16766 results for "sec+and+unspecified+malignant+neoplasm"

in 63.85 milliseconds.

• Recurrent somatic JAK-STAT mutations within a RUNX1-mutated pedigree

  Whole-exome sequencing of a RUNX1-mutated pedigree, including samples from mother, father and four offsprings. Recurrent somatic JAK-STAT mutations were found among the diseased individuals.

  Dataset EGAD00001002240

• Whole exome sequencing for ZNF384-rearranged ALL cases

  Whole exome sequencing for the matched germline and tumor DNA from 10 ALL cases with ZNF384 rearrangements.

  Dataset EGAD00001002152

• SCNA-Seq of plasma DNA samples

  Low coverage whole genome sequencing for the identification of somatic copy number alterations (SCNA) and focal amplification mapping in plasma DNA of prostate cancer patients

  Dataset EGAD00001002149

• The tissue origin of highly elevated cell-free DNA in patients with and without cancer

  Forty years ago, the first measurements of cell free DNA (cfDNA) from cancer patients revealed that its total concentration was often elevated compared to healthy controls. The basis for this increase, and in particular the source of the extra cfDNA in such patients, has never been determined. To address this issue, we assessed methylation patterns of cfDNA from 57 individuals, 34 of whom had unequivocally elevated cfDNA concentrations (i.e., >15 ng/mL of plasma). We found that the excess cfDNA in cancer patients did not come from either neoplastic cells or surrounding cells from the tumor's tissue of origin. Instead, 80% of the cfDNA was derived from neutrophils, B cells or T cells, with neutrophils accounting for ~2/3. B cells contributed more than T cells despite the great excess of T cells over B cells in the blood. To see if this result was generalizable to other clinical situations in which elevated cfDNA concentrations have been described, we evaluated nine patients before and one day following surgery. After surgical resection, cfDNA concentration increased by an average of 16.1-fold, as expected. The majority of this increase (55%) was contributed by leukocytes, though damaged hepatocytes contributed a substantial minority (31% of increase). These data suggest that the elevated concentrations of cfDNA in cancer patients, as with patients after surgery, arises largely from dying leukocytes—not from the neoplastic cells or the tissue of origin of the cancer.

  Study EGAS00001005400

• Oral Immunotherapy for Induction of Tolerance and Desensitization in Peanut-Allergic Children (IMPACT)

  Brief Summary:This is a randomized, double-blind, placebo-controlled, multi-center study comparing peanut oral immunotherapy (OIT) to placebo in the induction of tolerance and desensitization in peanut-allergic children. Eligible participants with peanut allergy will be randomly assigned to receive either peanut OIT or placebo for 134 weeks followed by peanut avoidance for 26 weeks.Detailed Description:An initial oral food challenge (OFC) to 1 g of peanut flour (500 mg peanut protein) will be conducted. Participants must have a clinical reaction during this OFC to initiate study dosing. After the initial OFC, the study design includes four phases:Initial dose escalation (1 day): Peanut or placebo dosing will be given incrementally and increase every 20 minutes until a dose of 12 mg peanut flour (6 mg peanut protein) or placebo flour is given. Build-up (30 weeks): Initial observed dose administration of highest tolerated dose, followed by daily OIT at home with return visit every 2 weeks for dose escalation. Maintenance (104 weeks):The participant will continue on daily OIT with return visits every 13 weeks. At the end of this phase the participant will undergo a blinded OFC to 10 g peanut flour (5 g peanut protein). Avoidance (26 weeks): In this final phase participants will be seen every 13 weeks. At the completion of this phase participants will have a final blinded OFC to 10g peanut flour (5 g peanut protein)

  Study phs003109

• DAC for DKFZ Recording physiological history of cells with chemical labeling

  DAC for the data in the publication "Recording physiological history of cells with chemical labeling" from DKFZ for Tobias Kessler (t.kessler@dkfz-heidelberg.de), Frank Winkler (frank.winkler@med.uni-heidelberg.de) and Kai Johnsson (johnsson@mr.mpg.de)

  Dac EGAC50000000054

• De novo metastatic prostate cancer cohort

  Fastq files from RNA sequencing of normal and tumor samples from 16 patients from the de novo metastatic prostate cancer cohort.

