of 66 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008887

• Dataset for upper_gastrointestinal_tumor-EXON

  Rare cancer sequencing data of 85 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008902

• Dataset for other_cancer-WHOLE_GENOME

  Rare cancer sequencing data of 49 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008895

• Molecular Signatures of DCIS to Invasive Progression for Basal-Like Breast Cancers: An Integrated Mouse Model and Human Tumor Study

  We studied the genomic signatures of progression in breast ductal carcinoma in situ (DCIS) as it progresses towards triple negative invasive breast cancer (TNBC). Single cell RNA sequencing (scRNAseq) was performed on the C3Tag genetically engineered mouse model that forms human breast-like DCIS and TNBC. Bulk RNA sequencing was performed on RNA harvested from archival formalin-fixed, paraffin embedded (FFPE) pairs comprising of estrogen receptor (ER) positive (ER+) and negative (ER-) subsets of DCIS. 

  Study phs002443

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354

• Assessment of epigenetic variation in human iPS cells-Medip

  n order to progress human induced pluripotent stem cells (hiPSCs) towards the clinic, several outstanding questions must be addressed. It is possible to reprogram different somatic cell types into hiPSCs and from studies in the mouse, it appears that an epigenetic memory of the starting cell type is carried over to hiPSCs. However a comprehensive comparative study of the characteristics of these hiPSCs has been missing from the literature. Importantly studies which aimed to address these aspects of hiPSCs have used cells from different patients. In order to avoid this important confounding variable and to keep the genetic background constant, tissue samples were procured from the patients and reprogrammed to iPS cells. The methylation status of these iPS cells will be compared. Protocol: Primary cell cultures were generated and reprogrammed to iPS cells. DNA was extracted and immunoprecipitated using anti-methyl cytosine and anti-hydroxymethyl cytosine antibodies. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Dataset EGAD00001000827

• Starr County Health Studies' Genetics of Diabetes Study

  An initial observation in the 1970s that Starr County, Texas, had the highest diabetes-specific mortality of any of the 254 Texas counties led to the establishment of a field office in Rio Grande City, Texas (the county seat of Starr County) and the initiation of a series of studies to understand the epidemiology and genetics of type 2 diabetes, its complications and related conditions in this predominantly (97%) Mexican American population. The field office opened in February 1981 and has operated continuously since then. During this time, three systematic surveys of the population have been conducted as well as family and longitudinal studies. Culturally sensitive diabetes education programs have been developed and implemented and also a weight loss intervention. In total, more than 23,000 Mexican American individuals have been examined with more than 200,000 aliquots of biological specimens stored. Collectively, these studies are known as the Starr County Health Studies. The present Genetics of Diabetes Study has the goal of identifying loci/alleles that underlie susceptibility to type 2 diabetes in this high risk population using genome wide markers and association testing. The study makes use of two primary resources that have been developed in order to identify 1,000 type 2 diabetes cases and 1,000 disease free controls. In the first instance we have identified a subset of unrelated cases from the total cases that we have identified. Where multiply affected sibships were available, the youngest onset case with detailed phenotyping (including assessment of diabetic retinopathy) was selected. Controls came from a recent survey to establish a representative sample of the Starr County population. Blocks were randomly selected, households on selected blocks enumerated and one individual randomly selected from each household for a detailed examination. The examination included an oral glucose tolerance test. Those included as controls are those with no prior diagnosis of diabetes and a negative oral glucose tolerance test. This collection of cases and controls provides the opportunity to identify susceptibility loci for type 2 diabetes and its complications, specifically diabetic retinopathy and albuminuria. The data set also allows the examination of impaired fasting glucose and impaired glucose tolerance. The samples are split between those born in the United States and those born in Mexico and this gives a natural contrast for examining genotype and environmental interactions. It is anticipated that the understanding that will come will lead to strategies for delaying and preventing the onset of diabetes and its complications.

  Study phs000143

• RNA sequencing of periprostatic fat after a 6 month deep androgen deprivation therapy

  Androgen deprivation therapy treated patients (n=11) were recruited from an open label neoadjuvant phase II study in which patients with high-risk disease received a ‘supercastration’ regimen consisting of degarelix 240/80 mg subcutaneously every four weeks; abiraterone acetate 500 mg orally daily titrating upwards every two weeks by 250 mg to a final dose of 1000 mg daily; bicalutamide 50 mg orally daily; and prednisolone 5 mg orally twice daily for a total of 6 months (Australian New Zealand Clinical Trials Registry 12612000772842). Untreated patients with similar pre-treatment characteristics were obtained from a prospective prostatectomy biorepository22,23. Prior to ligation of the dorsal venous complex and prostate pedicles, the anterior prostate was defatted and the specimen was removed immediately, placed in a sterile container and transferred on ice for long-term storage in the vapour phase of liquid nitrogen. A total of 50–100 µg of adipose tissue was separated from fresh frozen samples stored at −160°C. RNA was isolated using the Qiagen RNeasy Lipid Tissue Mini Kit and eluted in 35 µL nuclease-free water. 0.5–1 µg of total RNA was used as the input for cDNA library synthesis using TruSeq RNA Sample Prep Kit v2 (Illumina), and libraries were constructed according to manufacturer’s instructions. Samples were sequenced on a HiSeq 2500 (Illumina) using 101 base paired-end chemistry, aiming for 50 million mapped paired-end reads per sample.

  Dataset EGAD00001004971

• Data access committee for "Detection of brain cancer using genome-wide cell-free DNA fragmentomes"

  The data access committee for “ Detection of brain cancer using genome-wide cell-free DNA fragmentomes”. The DAC is comprised of Drs. Dimitrios Mathios, Jillian Phallen, Victor Velculescu, Robert Scharpf, Noushin Niknafs, and Shashikant Koul, and can be contacted at skoul3@jh.edu.

  Dac EGAC50000000605

• DNA WGS Short Read Sequence (Illumina NovaSeq) for manuscript titled: "Performance of Somatic Structural Variant Calling in Lung Cancer using Oxford Nanopore Sequencing Technology"

  DNA WGS Short Read Sequence (Illumina NovaSeq) for manuscript titled: "Performance of Somatic Structural Variant Calling in Lung Cancer using Oxford Nanopore Sequencing Technology"

  Dataset EGAD00001015399

• Identification of early disease progression in ALK-rearranged lung cancer using circulating tumor DNA analysis (hipo_K34R)

  Study EGAS00001005327

• Dataset of 5 RNAseq from 3 non-muscle-invasive bladder cancer patients

  RNAseq (FASTQ files) of 5 tumor from 3 non-muscle-invasive bladder cancer patients. For patient UC2, RNA from 3 different synchronous tumors was extracted. Relating to the other datasets from the project : no RNA was available from patient UC4. NB : patients aliases are the following : ROXY : UC1, OMAD : UC2, MAKI : UC3, HAPE : UC4

  Dataset EGAD50000002009

• Human lymphoma plasma cfRNA - raw data

  This study contains total RNA sequencing data from plasma of 65 different human donors: 30 diffuse large B-cell lymphoma patients, 13 primary mediastinal large B-cell lymphoma patients and 22 cancer-free controls.

  Study EGAS00001007127

• Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Dataset EGAD00001015397

• Effects of 2DG, Galactose, or Oligomycin on the epigenome remodeling induce by T cells activation.

  T cell activation is known to require a metabolic shift towards glycolysis, triggered by TCR-engagement . To substantiate the role of glycolysis in transcriptional reprogramming during antigen-driven T cell activation, we utilized a well-established ex-vivo model to recapitulate the process of antigen stimulation without the requirement for additional antigen-presenting cells . We initially explored and validated the conditions for both metabolic and epigenetic reprogramming. Antigen-mediated CD4+ T cells activation initiates context-specific gene-expression programs that drive effector functions and cell fates through changes in the epigenetic landscape . To evaluate global changes in histone modifications, we isolated CD4+ T cells from peripheral blood (PB) of healthy control (HC) human donors and either maintained them in resting conditions or stimulated with anti-CD3/CD28 for 24h. Rapid changes in the CD4+ epigenome and transcriptome were observed within 24h as measured by RNA-sequencing (RNA-seq) and H3K27ac chromatin immunoprecipitation followed by DNA-sequencing (ChIP-seq).To explore the requirement for metabolic reprogramming in regulating transcriptional responses after initial TCR engagement, CD4+ T cells from PB of healthy donors were isolated and activated in either the presence or absence of oligomycin (inhibitor of ATP synthase blocking the production of ATP by OXPHOS), 2-deoxyglucose (2DG; competitively inhibiting production of glucose-6-phosphate from glucose), or replacement of glucose with galactose. Galactose is metabolized through glycolysis, utilizing the Leloir pathway which is energy neutral, forcing cells to use all the pyruvate production to sustain the TCA cycle for OXPHOS and ATP synthesis at the expense of lactate production. Employing ChIP-seq and RNA-seq, inhibition of OXPHOS-mediated ATP production by oligomycin had only a limited effect on H3K27-acetylation or activation-induced transcription during the first 24h of activation. In contrast, inhibition of glycolysis by 2DG treatment compromised both H3K27-acetylation and transcriptional changes. However, under conditions of galactose-metabolism where lactate production is abrogated, activated CD4+ T cells were still able to globally remodel H3K27 acetylation and reprogram the transcriptome.