  Dataset EGAD50000002381

• Pan Prostate Cancer Group DK BAM files

  This dataset contains the BAM files from 32 Danish patients with prostate cancer, both germline and tumor tissues. These samples are part of the Pan Prostate Cancer Genome project.

  Dataset EGAD50000002318

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Enzymatic methylation sequencing of intestinal metaplasia

  We perform genome-wide EM-seq of 14 patients with concurrent matched normal, dysplasia and early gastric samples from South Korea. The dataset contains cram files from 38 samples.

  Dataset EGAD50000001538

• Holistic ends analysis

  This dataset comprises fastq or bam files derived from sequencing data of dsDNA and ssDNA libraries from 138 plasma cfDNA samples.

  Dataset EGAD50000001737

• Single cell transcriptomes from vascularized human retinal organoids

  Both control and vascularized organoids were processed using the 10x Chromium 3' RNA method. Sequencing reads were aligned with STARsolo.

  Dataset EGAD50000001216

• Dataset of Clonal Evolution of PPM1D Mutations in the Spectrum of Myeloid Disorders

  This dataset contains genomic profiles of 7 PPM1D-mutated patients across the spectrum of myeloid disorders using single-cell analyses (Tapestri technology) on diagnostic and longitudinal samples.

  Dataset EGAD50000001229

• SCLC MeDIP-seq

  Methylation profile of 33 patients with small cell lung cancer (SCLC) for both, tumour and normal lung samples using MeDIP-seq.

  Dataset EGAD50000000724

• Short-read transcriptomic data

  Short-read transcriptomic data of unaffected control, expansion negative, and expansion positive FECD CECs

  Dataset EGAD50000000436

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• SECRETO Oral metagenome

  The dataset comprises data for n=329 participants who underwent saliva sampling. Shotgun metagenomic paired-end sequencing was conducted using the Illumina NovaSeq 6000 platform, and the resulting files are in FASTQ format.

  Dataset EGAD50000000283

• PCA Atlas donor genotyping arrays (Axiom UK Biobank v2.0)

  Raw Axiom v2.0 UK Biobank Array CEL files for PCA Atlas donor buffy-coat DNA, used to generate SNP genotypes for demultiplexing single-cell and spatial transcriptomics libraries.

  Dataset EGAD00010002818

• OncoScan SNP data set for localized follicular lymphoma (lFL)

  149 unpaired initial tumor samples (133/149 FFPE and 16/149 fresh frozen samples) of lFL patients measured with OncoScan SNP microarrays, Affymetrix CEL intensity data file types (Thermo Fisher Scientific, Waltham, Massachusetts, USA)

  Dataset EGAD00010002593

• H3Africa EPIGEN EWAS

  Data from 59 whole blood samples from pregnant mothers, unexposed and exposed to the Rwandan genocide, was generated using Infinium MethylationEPIC BeadChip Kit.

  Dataset EGAD00010002383

• H3Africa SIREN GWAS Stroke

  3421 Samples from Nigeria and Ghana, genotyped with the Illumina NestSeq 500

  Dataset EGAD00010002551

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• Hospital for Sick Children Infant Glioma RNA Sequencing

  Whole transcriptome (n=4) and targetted RNA sequencing (n=15) .bam files of infantile glioma samples reported on at the Hospital for Sick Children

  Dataset EGAD00001005092

• ChIP-seq for GOF p53

  This dataset includes ChIP-seq data from two cell lines (HKCI-11 (GOFp53) and MIHA(WT p53)). All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005449

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• BAM files of evolution T-ALL adults project

  WGS BAMs of 19 adult patients with T-acute lymphoblastic leukemia with primary, remission and relapse sample per patient. Total = 58 samples sequenced with HiSeq 4000 or NovaSeq 6000 (Illumina).

  Dataset EGAD00001006543

• ATAC data for Glioblastoma (EGAS00001003953, H016)

  ATAC-seq data for 2 glioblastoma cell lines (LN229, ZH487), NT and SOX10KD.

  Dataset EGAD00001006544

• Trio Sequencing results for the AnkyrinG MIPS screening study

  Approximately 1000 trio's with varying degrees of cognitive disorders. All samples have been sequenced for the AnkyrinG interactome using MIPS technology. Data is presented as BAM and unfiltered VCF files.

  Dataset EGAD00001006823

• Clinical dataset (new)

  ctDNA guiding adjuvant immunotherapy in urothelial carcinoma (Nature 2021). ABACUS clinical data cut (2020) used in 2021 paper: Clinical data include PCR, RFS_months, RFS_event, and OUTCOME for 40 patients in ABACUS with ctDNA data.

  Dataset EGAD00001007578

• WGS-TOF study

  Whole genome sequencing data (bam) of tetralogy of Fallot study, including data derived from iPSCs of two control and four patients with tetralogy of Fallot (two with DiGeorge syndrome (DG), two without DiGeorge syndrome (ND).

  Dataset EGAD00001008569

• Paired-end Whole Exome-seq analysis of TERT promoter duplication in GBM

  Dataset contains paired-end Whole Exome sequencing data from 5 tumor samples and 1 single normal blood sample from a single primary GBM patient.

  Dataset EGAD00001008768

• SNP array data in Massim study

  The compressed file contains plink format file for the Illumina MEGA SNP array data of 255 individuals generated and analyzed in Liu et al study of genom-wide variation of the Massim region.

  Dataset EGAD00001008545

• Hypoxia acts as an environmental cue for the human TRM differentiation program

  Dataset consists of 19 bam files from RNA sequencing experiments batch1 and batch2.

  Dataset EGAD00001007692

• GCAT| PCAs GCATcoreSpain V2

  First 20 principal components of 4988 genotyped GCAT Cohort individuals with Infinium Multi-Ethnic Global (MEGAEX2) array, with data for Cr1-22. Plink files with QC and imputed (SHAPEIT+IMPUTE).

  Dataset EGAD00001007730

• Dataset for Stromal-induced epithelial-mesenchymal transition induces drug resistance in acute lymphoblastic leukemia

  RNA-seq was performed to compare gene expression profiles between 11 patient adherent ALL samples and nonadherent ALL samples.

  Dataset EGAD00001009056

• Long-read sequencing for cell-free DNA analysis (human pacbio)

  8 pregnant women at the 3rd trimesters, 4 hepatitis B carriers, and 4 patients with hepatocellular carcinoma

  Dataset EGAD00001009427

• Human Origins array data for 1510 individuals

  Genotype data typed on the Human Origins array for 1510 individuals published in "Dense sampling of ethnic groups within African countries reveals fine-scale genetic structure and extensive historical admixture."

  Dataset EGAD00001010015

• RNA sequencing of human lung fibroblasts

  Bulk RNA seq data from human lung fibroblasts isolated from fresh and cryopreserved lung tissue (18 samples, 3 donors)

  Dataset EGAD00001010252

• Ovarian cancer cfDNA dataset

  The dataset contains 23 ovarian cancer and 2 healthy control urine cfDNA samples. Shallow WGS was performed on an Illumina Novaseq S4 PE150bp. Samples are provided as raw reads without any prior processing.