  Study EGAS00001007115

• Identification of molecule relationship between intravenous leiomyomatosis and uterus myoma

  Up to now, there are two hypothesis about the pathogenesis of the relationship of intravenous leiomyomatosis and uterine myoma. One theory suggests that the IVL comes from the smooth muscle cell in the vessel wall.The other theory indicates that the IVL derives from the uterine myometrium. However, limited to the technology, few studies have been deeply explore the underlying relation. In this study, we employ the RNA sequencing to explore the molecule relationship between IVL and uterus myoma. In order to identify the molecule relationship between IVl and uterine myoma we conducted transcriptome sequencing and bioinformaitc analysis

  Dataset EGAD00001003356

• Targeted NGS panel

  The mutational status of 121 genes recurrently altered in B-cell lymphoma was examined in 55 of 56 diagnostic and 10 of 12 relapse samples using a custom targeted NGS panel. Libraries were generated from 150 ng of DNA using molecular-barcoded library adapters (ThruPLEX Tag- seq kit; Takara) coupled with a custom hybridization capture-based method (SureSelectXT Target Enrichment System Capture strategy, Agilent Technologies). The quality of the libraries was determined using the Bioanalyzer high sensitivity DNA kit (Agilent) and quantified by PCR using the KAPA library quantification kit (KAPA Biosystems). Finally, the libraries were pooled and sequenced in the MiSeq instrument (Illumina).

  Dataset EGAD00001010842

• Neuroblastoma patient Total RNA Seq data

  Tumor Total RNA Seq data of primary neuroblastomas. This is an update of the „Berlin Neuroblastoma Dataset” (EGAS00001004022). This data was used for the analysis of circular RNA expression and regulation in neuroblastoma.

  Dataset EGAD00001008124

• Batch-corrected read-count matrix of the RNAseq Datasets of CLUSTER JIA pre-MTX cohort

  Samples were sequenced with NovaSeq6000 and the sequencing files were processed using the RSSnextflow workflow (https://gitlab.com/b8307038/rssnextflow). The raw read counts from all batches were combined. Analysis-ready batch-corrected read counts were generated using ComBat-seq.

  Dataset EGAD50000002169

• COVID_Methyl_scRNA

  DAC for the study of whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing of nasal cells from COVID-19 patients. Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dac EGAC50000000197

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The dataset comprises 27 single-cell multiome (ATAC + GEX) datasets generated from 13 patients with AML, collected across different stages of disease progression. In addition, matched long-read sequencing data from 5 samples were used to enable longitudinal analyses throughout the manuscript. Finally, bulk RNA-seq and ATAC-seq datasets from the cell line used in this study are also included.

  Dataset EGAD50000002359

• MutWP1__CRUK_Grand_Challenge_Mutographs_of_Cancer__Oesophageal_squamous_cell_carcinoma

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, the International Agency for Research on Cancer is coordinating the recruitment of 5000 individuals with cancer (colorectal, renal, pancreatic, oesophageal adenocarcinoma or oesophageal squamous cancers) across 5 continents to explore whether different mutational signatures explain marked variation in incidence. In brief, through an international network of collaborators around the world, biological materials are collected, along with demographic, histological, clinical and questionnaire data. Whole genome sequences of tumour-germline DNA pairs are generated at the Wellcome Trust Sanger Institute (Illumina HiSeqX, 40X and 20X depth respectively). Somatic mutational signatures are subsequently extracted by non-negative matrix factorisation methods and correlated with risk factors data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001002725

• MutWP1__CRUK_Grand_Challenge_Mutographs_of_Cancer__pancreas

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, the International Agency for Research on Cancer is coordinating the recruitment of 5000 individuals with cancer (colorectal, renal, pancreatic, oesophageal adenocarcinoma or oesophageal squamous cancers) across 5 continents to explore whether different mutational signatures explain marked variation in incidence. In brief, through an international network of collaborators around the world, biological materials are collected, along with demographic, histological, clinical and questionnaire data. Whole genome sequences of tumour-germline DNA pairs are generated at the Wellcome Trust Sanger Institute (Illumina HiSeqX, 40X and 20X depth respectively). Somatic mutational signatures are subsequently extracted by non-negative matrix factorisation methods and correlated with risk factors data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001002726

• The Sea Islands Genetic Network (SIGNET): Identifying genetic contributors to diabetes and dyslipidemia in African Americans

  Recent genome-wide association studies (GWAS) have successfully identified genetic variants that influence diabetes risk in European populations, however most do not have a major impact on diabetes risk in populations of African descent. The African American (AA) population from the Sea Islands of coastal South Carolina and Georgia has high rates of type 2 diabetes, low levels of admixture, and in general, consume a diet rich in saturated fats. We postulate that this unique combination of ancestral and environmental factors results in a more consistent penetrance of diabetes risk alleles, as well as enrichment of risk alleles of African origin. The existing DNA samples and rich phenotypic data from the Sea Island Families Project comprise a unique resource for genetic studies of type 2 diabetes and related metabolic traits such as dyslipidemia. Our central hypothesis is that the increased risk for T2DM in AA compared with European American (EA) is due, in part, to susceptibility alleles of African origin, and that these alleles can be identified using a GWAS. The Specific Aims are to: 1) Identify genetic risk factors for type 2 diabetes utilizing DNA samples and data from the Sea Island Families Project, Reasons for Geographic and Racial Differences in Stroke (REGARDS) Study recruited from SC, GA, NC, and AL; and a GWAS approach; 2) Identify genetic contributors to lipoprotein subclasses in African Americans using the lipoprotein subclass profile (particle size and concentration for multiple subclasses of VLDL, LDL, and HDL) assessed by NMR at LipoScience, Inc., and the GWAS data from Aim 1. The rationale for this project is that identification and validation of novel pathophysiological pathways and informed selection of candidate genes for diabetes risk will inform development of new, targeted prevention and treatment strategies in this underserved, high risk population.

  Study phs000433

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• minION fastq files of 10 different tumor samples from the Master program (H021)

  Nanopore RNA Sequencing was done for 10 tumor samples. Direct cDNA sequencing was performed using the SQK-DCS109 kit (Oxford Nanopore Technologies). For analysis of a single sample on a MinION flow cell (version R9.4.1), 5 μg RNA was used as input. For multiplexing on a MinION flow cell, 2.5 μg RNA per sample was used as input, and the native barcoding expansion kit EXP-NBD104 was employed in conjunction with SQK-DCS109. After reverse transcription with Maxima H Minus Reverse Transcriptase (Thermo Scientific), second-strand synthesis was performed using the 2x LongAmp Taq Master Mix (New England Biolabs). The resulting double-stranded cDNA was subjected to end-repair and dA-tailing using the NEBNext Ultra End Repair/dA-Tailing Module (New England Biolabs). For multiplexed libraries, this step was followed by barcode ligation and library pooling. Next, libraries were quantified with a Qubit Fluorometer 3.0 (Life Technologies). Finally, sequencing adapters were added to the library preparations and ligated with Blunt/TA Ligase Master Mix (New England Biolabs), followed by further quality control using a Qubit. Samples ACC1 and ACC2 were analyzed on individual MinION flow cells, while the remaining eight samples were sequenced as multiplexed libraries on two MinION flow cells by pooling four samples for each run. Five ACC samples were also analyzed individually on Flongle flow cells

  Dataset EGAD00001008970

• Uncovering tumor intrinsic and extrinsic factors that regulate hepatocellular carcinoma growth using patient derived xenograft assays

  Exome Sequencing and RNA Sequencing Data for PDX Samples

  Dataset EGAD00001005734

• Circulating Tumor DNA in Intermediate Risk Rhabdomyosarcoma

  In this study, we evaluated circulating tumor DNA (ctDNA) as a biomarker in the serum of 124 patients with newly diagnosed intermediate risk rhabdomyosarcoma (IR RMS) from the Children's Oncology Group (COG) biorepository. In addition to pre-treatment serum, we also analyzed matched tumor tissue and germline in a subset of patients. We profiled samples using ultra-low passage whole genome sequencing (ULP-WGS) and a new custom hybrid-capture sequencing assay, Rhabdo-Seq, to detect copy number alterations, rearrangements, and single nucleotide variants. We found that patients with detectable ctDNA at diagnosis had significantly worse outcomes than those without detectable levels of ctDNA. Our study demonstrates that baseline ctDNA detection is feasible and prognostic in IR RMS. The ULP-WGS and targeted next-generation sequencing (Rhabdo-Seq and TranSS-Seq) data are available in this study.  

  Study phs002866

• RNASeq profiles of ROBUST clinical trial and processed WGS mutation calls output

  The dataset contains RNAseq profiles of 1040 patients from the ROBUST clinical trial (NCT02285062). The Allprep DNA/RNA FFPE kit was used to simultaneously purify genomic DNA and total RNA from formalin-fixed, paraffin embedded (FFPE) tissue sections. RNAseq libraries (75PE, 50M) were constructed using Illumina TruSeq RNA Access method. Fastq files are included. Also includes processed WGS mutation calls output.

  Dataset EGAD50000000482

• RNA Sequencing of Control and Myotonic Dystrophy Type 1 Cells During Myogenic Differentiation

  To investigate gene expression dynamics during myogenic differentiation in myotonic dystrophy type 1, RNA was collected from immortalized control, patient-derived, and CRISPR/Cas9-corrected myoblasts at proliferation (day -2) and at days 1 and 5 of differentiation. High-quality RNA was isolated and sequenced using poly(A)-enriched or rRNA-depleted protocols, yielding 100 bp paired-end reads with high coverage. A subset of samples at day 1 underwent deeper sequencing to enhance transcriptome resolution.

  Dataset EGAD50000001647

• Using RNA-sequencing to characterize the resistance to lirafugratinib

  In addition to Exome-sequencing, we used RNA-sequencing to also characterize resistance to lirafugratinib with whole exome sequencing in patients with FGFR2-driven cancers, treated in the phase 1/2 ReFocus trial (NCT04526106) and enrolled in the UNLOCK program at Gustave Roussy

  Study EGAS50000001370

• Single-cell RNA sequencing of erythroid and megakaryocytic acute myeloid leukemia patient cells

  Single-cell RNA sequencing was performed on bone marrow mononuclear cells of a patient with acute myeloid leukemia with erythroid differentiation of the blasts and on peripheral blood mononuclear cells of a patient with acute myeloid leukemia with megakaryocytic differentiation of the blasts. The dataset contains raw fastq files of these two samples with single-cell RNA sequencing performed using the 10x Genomics platform.

  Dataset EGAD00001009865

• miRNASeq profiles from Indian HFrEF Cohort

  The dataset contains miRNA profiling from a cohort of 49 HFrEF patients. The myocardium samples were collected from these patients during heart transplant of LVAD implantation procedure. The RNA samples were collected in RNAlater. Small RNA libraries were prepared using QIAseq miRNA Library Kit, Qiagen and sequenced on Illumina HiSeq4000.

  Dataset EGAD50000001194

• Dicer and/or ADAR1 depleted HEK293-LGP2 cells

  This dataset includes bulk RNA-sequencing data from HEK293-L cells subjected to siRNA-mediated knockdown of Dicer and/or ADAR1. In total, 12 samples are included, representing four experimental groups with triplicate biological replicates. RNA was extracted using TRIzol according to standard protocols and sequenced on an Illumina NovaSeq 6000.

  Dataset EGAD50000002044

• Single-cell RNA sequencing of acute myeloid leukemia patients

  Single-cell RNA sequencing was performed on bone marrow mononuclear cells from 8 acute myeloid leukemia patients at diagnosis. The profiling was performed using 10x Genomics 3' (5 samples) and 5' (3 samples) platforms. The raw data are available as fastq files.

  Dataset EGAD00001006173

• Single cell RNA-sequencing of treatment naïve PDAC patient samples

  Single cell RNA-sequencing of treatment naïve PDAC patient samples. We have 10 samples, sequenced using the 10X genomics chromium platform with 3 prime chemistry. We are submitting FASTQ files representing the index files (I1), Read1 (R1) and Read2 (R2).

  Dataset EGAD00001008961

• Small molecule screen reveals synergy of cell cycle checkpoint kinase inhibitors with DNA-damaging chemotherapies in medulloblastoma (methylation dataset)

  human medulloblastoma xenograft isolated from mouse brain was frozen and genomic DNA or RNA was extracted. Bisulfite converted DNA was processed and hybridised to illumina EPIC or 450K arrays using standard protocols. RNAseq was performed on total RNA.

  Dataset EGAD00001006583

• Iso-seq or Long-read RNAseq Dataset for 7 T-ALL patient samples

  7 Isoform sequencing or Long-read RNAseq mapped bam files. Reads were aligned to HG38 reference using Minimap2.

  Dataset EGAD50000000022

• scRNA-seq for 4 reactive lymph node and 12 high grade B cell lymphoma samples

  Dataset includes count matrices, barcode tsvs, and features tsv for each sample, generated using Cell Ranger.

  Dataset EGAD50000001386

• RNA-seq in LCLs derived from constitutional MLH1 epimutation carriers and non-carrier relatives

  Transcriptome profiling in human lymphoblastoid cell lines derived from constitutional MLH1 epimutation carriers and non-carrier relatives

  Study EGAS50000000498

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line RNA-Seq

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009759

• Multi-omic analysis of the tumor microenvironment shows clinical correlations in Ph1 study of atezolizumab +/- SoC in MM

  Multiple myeloma (MM) remains incurable, and treatment of relapsed/refractory (R/R) disease is challenging. There is an unmet need for more targeted therapies in this setting; deep cellular and molecular phenotyping of the tumor and microenvironment in MM could help guide such therapies. This phase 1b study (NCT02431208) evaluated the safety and efficacy of the anti-programmed death-ligand 1 monoclonal antibody atezolizumab (Atezo) alone or in combination with the standard of care (SoC) treatments lenalidomide (Len) or pomalidomide (Pom) and/or daratumumab (Dara) in patients with R/R MM. Study endpoints included incidence of adverse events (AEs) and overall response rate (ORR). A novel unsupervised integrative multi-omic analysis was performed using RNA sequencing, mass cytometry immunophenotyping, and proteomic profiling of baseline and on-treatment bone marrow samples from patients receiving Atezo monotherapy or Atezo+Dara. A similarity network fusion (SNF) algorithm was applied to preprocessed data. Eighty-five patients were enrolled. Treatment-emergent deaths occurred in 2 patients; both deaths were considered unrelated to study treatment. ORRs ranged from 11.1% (Atezo+Len cohorts, n=18) to 83.3% (Atezo+Dara+Pom cohort, n=6). High-dimensional multi-omic profiling of the tumor microenvironment and integrative SNF analysis revealed novel correlations between cellular and molecular features of the tumor and immune microenvironment, patient selection criteria, and clinical outcome. Atezo monotherapy and SoC combinations were safe in this patient population and demonstrated some evidence of clinical efficacy. Integrative analysis of high dimensional genomics and immune data identified novel clinical correlations that may inform patient selection criteria and outcome assessment in future immunotherapy studies for myeloma.

  Study EGAS00001007286

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• Single molecule genome-wide mutation profiles of cell-free DNA for non-invasive detection of cancer

  Somatic mutations are a hallmark of tumorigenesis and may be useful for non-invasive diagnosis of cancer. We analyzed whole-genome sequencing (WGS) data from 2,511 individuals in the Pan-Cancer Analysis of Whole Genomes (PCAWG) study as well as 489 individuals from four prospective cohorts and found distinct regional and mutation type specific frequencies in tissue and cell-free DNA (cfDNA) of cancer patients that were associated with replication timing and other chromatin features. A machine learning model using genome-wide mutational profiles combined with other features and followed by CT imaging detected >90% of lung cancer patients, including those with stage I and II disease. The fixed model was validated in an independent cohort, detected patients with cancer earlier than standard approaches, and could be used to monitor response to therapy. This approach lays the groundwork for non-invasive cancer detection using genome-wide mutation features that may facilitate cancer screening and monitoring.

  Study EGAS00001007248

• End motifs analysis of circulating DNA from the plasma of patients with stage II-III breast cancer (n=50), stage I-III non-small cell lung cancer (n=56), metastatic colorectal cancer (mCRC) (n=15) and healthy individuals (n=37)..

  We have developed an algorithm designed to discriminate cancer patients and healthy individuals based on cirDNA fragment end motif analysis assisted by machine learning, using data obtained from shallow whole genome sequencing (a method we call EMA). We applied EMA to cirDNA from the plasma of patients with stage II-III breast cancer, stage I-III non-small cell lung cancer, and metastatic colorectal cancer (mCRC). CirDNA from 158 individuals was prepared following the conventional double-stranded DNA library preparation (DSP). We also performed a single-stranded DNA library preparation (SSP) using mCRC patients and healthy control cirDNA, which allowed us to make the first ever end motif analysis in the literature which compares the use of DSP and SSP.

  Study EGAS50000001319

• Genome-wide cell-free DNA biological patterns in patients with cancer

  The structure of cell-free DNA (cfDNA) is altered in the blood of cancer patients. From whole genome sequencing we retrieved the cfDNA fragment-end composition using a new software (FrEIA), as well as the cfDNA size and tumor fraction in three independent cohorts (n=925 cancer from >10 types and 321 control samples). At 95% specificity, we detect 72% of cancer samples using at least one cfDNA measure, including 64% of early-stage cancer (n=220). cfDNA detection correlates with a shorter overall (p=0.018) and recurrence-free (p=0.006) survival in patients with resectable esophageal adenocarcinoma. Integrating cfDNA measures with machine learning in an independent test set (n=396 cancer, 90 controls) achieve a detection accuracy of 82% and AUROC of 96%. In conclusion, harnessing the biological features of cfDNA can improve at no-extra cost the diagnostic performance of liquid biopsies.