  Dataset EGAD00001010848

• Nanopore medulloblastoma data

  Nanopore data from 3 medulloblastoma samples of which 2 are tumor-normal pairs sequenced with the MinIon and one is tumor only data sequenced on the PromethIon. The data consists of BAM files aligned using minimap2

  Dataset EGAD00001010851

• Single-cell CITE-seq from MDS patients with SF3B1 mutations

  Single-cell CITE(cellular indexing of transcriptomes and epitopes)-seq from MDS (n = 2, MDS02 in 2 replicates). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011281

• ARIC

  Bam files are from matched normal + "very early" plasma (diagnostic) samples, sequenced on Illumina NovaSeq 6000 instrument. After bwa alignment, duplicates were removed by picard markduplicate, and base quality scores recalibrated using gatk baserecalibrator + apply bqsr.

  Dataset EGAD00001015603

• Identifying new diagnostic and treatment pathways for patients with unclassifiable sarcomas

  Whole genome sequencing of tumour normal pairs of human undifferentiated sarcomas.

  Dataset EGAD00001003216

• H3Africa H3AChipDesign MalSic

  The dataset includes BAM, FASTQ and decompressed gVCF files for 50 samples from Benin generated for the H3Africa Chip Design Study.

  Dataset EGAD00001004557

• Tumor-associated preferred end coordinates and somatic variants as signatures of circulating tumor DNA

  Plasma DNA libraries were constructed from 4 mL of plasma without library enrichment, namely without PCR amplification. Paired-end massively parallel sequencing was performed

  Dataset EGAD00001004561

• NKI-AvL CRC-OVC RNA-seq

  The dataset “NKI-AvL CRC-OVC RNA-seq" includes 4 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 for 2 colorectal cancer and 2 ovarian cancer patients.

  Dataset EGAD00001004341

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• Cell lines with telomere fusion-induced rearrangements

  Whole-genome somatic rearrangement and point mutation analysis in cell lines with induced telomere fusions.

  Dataset EGAD00001001629

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• whole genome sequencing

  Whole-genome sequencing was performed by Illumina Inc (San Diego, CA). Libraries were constructed with ~300bp insert length and paired-end 100bp reads were sequenced on Illumina HiSeq2000.

  Dataset EGAD00001000782

• Locally advanced rectal cancer samples

  Fastq files from exome sequencing of paired normal/tumor (pre and post-nCRT) samples from 7 patients with rectal tumors. All samples were sequenced on a 5500xl SOLiD sequencing platform (Thermo Fisher Scientific).

  Dataset EGAD00001004378

• Identification of the underlying causal variant in a multi-generational family with autosomal dominant common variable immunodeficiency

  Common variable immunodeficiency (CVID) is the most common form of primary immunodeficiency with an estimated incidence of 1:10,000. It has been apparent for many years that CVID has a genetic component, occurs frequently in families and can have both a recessive or dominant mode of inheritance. In recent years, 4 genes underlying CVID have been identified; however, mutations within in them are estimated to account for no more than 10% of all cases of CVID. We have identified a multi-generational family with autosomal dominant CVID. Genome-wide linkage analysis has mapped the locus underlying CVID in this family to an approximately 9.2 Mb interval on chromosome 3q27.3-q29, between the markers D3S3570 and D3S1265. This locus is distinct from any of the previously mapped susceptibility loci suggesting a novel genetic variant is responsible for disease in this family. The aim of this study is to use exome sequencing of affected (n = 4) and unaffected (n = 4) individuals, in tandem with the available genetic mapping data, to identify the causal variant underlying CVID in this family.

  Dataset EGAD00001000363

• WGS of HSPC clones of healthy individual sequenced with Illumina NovaSeq 6000

  Dataset contains WGS sequecing data from clonally expanded hematopoietic stem cells from 7 individual pediatric cancer patients. Samples were taken before (DX - diagnosis) or Follow-up (DX2/REM/FU - Diagnosis 2, remission or follow-up, respectively). In addtion, cord blood clones (Designated CB) treated with X-ray radiation, Cisplatin, Maphosphamide, Vincristine and Doxorubicin and untreated cord blood hematopoietic stem/progenitor cells were have been whole-genome sequenced. (Abbreviations RAD, CISPL, MAPH, VINC, DOX and CTRL, respectively)

  Dataset EGAD00001007078

• Multisample genomic analysis of solid childhood cancers using high resolution SNP-arrays, Whole Exome Sequencing and Targeted Deep Sequencing.