  Study EGAS00001007400

• Strand-specific mRNA-Seq assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  Strand-specific mRNA-Seq assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001227

• Fastq data for stranded mRNA-Seq assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for stranded mRNA-Seq assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001402

• ChIP-Seq (Input) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (Input) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001235

• Targeted_sequencing_of_genes_recurrently_mutated_in_AML

  Background Massively parallel sequencing technology has transformed cancer genomics. It is now feasible, in a clinically relevant time-frame, for a clinically manageable cost, to screen DNA from patient tumours for mutations essentially genome-wide. The challenge for personalised medicine will be to increase the sample size to thousands or tens of thousands of well-characterised cases in order to attain sufficient statistical power to stratify patients accurately across the complexity and genomic heterogeneity expected for most of the common tumour types. Currently, whole genome sequencing on this scale is not feasible, and targeted sequencing of relevant portions of the genome will be required. Pilot data We have developed protocols for large-scale, multiplexed sequencing of 100-200 genes in thousands of samples. Essentially, using robotic technology, genomic DNA from the cancer specimen is processed into sequencing libraries with unique DNA barcodes, thereby allowing sequencing reads to be attributed to the sample they derive from. Currently, these sequencing libraries can be generated in a 96-well format using fully automated protocols, and we are exploring methods to expand this to a 384-well format. The sequencing libraries are pooled and hybridized to custom sets of RNA baits representing the genomic regions of interest. Sequencing of the pulled-down libraries is done in pools of 48-96 samples per lane of an Illumina Hi-Seq. This protocol is already implemented at the Sanger Institute. We have published proof that somatic mutations in novel cancer genes can be identified from exome-wide sequencing. In unpublished pilot data, we have established the feasibility of robotic library production, custom pull-down, and multiplexed sequencing of barcoded libraries for 100 known myeloid cancer genes across 760 myelodysplasia samples. Highlights of the data thus far analysed reveal that the coverage is remarkably even between samples; when 96 samples are run, average coverage per lane of sequencing is ~250, with 90-95% of targeted exons covered by >25 reads; known mutations can be discovered in the data set; and the protocol is amenable to whole genome amplified DNA. The bioinformatic algorithms for identification of substitutions and indels in pull-down data are well-established; we have pilot data proving that copy number changes, LOH and genomic rearrangements in specific regions of interest can also be identified by tiling of baits across the relevant loci. Proposal We propose to apply this methodology to 10000 samples from patients with AML enrolled in clinical trials over the last 10-20 years. Oncogenic point mutations and potentially genomic rearrangements will be identified, and linked to clinical outcome data, with a view to undertaking the following sorts of analyses: • Identification of co-occurrence, mutual exclusivity and clusters of driver mutations. • Correlation of prognosis with driver mutations and potentially gene-gene interactions • Exploration of genomic markers of drug response Ultimately, we would like to be in a position to release the mutation data together with matched clinical outcome data to genuine medical researchers via a controlled access approach, possibly within the COSMIC framework (www.sanger.ac.uk/genetics/CGP/cosmic/). The vision here is to generate a portal whereby a clinician faced with an AML patient and his / her mutational profile can obtain a ‘personalised’ prediction of outcome, together with a fair assessment of the uncertainty of the estimate. With a sufficient sample size, there would also be the potential to develop decision support algorithms for therapeutic choices based on such data.

  Study EGAS00001000408

• Comparison of 3 protocols for deriving pancreatic progenitors from hPSC with RNA-seq and ATAC-seq

  Several distinct differentiation protocols for deriving pancreatic progenitors (PP) from human pluripotent stem cells have been described but it remains to be shown how similar the PP are across protocols, and how well they resemble their in vivo counterparts. Here we evaluated three differentiation protocols; performed RNA and ATAC-seq on isolated PP derived with these, and compared them to fetal human pancreas populations. This enabled us to define a shared transcriptional and epigenomic signature of the PP, including several genes not previously implicated in pancreas development. Furthermore, we identified a significant and previously unappreciated cross-protocol variation of the PP through multi-omics analysis and demonstrate how such information can be applied to refine differentiation protocols for derivation of insulin-producing beta-like cells. Together, our study highlights the importance of a detailed characterization of defined cell populations derived from distinct differentiation protocols, and provides a valuable resource for exploring human pancreatic development.

  Study EGAS00001003513

• Identification of the Global miR-130a Targetome Reveals a Novel Role for TBL1XR1 in Hematopoietic Stem Cell Self-Renewal and t(8;21) AML

  In this study, we identified miR-130a as a regulator of HSC self-renewal and differentiation. To characterize gene expression changes following enforced expression of miR-130a OE, we performed RNA-seq in CD34+ cord blood (CB) cells transduced with control and miR-130a OE lentiviruses. To capture miRNA targets in an unbiased, transcriptome-wide manner, we perfomed enhanced CLIPseq procol in 2 replicates of CD34+ CB cells and Kasumi-1 cell line, which represent a model system for t(8;21) AML. We chose this cell line, as we found miR-130a to be highly expressed in this AML subtype where it is critical for maintaining the oncogenic molecular program mediated by AML1-ETO. Chimeric Ago2 eCLIPseq in CD34+ CB cells combined with Mass Spectrometry data analysis identified TBL1XR1 as a principal target of miR-130a. To elucidate gene expression changes associated with TBL1XR1 loss of function, we performed RNA-seq in CD34+CD38- CB cells transduced with control and shRNA targeted against TBL1XR1. To determine the functional significance of high miR-130a expression levels in Kasumi-1 cells on the molecular network controlled by AML1-ETO, we performed CUT&RUN assay and RNA-seq in Kasumi-1 cells following miR-130a knock-down (KD). Collectively, our findings reveal a unique role of miR-130a in regulating normal hematopoietic stem cell self-renewal and how elevated levels of miR-130a in t(8;21) AML contribute to the leukemogenesis of this AML subtype.

  Dataset EGAD00001008412

• Genome-wide DNA methylation profiles by MeDIP-seq of cord blood cells and cord blood mononuclear cells obtained from twins conceived through in vitro fertilization and naturally conceived controls

  The study included 47 newborn twins conceived though in vitro fertilisation (IVF) and 60 non-IVF-conceived twins from the Peri/postnatal Epigenetic Twins Study (PETS). Cord blood was collected at birth and used to process mononuclear cells. Whole blood cells (WBCs) from cord blood of 98 twins (40 IVF and 58 non-IVF) and cord blood mononuclear cells (CBMCs) of 82 twins (35 IVF and 47 non-IVF) were subjected to DNA methylation profiling. Methylated DNA immunoprecipitation followed by deep sequencing (MeDIP-seq) was applied to generate genome-wide DNA methylation profiles in a total of 180 samples. Single-end reads were mapped onto hg19 using BWA. Methylation levels were quantified using MEDIPS and used to identify IVF-associated differentially methylated regions.

  Study EGAS00001002248

• ATAC-Seq of healthy and IBD blood samples

  PBMCs from blood samples of 9 age- and gender-matched healthy subjects and 25 IBD patients were isolated through a Ficoll density gradient and used to isolate live CD4 T cells through a magnetic cell isolation kit (Miltenyi Biotec). Twelve thousand live CD4 T cells were then used to prepare ATAC-Seq libraries. Briefly, crude nuclei of live CD4+ T cells were treated with Tagment DNA buffer and Tagment DNA Enzyme (Nextera DNA Library Prep Kit, Illumina), and then the DNA was purified by MinElute PCR Purification Kit (Qiagen). Transposed DNA fragments were amplified using specific adapters followed by purification with MinElute PCR Purification Kit (Qiagen). Fragments from 240-360pb were selected in the PippinHT system (Sage Science). The quality of the library and its DNA concentration were assessed by Bioanalyzer instruments (Agilent Technologies) and ultimately submitted for sequencing using Illumina HiSeq 2500 sequencer, V4 chemistry.

  Study EGAS00001007343

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• Comprehensive Genomic Characterization of Acral Melanoma

  In this study, we performed paired tumor/normal long insert whole genome and exome sequencing and tumor RNA sequencing on primary or metastatic acral melanoma tumors collected from 34 patients. Patients were enrolled from either Vanderbilt University or the Memorial Sloan-Kettering Cancer Center. We report an integrated analysis of DNA and RNA sequencing data to describe genomic and transcriptomic characteristics of acral melanoma.

  Study phs001036

• Broad utility of ultrasensitive analysis of ctDNA dynamics across solid tumors treated with immunotherapy

  Prior studies have suggested the biomarker potential of plasma circulating tumor DNA (ctDNA) in cancer patients treated with immune checkpoint inhibitors (ICIs). In order to characterize the potential role of ultrasensitive ctDNA detection in the management of these patients we have performed tumor whole-genome-informed, ultrasensitive ctDNA analysis—tracking approximately 1,800 tumor-specific mutations per patient—in a retrospective cohort (n=136) and a prospective validation cohort (n=66) across 24 cancer types treated with ICIs alone or in combination with bispecific antibodies or immune cell engagers. Analyzing 1,455 longitudinal samples, we found that ctDNA molecular response measured as early as 3 weeks after treatment initiation correlated with improved progression-free and overall survival, while ctDNA clearance at any time strongly correlated with radiological response and prolonged survival. Additionally, ctDNA dynamics distinguished true progression from pseudoprogression and predicted outcomes in patients receiving continued immunotherapy beyond initial progression. This study highlights the broader applicability of ultrasensitive ctDNA as a biomarker across cancer types and immunotherapy modalities.

  Study EGAS50000001333

• Whole Genome DNA Methylation

  Whole Genome Bisulfite Sequencing on normal primary human uveal melanocytes. WGBS libraries were prepared using the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences 30024), the EZ DNA Methylation-Gold Kit (Zymo D5005), and DNA Clean & Concentrator-5 (Zymo D4013), following the instruction manual Accel-NGS Methyl-Seq DNA Library (Revision 160510). Paired-end (2 x 150 bp) libraries were sequenced on a DNBSEQ-T7 instrument (MGI) after library conversion.