  We mapped the prevalence of genetically distinct clones over 248 regions in 54 childhood cancers. This revealed that primary tumors can simultaneously follow up to four evolutionary patterns in different anatomic areas. The most common pattern consists of a fluctuating presence over anatomic space of subclones with very few mutations. The second most common is a surprisingly stable coexistence, over vast areas, of clones with different changes in chromosome numbers. This is contrasted by a third, less frequent, pattern where a novel clone harboring driver mutations or structural chromosome rearrangements completely replaces its progenitor. The fourth and rarest pattern is the local emergence of a myriad of clones with TP53 inactivation. Strikingly, death from disease was limited to tumors exhibiting the two latter, most dynamic patterns.

  Study EGAS00001002662

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Reactivation of telomerase reverse transcriptase (TERT) expression enables cells to overcome replicative senescence and escape apoptosis, fundamental steps in the initiation of human cancer. Multiple cancer types, including up to 83% of glioblastomas (GBM), harbor highly recurrent TERT promoter mutations of unknown function but specific to two nucleotide positions. We identify the functional consequence of these mutations in GBM to be recruitment of the multimeric GABP transcription factor specifically to the mutant promoter. Allelic recruitment of GABP is consistently observed across four cancer types, highlighting a shared mechanism underlying TERT reactivation. Tandem flanking native ETS motifs critically cooperate with these mutations to activate TERT, likely by facilitating GABP heterotetramer binding. GABP thus directly links TERT promoter mutations to aberrant expression in multiple cancers.

  Study EGAS00001001242

• Adult B-precursor acute lymphoblastic leukemia transcriptomes

  Bone marrow or peripheral blood samples were collected of adult patients at first diagnosis of B-precursor acute lymphoblastic leukemia. RNA was isolated from mononuclear cells and subjected to mRNA library prep using Poly-A selection and sequencing on a NovaSeq 6000 system. Obtained gene expression profiles and gene fusion calls were used to allocate samples to molecular disease subtypes.

  Dataset EGAD00001008633

• RNA-seq data

  RNAseq FASTq files of 181 bulk pre-treatment and 14 post-treatment tumors from GO30140 Ph1b group A and F and 177 bulk pre-treatment tumors of IMbrave150 PhIII

  Dataset EGAD00001008128

• A Tumour Organoid Biobank for Mapping Cancer Cell Vulnerabilities - RNA

  RNA sequencing data from cancer patient-derived organoids. Part of a study to include genomic and transcriptomic sequencing data, along with CRISPR screening data from cancer patient-derived organoids and matched tumour tissues. Some organoids were developed as part of the Human Cancer Models Initiative (HCMI) in collaboration with Cancer Research UK (CRUK). The study includes organoids derived from colorectal, oesophageal, ovarian, pancreatic, and stomach cancer samples.

  Dataset EGAD00001015470

• Genetic Epidemiology of Ovarian Cancer Histotypes

  Epithelial ovarian cancer is a highly fatal malignancy with known genetic etiology; however, it is estimated that a substantial portion of narrow sense heritability remains to be discovered. The goal of this research was to use genetic information from distantly related ovarian cancer cases to identify regions of the genome that may harbor rare risk variants for epithelial ovarian cancer. The study was conducted in the setting of the Utah Population Database, a statewide data resource in which extensive ancestry data are linked to Utah Cancer Registry records. Focusing on families with a statistically significant excess risk of epithelial ovarian cancer, we used the Infinium Global Screening Array v.3.0 to generate germline genotyping data for distantly related cases. We then applied Shared Genomic Segment Analysis to each set of related cases to identify genomic regions that may harbor ovarian cancer risk variants. Eleven regions were identified. Genotype data are available through dbGaP for one case from each pedigree. Genotype data from other ovarian cancer cases within the high-risk pedigrees as well as the pedigrees' corresponding structures can be requested and made available with approval from the Utah Resource for Genetic and Epidemiologic Research (RGE).