  Dataset EGAD50000000766

• Whole Genome DNA Methylation MPI

  Whole Genome Bisulfite Sequencing on normal primary human uveal melanocytes. WGBS libraries were prepared using the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences, Catalog No. 30024), the EZ DNA Methylation-Gold Kit (Zymo, D5005) and DNA Clean & Concentrator-5 (Zymo, D4013), following the instruction manual Accel-NGS® Methyl-Seq DNA Library (Revision 160510). Paired-end libraries (2 × 150 bp) were sequenced on a NovaSeq 6000 instrument.

  Dataset EGAD50000001139

• DNA-seq FASTQ files from 16 patients affected by acute intermittent porphyria

  Paired-end DNA-seq FASTQ files from 16 patients affected by acute intermittent porphyria. Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). Each sample was multiplexed across flowcells and lanes, leading to a total number of 83 pairs of FASTQ files.

  Dataset EGAD00001006950

• Methylation profiling by MCC-Seq of visceral fat (N=199) and whole-blood (N=206) derived from IUCPQ participants

  The study includes NGS-based methylC-capture sequencing (MCC-Seq) on 199 visceral adipose tissue and 206 whole-blood DNA samples derived from obese individuals (BMI >40 kg m-2) in the IUCPQ cohort. We generated 100bp paired-end reads using the Illumina HiSeq2000 or 2500 systems.

  Dataset EGAD00001004787

• Regulatory Genomics of Human Embryonic Development

  We used epigenetic profiling to map active enhancers in the developing human limb and cortex as described in two published studies: Cotney J, Leng J, Yin J, Reilly SK et al. The evolution of lineage-specific regulatory activities in the human embryonic limb. Cell 2013;154(1):185-96. Reilly SK, Yin J, Ayoub AE, Emera D et al. Evolutionary changes in promoter and enhancer activity during human corticogenesis. Science 2015;347(6226):1155-9. We also used ChIP-seq to map binding sites for the chromatin modifier CHD8 in the developing human brain, as described in one published study: Cotney J, Muhle RA, Sanders SJ, Liu L et al. The autism-associated chromatin modifier CHD8 regulates other autism risk genes during human neurodevelopment. Nat Commun 2015;6:6404. We are also depositing primary human sequence reads related to processed datasets in the Gene Expression Omnibus under the following accession numbers: GSE42413 (Cotney et al. 2013); GSE63649 (Reilly et al. 2015); GSE57369 (Cotney et al. 2015).

  Study phs001226

• Megabase-scale Haplotyped Genomic Analysis of Normal and Cancer Genomes

  We experimentally determined Mb-scale haplotypes from germline and cancer genome sequencing. Using a microfluidic process that partitions long DNA fragments into hundreds of thousands of barcoded reactions, we determined haplotype blocks from matched colorectal cancer samples in the delineation of haplotypes of allelic imbalances and other genomic instability events.

  Study phs000898

• Targeted_Pulldown_Validation_of_mutations_found_in_whole_genome_sequencing

  This experiment is to inform us of the validity of using pre-made library material to perform a bespoke pulldown experiment to validate the mutations found between the whole genome sequencing of the DNA from the same individuals cancer and normal material. This is to identify the valid and informative mutations in cancer genomes.

  Study EGAS00001000260

• NIMH Human Middle Temporal Gyrus (MTG) Cell Types

  Elucidating the cellular architecture of the human neocortex is central to understanding our cognitive abilities and susceptibility to disease. In this study, we applied single nucleus RNA sequencing to perform a comprehensive analysis of cell types in the middle temporal gyrus of human cerebral cortex. We identify a highly diverse set of excitatory and inhibitory neuronal types, many of which are relatively sparse. Additionally, we found that excitatory types are less layer-restricted than expected based prior knowledge from cell morphologies and from mouse studies. Comparison to a similar mouse cortex single cell RNA-sequencing dataset revealed a surprisingly well-conserved cellular architecture that enables matching of homologous types and predictions of human cell type properties. Despite this general conservation, we also find extensive differences between homologous cell types in human and mouse, including dramatic alterations in proportions, laminar distributions, gene expression, and morphology. These species-specific features emphasize the importance of directly studying human brain. This study conducted by the Allen Institute for Brain Science was supported by the Allen Institute for Brain Science and by US National Institutes of Health grant U01 MH114812-02 to E.S.L. Collaborators request that publications resulting from these data cite their original publication: Hodge RD, Bakken TE, et al. Conserved cell types with divergent features between human and mouse cortex. bioRxiv. 2018 doi: 10.1101/384826.

  Study phs001790

• Region-Specific Neural Stem Cell Lineages Revealed by Single-Cell RNA-Sequences from Human Embryonic Stem Cells

  During development of the human brain, multiple cell types with diverse regional identities are generated. Here we report a system to generate early human brain forebrain and mid/hindbrain cell types from human embryonic stem cells (hESCs), and infer and experimentally confirm a lineage tree for the generation of these types based on single-cell RNA-Seq analysis. We engineered SOX2Cit/+ and DCXCit/Y hESC lines to target progenitors and neurons throughout neural differentiation for single-cell transcriptomic profiling, then identified discrete cell types consisting of both rostral (cortical) and caudal (mid/hindbrain) identities. Direct comparison of the cell types were made to primary tissues using gene expression atlases and fetal human brain single-cell gene expression data, and this established that the cell types resembled early human brain cell types, including preplate cells. From the single-cell transcriptomic data a Bayesian algorithm generated a unified lineage tree, and predicted novel regulatory transcription factors. The lineage tree highlighted a prominent bifurcation between cortical and mid/hindbrain cell types, confirmed by clonal analysis experiments. We demonstrated that cell types from either branch could preferentially be generated by manipulation of the canonical Wnt/beta-catenin pathway. In summary, we present an experimentally validated lineage tree that encompasses multiple brain regions, and our work sheds light on the molecular regulation of region-specific neural lineages during human brain development.

  Study phs001205

• MutWP1__CRUK_Grand_Challenge_Mutographs_of_Cancer__Oesophageal_adenocarcinoma

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, the International Agency for Research on Cancer is coordinating the recruitment of 5000 individuals with cancer (colorectal, renal, pancreatic, oesophageal adenocarcinoma or oesophageal squamous cancers) across 5 continents to explore whether different mutational signatures explain marked variation in incidence. In brief, through an international network of collaborators around the world, biological materials are collected, along with demographic, histological, clinical and questionnaire data. Whole genome sequences of tumour-germline DNA pairs are generated at the Wellcome Trust Sanger Institute (40X and 20X depth respectively). Somatic mutational signatures are subsequently extracted by non-negative matrix factorisation methods and correlated with risk factors data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001003702

• Childhood Cancer Data Initiative (CCDI): Texas Pediatric Patient Derived Xenograft 

  The DNA/RNA samples of patients for which PDX models were developed were from a population of children, adolescents, and young adults from South Texas. Consent was obtained for collection of malignant and non-malignant tissue samples for genetic analysis and for the development of models to study new ways to treat cancer. For additional details, please refer to these publications: PMID: 37915590; PMID: 37990009.

  Study phs003215

• ChiLDReN/BA: Genetic Studies of Biliary Atresia in the Childhood Liver Disease Research Network

  Biliary atresia (BA) is a progressive necroinflammatory process initially involving the extra-hepatic biliary tree. Little is known about the factors that cause BA or the factors that influence disease progression. A variety of genetic, autoimmune, and environmental influences have been hypothesized to be important. Most studies to date have focused on the neonate and young child with BA, yet the older surviving child with BA can provide important information about genetics as well as natural history.The Childhood Liver Disease Research Network (ChiLDReN) conducts two longitudinal and observational studies that include BA patients: Biliary Atresia Study in Infants and Children (BASIC) and A Prospective Database of Infants with Cholestasis (PROBE). Using samples from participants in these two protocols, we have formed the largest known data set of biliary atresia patients in the world. ChiLDReN is performing a series of genomic analyses, with subsequent analyses being released as subsequent versions of this registration, phs003356. Version 1 concerns PKD1L1.About the PKD1L1 Analysis (phs003356.v1): While multiple factors have been implicated in the perinatal biliary injuries that characterize BA, a definitive etiology has not yet been established. This study is part of a larger project to characterize the largest cohort of pediatric BA patients through whole-exome sequencing (WES). In this analysis, we examine the WES of those with various laterality defects to determine whether genetic factors could be identified to explicate the etiopathogenesis of BA in biliary atresia splenic malformation (BASM) syndrome. We specifically explored variations in the PKD1L1 gene, which recently has been identified in mouse models as playing a role in laterality.

  Study phs003356

• Investigation of Brain Nitrogen Metabolism in Partial Ornithine Transcarbamylase Deficiency (OTCD) Using 1H MRS, DTI, and fMRI

  This is a case controlled, observational study. This project studies cognitive and motor dysfunction in adult and pediatric patients who are female carriers of ornithine transcarbamylase deficiency (OTCD) or are males with late onset presentation (outside of the newborn period) of OTCD, utilizing state of the art MRI (magnetic resonance imaging), a non-invasive technique. This project seeks to improve our understanding of the underlying neural mechanisms that contribute to metabolic, cognitive, sensory and motor abnormalities in urea cycle disorders, which although individually rare, collectively constitute a major cause of neonatal encephalopathy, leading to significant morbidity and mortality. As a result of this study, a greater understanding of the anatomic, cognitive, motor, and biochemical underpinnings of neurologic damage attributable to this metabolic disorder will be gained. Experimental approaches will combine sensory, cognitive and motor testing with structural, functional and molecular magnetic resonance imaging to study symptomatic and asymptomatic heterozygous female carriers of X-linked ornithine transcarbamylase deficiency (OTCD), and late onset hemizygous males. Participants to be included in the studies ranged from ages 7-60 years and were compared to an age-matched typically developed (TD) comparison group. For our research, we use anatomic MRI, functional Magnetic Resonance Imaging (fMRI), and magnetic resonance spectroscopy (MRS) to monitor brain activity. The technique of fMRI provides detailed maps of the brain areas underlying human mental activities. By using fMRI, we are able to observe how the brain is functioning while a person is performing a specific task, such as reading. We can not only observe differences in the structure of the brain, but can also measure differences in brain function and activity as well. This information will ultimately be used to provide a basis for designing more effective interventions and methods for early identification of learning disabilities in patients with OTCD and related disorders. We will also use MRS to study various brain chemicals such as glutamine using the non-invasive MRI imaging techniques.

  Study phs001296

• Enzymatic Methyl-Seq Rectal Mucus

  Enzymatic methyl sequencing of rectal mucus samples from patients suspected to have colorectal cancer. This is 1 of 4 sequencing experiments on the same sample type.

  Study EGAS50000001314

• Data for noninvasive lung cancer subtyping study

  This dataset included cfMethyl-Seq data of 15 plasma cfDNA samples from 15 lung cancer patients and RRBS data of 58 lung tumor tissue samples from 58 lung cancer patients. The data were generated following the standard protocols.

  Dataset EGAD00001015344

• Multiregion Whole Exome and Smart-Seq3 single cell RNA sequencing of Breast Tumors

  Multiple regions were cut out of each tumor extracted form breast cancer patients and two experiments were run: - Whole exome sequencing on each of the regions plus an adjacent normal tissue sample - Smart-Seq3 Single cell RNA sequencing on EPCAM+ CD45- sorted cells from different tumor regions

  Study EGAS00001006851

• Somatic mutation analysis based on Whole exome Sequencing (WES) of multiple tumor biopsies, patient-derived spheroids and leukocyte DNA from colorectal cancer patients (vcf files)

  Somatic mutations were called using whole exome Sequencing (WES) data from colorectal cancer samples (dataset EGAD00001003821) using MuTect2, with matched constitutional WES-data obtained from leukocytes samples as reference.

  Dataset EGAD00001003823

• Small RNA sequencing of untreated and castration resistant prostate cancer

  Small RNA sequencing of 28 untreated prostate cancers, 12 castration resistant prostate cancers, and 3 benign prostatic hyperplasias.

  Dataset EGAD00001000611

• Correlative Studies for Protocol #14-C-0059: T Cells Expressing an Anti-GD2 Chimeric Antigen Receptor in Patients with GD2+ Solid Tumors, a Collaboration with CIMAC-CIDC

  This study is a retrospective correlative analysis of immune cell phenotypes in samples from a Phase I clinical trial (NCT02107963) of GD2 CAR-T cells (GD2-CAR.OX40.28.z.iC9) in children and young adults with osteosarcoma and neuroblastoma. The study was a 3+3 dose-escalation study with four dose levels (1 x 10(5) transduced T cells/kg; 1 x 106 transduced T cells/kg; 3 x 106 transduced T cells/kg; and 1 x 107 transduced T cells/kg). Apheresis and final manufactured GD2 CAR-T product samples were analyzed by bulk RNA sequencing and ATAC sequencing. The patients were stratified into good CAR-T expanders (peak CAR-T expansion >1000 GD2 CAR copies/100ng DNA) and poor CAR-T expansion (peak CAR-T expansion Increased naïve T cell subsets in baseline apheresis are associated with patients who experienced good CAR T cell expansion A T cell exhaustion signature was observed in the manufactured GD2 CAR-T product and may have contributed to lack of efficacy observed in this trial Increased myeloid-derived suppressor cell (MDSC) signatures were observed in patients with poor CAR-T expansion CAR-T product in good expanders displayed increased AP-1 factor transcription factor motifs, such as BATF, JUN, and FOS Data provided in dbGaP for this study include: Bulk RNA-Seq data for 11 pre-treatment peripheral blood and 11 GD2 CAR-T product from 14 patients. ATAC sequencing of 22 peripheral blood samples and 5 GD2 CAR-T products from 14 patients.

  Study phs003455

• Validated Single-cell RNA sequencing in early breast cancer

  Single-cell RNA and VDJ sequencing of early breast cancer

  Dataset EGAD00001006608

• Blood Transcriptome Profiling Following Seizures

  The retrospective diagnosis or confirmation of a seizure, after the event, is very challenging. Many times clinicians can only use a patient's self-reported history. To further complicate the diagnosis, it is known that 20-30% of patients reporting a seizure actually suffer from psychogenic non-epileptic seizure (PNES). The patient has the behavior of a seizure, but does not suffer from brain seizure activity. Considerable time and resources are used to monitor PNES, and many patients undergo unnecessary therapy with anti-epileptic drugs. These resources could be more effectively used if we could confirm a seizure after the event (retrospective diagnosis). Here we propose a novel approach to distinguish seizures from PNES after the seizure event has happened.We have developed an accurate blood biomarker technology to diagnose acute brain injury, and assess chronic progression following brain injury. Previous studies support the premise that seizures affect blood RNA expression; here we assess temporal RNA expression pattern changes following seizure. We present preliminary preclinical data showing the discrimination of electric-stimulation evoked animal seizures. Here, we validate this maturing technology to assist with the discrimination of epileptic seizures from psychogenic non-epileptic seizures. We will analyze blood samples from patients undergoing video EEG monitoring in an epilepsy monitoring unit (Emory University Hospital, Atlanta GA). We expect 20% of these patients will have PNES. Once a patient has an EEG verified seizure, we will collect blood at various time points and identify biomarker RNA molecules in the blood. Blood samples will be collected from patients with non-verified seizures as control. These RNA expression values will be used to develop a predictive test for the occurrence of seizures. A biomarker gene panel will be developed from this exploratory project for validation in a larger patient population.

  Study phs003460

• RaScALL: Rapid (Ra) screening (Sc) of RNA-seq data for prognostically significant genomic alterations in acute lymphoblastic leukaemia (ALL)

  RNA-sequencing (RNA-seq) efforts in acute lymphoblastic leukaemia (ALL) have identified numerous prognostically significant genomic alterations which can guide diagnostic risk stratification and treatment choices when detected early. However, a full RNA-seq Bioinformatics workflow is time-consuming and costly in a clinical setting where rapid detection and accurate reporting of clinically relevant alterations are essential. To accelerate the identification of ALL-specific alterations (including gene fusions, single nucleotide variants and focal gene deletions), we developed the rapid screening tool RaScALL, capable of identifying more than 100 prognostically significant lesions directly from raw sequencing reads. RaScALL uses the k-mer based targeted detection tool km and known ALL variant information to achieve a high degree of accuracy for reporting subtype defining genomic alterations compared to standard alignment-based pipelines. Gene fusions, including difficult to detect fusions involving EPOR and DUX4, were accurately identified in 98% (164 samples) of reported cases in a 180-patient Australian study cohort and 95% (n=63) of samples in a North American validation cohort. Pathogenic sequence variants were correctly identified in 75% of tested samples, including all cases involving subtype defining variants PAX5 p.P80R (n=12) and IKZF1 p.N159Y (n=4). Accurate detection of intragenic IKZF1 deletions resulting in aberrant transcript isoforms was also detectable with 98% accuracy. Importantly, the median analysis time for detection of all targeted alterations averaged 22 minutes per sample, significantly shorter than standard alignment-based approaches, ensuring accelerated risk-stratification and therapeutic triage.

  Dataset EGAD00001009087

• Genome-wide cell-free DNA termini in patients with cancer

  The structure, fragmentation pattern, length and terminal sequence of cell-free DNA (cfDNA) is under the influence of nucleases present in the blood. We hypothesized that differences in the diversity of bases at the end of cfDNA fragments can be leveraged on a genome-wide scale to enhance the sensitivity for detecting the presence of tumor signals in plasma. We surveyed the cfDNA termini in 72 plasma samples from 319 patients with 18 different cancer types using low-coverage whole genome sequencing. The fragment-end sequence and diversity were altered in all cancer types in comparison to 76 healthy controls. We converted the fragment end sequences into a quantitative metric and observed that this correlates with circulating tumor DNA tumor fraction (R = 0.58, p < 0.001, Spearman). Using these metrics, we were able to classify cancer samples from control at a low tumor content (AUROC of 91% at 1% tumor fraction) and shallow sequencing coverage (mean AUROC = 0.99 at >1M fragments). Combining fragment-end sequences and diversity using machine learning, we classified cancer from healthy controls (mean AUROC = 0.99, SD = 0.01). Using unsupervised clustering we showed that early-stage lung cancer can be classified from control or later stages based on fragment-end sequences. We observed that fragment-end sequences can be used for prognostication (hazard ratio: 0.49) and residual disease detection inresectable esophageal adenocarcinoma patients, moving fragmentomics toward a greater clinical implementation.

  Study EGAS00001005738

• Genome-wide cell-free DNA termini in patients with cancer

  The structure, fragmentation pattern, length and terminal sequence of cell-free DNA (cfDNA) is under the influence of nucleases present in the blood. We hypothesized that differences in the diversity of bases at the end of cfDNA fragments can be leveraged on a genome-wide scale to enhance the sensitivity for detecting the presence of tumor signals in plasma. We surveyed the cfDNA termini in 72 plasma samples from 319 patients with 18 different cancer types using low-coverage whole genome sequencing. The fragment-end sequence and diversity were altered in all cancer types in comparison to 76 healthy controls. We converted the fragment end sequences into a quantitative metric and observed that this correlates with circulating tumor DNA tumor fraction (R = 0.58, p < 0.001, Spearman). Using these metrics, we were able to classify cancer samples from control at a low tumor content (AUROC of 91% at 1% tumor fraction) and shallow sequencing coverage (mean AUROC = 0.99 at >1M fragments). Combining fragment-end sequences and diversity using machine learning, we classified cancer from healthy controls (mean AUROC = 0.99, SD = 0.01). Using unsupervised clustering we showed that early-stage lung cancer can be classified from control or later stages based on fragment-end sequences. We observed that fragment-end sequences can be used for prognostication (hazard ratio: 0.49) and residual disease detection inresectable esophageal adenocarcinoma patients, moving fragmentomics toward a greater clinical implementation.

  Study EGAS00001005747

• Molecular Biomarkers in Glioma (Mechanisms and Therapeutic Implications of Hypermutation in Gliomas)

  This study seeks to genomically and mechanistically examine the basis for resistance of glioblastoma to chemotherapy, radiation therapy, and targeted therapy including immunotherapies. The study design addresses two Aims. In Aim 1, we will test the hypothesis that treatment with radiation and temozolomide or other therapies leads to consistent genetic changes in human tumors using whole exome sequencing of paired pre- and post-treatment tumor samples to determine large-scale changes in population structures and single cell whole genome sequencing to evaluate the effects of these treatments on microheterogeneity. In Aim 2, we will test the hypothesis that genetic changes identified in post-treatment glioblastomas (GBMs) functionally contribute to various forms of resistance in GBM using patient derived cell lines (PDCL) and patient derived xenografts (PDX). These studies will create a comprehensive understanding of genetic evolution during standard-of-care therapy for GBM. They will inform diagnostic approaches for assignment of targeted therapeutics in the recurrent setting and identify genetic changes driving resistance. Therapeutic targeting of these novel resistance drivers could represent a rational approach to substantially improve our existing standard of care for GBM patients.

  Study phs001967

• Sequencing_component_for_the_whole_genome_methylation_analysis_in_PBMCs_and_cell_subsets__pilot_study_

  DNA methylation has been shown to play a major role in determining cellular phenotype by regulating gene expression. Moreover, dysregulation of differentially methylated genes has been implicated in disease pathogenesis of various conditions including cancer development as well as autoimmune diseases such as systemic Lupus erythematosus and rheumatoid arthritis. Evidence is rapidly accumulating for a role of DNA methylation in regulating immune responses in health and disease. However, the exact mechanisms remain unknown. The overall aim of the project is to investigate the role of epigenetic mechanisms in regulating immunity and their impact on autoimmune disease pathogenesis.The aim of this pilot study is to perform whole genome methylation analysis in peripheral blood mononuclear cells (PBMCs) and cell subsets (CD4, CD8, CD14, CD19, CD16 and whole PBMCs) obtained from 6 healthy volunteers. Whole genome methylation analysis will be performed using two methodological approaches, the Infinium Methylation Bead Array K450 (Illumina) and MeDIP-seq. mRNA expression arrays will also be performed in order to correlate DNA methylation with gene expression as well as genotyping on the Illumina OmniExpress chip

  Study EGAS00001000490

• T2D-GENES Consortium: San Antonio Mexican American Family Studies (SAMAFS)

  The Type 2 Diabetes (T2D) Genetic Exploration by Next-generation sequencing in Ethnic Samples (T2D-GENES) Consortium is a collaborative international effort to identify genes influencing susceptibility to type 2 diabetes in multiple ethnic groups using next generation sequencing. To fulfill this objective, T2D-GENES Consortium undertook two large sequencing studies, called T2D-GENES Projects 1 and 2. Project 1 has carried out whole exome sequencing of 12,940 individuals, 6,504 with T2D and 6,436 non-diabetic controls, equally divided among five continental ancestry groups: Europeans, East Asians, South Asians, Hispanic Americans, and African Americans. The goal of Project 1 is to identify all genetic variants in the complete coding regions of the genomes (i.e., whole exome) by sequencing, including rare variants. Project 2 (i.e., SAMAFS substudy 2) is a pedigree-based study designed to identify low frequency or rare variants influencing susceptibility to T2D, using whole genome sequence information from approximately 600 individuals in 20 Mexican American T2D-enriched pedigrees from San Antonio, Texas, augmented with family-based imputation into approximately 440 additional family members. The major objectives of Project 2 are to identify low frequency or rare variants in and around known common variant signals for T2D, as well as to find novel low frequency or rare variants influencing susceptibility to T2D. Both T2D-GENES Projects 1 and 2 involve the San Antonio Mexican American Family Studies (SAMAFS), which are composed of four San Antonio, Texas-based family studies: the San Antonio Family Heart Study (SAFHS), San Antonio Family Diabetes/Gallbladder Study (SAFDGS), Veterans Administration Genetic Epidemiology Study (VAGES), and Family Investigation of Nephropathy and Diabetes - San Antonio (FIND-SA) Component and its extension called the Extended FIND [E-FIND]. The SAFHS and SAFDGS began in 1991 and have followed participants with extensive clinical phenotyping related to T2D for over 20 years. The VAGES was initiated in 1994 and a large battery of T2D-related phenotypic data has been obtained from its participants. The FIND-SA began in 2000, a part of the multicenter FIND study which was designed to identify genetic determinants of diabetic kidney disease; data from its participants related to T2D were used for this project. Non-overlapping subsets of SAMAFS participants are part of the T2D-GENES Projects 1 and 2, henceforth referred to as SAMAFS substudies 1 and 2, respectively. The SAMAFS substudies 1 and 2 are part of one of the five awards funded by NIDDK under a cooperative agreement award mechanism, which is governed by the Steering Committee of the T2D-GENES Consortium. Since Project 1 relies on population based subsets of cases and controls, 491 unrelated participants are drawn from the four SAMAFS as part of the T2D-GENES Project 1 Mexican American sample (i.e., SAMAFS substudy 1). The whole exome sequencing was performed at the Broad Institute. For Project 2, 1048 individuals are drawn from two SAMAFS (SAFHS and SAFDGS), representing 20 large families for substudy 2. The substudy 2 strategy is to sequence approximately 600 individuals at an average of 50x coverage across the entire genome, then impute genome wide genotypes for about 440 additional family members. The 600 sequenced individuals are specifically chosen for their value in imputing sequence information into other family members. By studying large pedigrees, we expect to find multiple individuals carrying each genetic variant, even if this variant is very rare in the population at large. Thus, a pedigree-based approach provides an excellent opportunity for identifying rare novel variants influencing risk of T2D and quantitative variation in T2D-related phenotypes. The whole genome sequencing has been done commercially by Complete Genomics, Inc. (CGI). The available sample of 1,048 includes 5 sequenced individuals who do not belong to any of the 20 large pedigrees. The final family data of 1,043 individuals includes whole genome sequence data for 607 individuals. After quality control, 590 sequenced individuals provide data for family based imputation using Merlin linkage analysis software into approximately 440 additional family members for whom chip based genotypes are available to indicate which parental haplotype is transmitted. The complete SAMAFS data including phenotype, genotype, sequence, other T2D-related trait data utilized for Projects 1 and 2 are available. These data can readily be viewed by clicking on the substudy title shown below or in the box: "Substudies", located on the right hand side of this parent or top study page phs000847.v1.p1, titled T2D-GENES Consortium: San Antonio Mexican American Family Studies (SAMAFS). phs000849 T2D-GENES Project 1: San Antonio Mexican American Family Studies (SAMAFS), Substudy 1: Whole Exome Sequencing phs000462 T2D-GENES Project 2: San Antonio Mexican American Family Studies (SAMAFS), Substudy 2: Whole Genome Sequencing in Pedigrees

  Study phs000847

• Molecular Sub-grouping of CNS-PNET

  In our study we aimed to define CNS-PNET subgroups. We performed Expression, Genotyping and/or Immunohistochemistry on 142 samples from 20 worldwide centers. Using these techniques, we have identified three molecular subgroups with distinct expression and copy number patterns, as well as, unique clinical characteristics. Specifically, these molecular subgroups were distinguished by primitive neural (group 1), oligoneural (group 2), and mesenchymal lineage (group 3) gene-expression signatures with differential expression of cell-lineage markers LIN28 and OLIG2. Our report underscores the importance of concerted, collaborative efforts to study large retrospective cohorts of tumours and patients to accelerate biological and ultimately therapeutic studies of rare tumours. The outcome of such a collaboration allowed us to identify LIN28 and OLIG2 as promising diagnostic and prognostic molecular markers for CNS PNET that warrant further assessment in prospective clinical trials.

  Study EGAS00000000116

• RNAseq Transcriptomic Analyses of European Ancestry Samples in MGS Dataset

  Schizophrenia is a common and severe psychotic disorder. While some common SNPs and rare copy number variants have been identified as being significantly associated with disease risk, the biological mechanisms remain undefined. To identify gene expression abnormalities in schizophrenia, we generated whole-genome gene expression profiles using RNAseq on lymphoblastoid cell lines from schizophrenia cases and controls of European ancestry. Subsets of these data have been used in three studies: (1) gene expression outliers (extreme tails of the distribution of transcript expression values) in 634 cases and 713 controls (PMID: 26022996); (2) baseline differential gene expression by affection status in 529 cases and 660 controls (PMID: 28418402); and (3) baseline versus dopamine stimulated differential gene expression by affection status in 514 cases and 690 controls (PMID: 30115913). Various classes of classes were enriched in the differentially expressed genes, especially brain expressed genes and genes related to immune processes.

  Study phs001932

• CRISPR-Mediated ASD Gene Knockout Reduces Neuronal Activity

  Autism Spectrum Disorder is phenotypically and genetically heterogeneous. We present a CRISPR gene editing strategy to insert a protein tag and premature termination sites creating an induced pluripotent stem cell (iPSC) knockout resource for functional studies of 10 ASD-relevant genes (AFF2/FMR2, ANOS1, ASTN2, ATRX, CACNA1C, CHD8, DLGAP2, KCNQ2, SCN2A, TENM1). Neurogenin 2 (NGN2)-directed induction of iPSCs allowed production of excitatory neurons, and mutant proteins were not detectable. RNAseq revealed convergence of several neuronal networks. Using both patch-clamp and multi-electrode array approaches, the electrophysiological deficits measured were distinct for different mutations. However, they culminated in a consistent reduction in synaptic activity, including reduced spontaneous excitatory post-synaptic current frequencies in AFF2/FMR2-, ASTN2-, ATRX-, KCNQ2- and SCN2A-null neurons. Despite ASD susceptibility genes belonging to different gene ontologies, isogenic stem cell resources can reveal common functional phenotypes, such as reduced functional connectivity.

  Study phs001816

• The Surveillance Monitoring for ART Toxicities (SMARTT) and the Women and Infants Transmission Study (WITS)

  Zidovudine (ZDV) is a nucleoside reverse transcriptase inhibitor (NRTI) which competitively inhibits HIV reverse transcriptase and is incorporated into the viral DNA, resulting in DNA chain termination. It was the first approved antiretroviral medication used for preventing HIV transmission from mother to child. However, in vitro and animal studies have suggested genotoxicity of ZDV and no study has evaluated potential impact of in utero ZDV exposure using genomic sequencing technologies. In this study, we investigate markers of genomic damage detected in peripheral blood mononuclear cell samples obtained from 91 ZDV-exposed and, for comparison, 94 NRTI-unexposed HIV-uninfected children born to HIV-infected mothers during the first week after birth. We utilize high-throughput DNA sequencing (whole exome sequencing) and genotype array methods to comprehensively identify potential clonal somatic single nucleotide variants (SNVs) and large acquired copy number alterations (SCNAs) related to ZDV exposure.

  Study phs002061

• NHLBI TOPMed: Stanford Cardiovascular Institute iPSC Biobank Study (SCVI)

  The proposed Stanford Cardiovascular Institute (SCVI) Biorepository will curate and manage an expanded collection of human induced pluripotent stem cell (iPSC) lines and provide investigators with iPSC materials generated using standardized protocols, with the overall objective of promoting the continued adoption and development of iPSC technology in cardiovascular research. Human iPSCs have revolutionized disease modeling, drug screening, and therapeutic research. However, it is also recognized that the need for specialized technical expertise and the associated cost have largely prevented individual research laboratories from adopting iPSC models in their inquiries, particularly in studies requiring multiple cell lines. To address this bottleneck, the proposed Biorepository will maintain our existing collection of iPSC lines and further expand the collection of iPSCs by recruiting 1,000 healthy, hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM) donors of both sexes and diverse racial/ethnic backgrounds (African Americans, Asians, Hispanics, and Whites).

  Study phs002338

• Genetic landscape of inherited retinal dystrophies affected cases in Spain

  Inherited retinal diseases (IRDs), defined by dysfunction or progressive loss of photoreceptors, are disorders characterized by elevated heterogeneity, both at the clinical and genetic levels. Our main goal was to address the genetic landscape of IRD in a Spanish cohort of patients. A retrospective hospital-based cross-sectional study was carried out on IRD affected individuals, referred for genetic testing from all the Spanish autonomous communities. Clinical, demographic and familiar data were collected from each patient, including family pedigree, age of appearance of visual symptoms, presence of any systemic findings and geographical origin. Genetic studies were performed to all families with available DNA using different molecular techniques. Our study provides the general landscape for IRD in Spain and our results have important implications for genetic diagnosis, counselling and new therapeutic strategies to both the Spanish population and other related populations.

  Study EGAS00001005104

• Common Deleterious Germline Variants Shape the Urothelial Cancer Genome

  Our study used whole-exome, whole-genome, and RNA sequencing to analyze samples from primary tumors, locally recurrent or metastatic urothelial tumors collected over time, and matched normal urothelium. We described the molecular landscape of mutational signatures and structural variants in chemotherapy-resistant urothelial cancer.

  Study phs001087

• CRUK Accelerator: Non-small cell lung cancer whole exome and RNA sequencing

  Whole exome and RNASeq raw sequencing data for a cohort 24 patients with non-small cell lung cancer, 15 adenocarcinoma (8 female, 7 male) and 9 squamous cell carcinoma(5 female, 4 male). Median age at diagnosis was 69. Tumour tissue and PBMCs were used for whole exome sequencing and RNA sequencing. This data was generated as part of a study funded by a Cancer Research UK Centres Network Accelerator Award Grant (A21998).

  Dataset EGAD00001007934

• RNA-sequencing from duodenal bipsies of Celiac disease patients

  Samples, in a form of PAXgene fixed and paraffin-embedded biopsies, were collected from the multi-site, double-blind, randomized, placebo-controlled trial, aimed at dose-finding and assessing the efficacy and tolerability of a 6-week treatment with ZED1227 capsules vs. placebo in subjects with well-controlled celiac disease undergoing gluten challenge. Total RNA was extracted from the PaxFPE biopsy specimens (n = 116) using additional cuttings from the samples on which histomorphometry was previously assessed. For the extraction, an RNeasy Kit (Qiagen, Hilden, Germany) was used according to the manufacturer’s instructions. Library preparation and next-generation sequencing (NGS) were performed by the Qiagen NGS Service. A total of 10 ng of purified RNA was converted into cDNA NGS libraries. Library preparation was quality controlled using capillary electrophoresis. Based on the quality of the inserts and the concentration measurements, the libraries were pooled in equimolar ratios and then sequenced on a NextSeq (Illumina Inc., San Diego, USA) sequencing instrument according to the manufacturer’s instructions, with 100 bp read length for read 1 and 27bp for read 2. The raw data were de-multiplexed, and FASTQ files for each sample were generated using bcl2fastq2 software (Illumina Inc., San Diego, USA).

  Dataset EGAD50000000491

• Characterization of Neoantigen-reactive T cells by Single-Cell Analysis

  Through CITE-seq and TCR-seq analysis of non-small cell lung cancer (NSCLC) tumor-infiltrating lymphocytes (TIL), we developed a neoantigen-reactive T-cell signature based on clonotype frequency and CD39 protein and CXCL13 mRNA expression. There are four datasets from four NSCLC cases. Each dataset includes (1) Transcriptome of tumor infiltrating lymphocytes (TIL), (2) Cell surface protein expression on TIL by Feature barcoding, (3) T-cell receptor analysis of TIL, and (4) Reference file for feature-barcoding antibodies.

  Study phs002792

• Human glioblastoma single cell RNA-seq from two patient, sampled at different positions within as well as outside tumor

  We performed deep single-cell RNA sequencing of two rare glioblastoma cases where tissue could be sampled from tumor core to macroscopically normal cortex. We processed two to three replicates per sample with the 10X Genomics V3.1 kits. Deep sequencing was performed to about 100,000 reads per cell on the Illumina NovaSeq 6000 platform, resulting in a total of 37 BAM files.

  Dataset EGAD50000001500

• RNA-seq after drug perturbation of primary lymphoma samples

  3'-end low-depth RNA sequencing data from 108 patients with chronic lymphocytic leukemia and 8 patients with lymphoma. Each primary patient sample was treated in vitro with DMSO as a control and with up to ten small-molecule inhibitors (ibrutinib, duvelisib, everolimus, trametinib, nutlin-3a, I-BET762, MK2206, selinexor, compound 26, and a combination of ibrutinib and compound 26). Sequencing was performed on the Illumina HiSeq4000. The dataset contains FASTQ files.

  Dataset EGAD50000002166

• WGS,RNA data of patients with multiple myeloma (MM) refractory to immunomodulatory agents (IMiDs) and proteasome inhibitors (PIs)

  Paired WGS and RNA-Seq data of patients with multiple myeloma (MM) refractory to immunomodulatory agents (IMiDs) and proteasome inhibitors (PIs). We performed whole genome and transcriptome sequencing of 39 heavily pretreated RRMM patients with at least double refractoriness revealing complex structural changes and a high mutational load.

  Dataset EGAD00001006189