  Study phs003140

• Residual ANTXR1+ myofibroblasts after chemotherapy inhibit anti-tumor immunity via YAP1 signaling pathway

  Although cancer-associated fibroblast (CAF) heterogeneity is well-established, the impact of chemotherapy on CAF populations remains poorly understood. We address this question in high-grade serous ovarian cancer (HGSOC), in which we previously identified 4 CAF populations. While the global content in stroma increases in HGSOC after chemotherapy, the proportion of FAP+ CAF (also called CAF-S1) decreases. Still, maintenance of high residual CAF-S1 content after chemotherapy is associated with reduced CD8+ T lymphocyte density and poor patient prognosis, emphasizing the importance of CAF-S1 reduction upon treatment. Single cell analysis, spatial transcriptomics and immunohistochemistry reveal that the content in the ECM-producing ANTXR1+ CAF-S1 cluster (ECM-myCAF) is the most affected by chemotherapy. Moreover, functional assays demonstrate that ECM-myCAF isolated from HGSOC reduce CD8+ T-cell cytotoxicity through a Yes Associated Protein 1 (YAP1)-dependent mechanism. Thus, efficient inhibition after treatment of YAP1-signaling pathway in the ECM-myCAF cluster is required to enhance CD8+ T-cell cytotoxicity. Altogether, these data pave the way for novel therapy targeting YAP1 in ECM-myCAF in HGSOC.

  Study EGAS50000000136

• Kidney_transplant_nephrectomy_scRNAseq

  Single cell transcriptomics study of tissue from human kidney transplant nephrectomies Tissue is acquired from kidney transplant nephrectomies, homogenised and disaggregated to a single cell suspension prior to droplet encapsulation single cell RNAseq (10X protocol) or plate based single cell RNAseq (SS2 protocol). Human tissues, including the kidney are seeded with a tissue resident immune cell network throughout life. These cells may self renew in situ or be replaced by circulating precursors which enter the tissue in response to tissue specific niche and inflammatory signals. We are using single cell RNA sequencing of kidney transplant nephrectomy tissue to 1) understand the immune cell populations which are resident within the human kidney 2) identify which of these populations is donor or recipient derived. 3) Uncover the temporal dynamics of donor/recipient chimerism in the the human kidney following transplantation. 4) Understand transcriptional differences between organs removed for a variety of reasons (infection, chronic rejection, vascular emergencies) This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001003935

• De novo assembly of 150 Danish genomes reveals rich structural complexity

  Most known genetic variation in human genomes has been called from comparison of short reads to the reference genome, an approach biased against finding complex variation. We sequenced 150 individuals from 50 parent-offspring trios with multiple insert-size libraries to very high coverage. We show that each genome could be independently de novo assembled into a small number of high-quality scaffolds (median N50 > 21 Mb), each of quality comparable to long read assemblies while being very cost-effective. We show that our variant call set from comparing de novo assemblies is far more complete in terms of complex variation than previous studies. Importantly, even the complex 4-5 Mb extended MHC region was assembled and resolved into haplotypes, revealing >700kb novel sequence in this important region of the genome, and major parts of the Y chromosome including some palindromes were assembled with high accuracy. Finally, we show that our variant call-set allows for the genotyping of many more complex variants when used as a reference-panel for imputation into SNP-chip data or into previously resequenced genomes.

  Study EGAS00001002108

• Target gene sequencing for human normal endometrial glands

  To elucidate the timing and mechanism of the clonal expansion of somatic mutations in cancer-associated genes in the normal endometrium, we conducted target sequencing of 112 genes for 1,298 endometrial glands and matched blood samples from 36 women. By collecting endometrial glands from different parts of the endometrium, we showed that multiple glands with the same somatic mutations occupied substantial areas of the endometrium. The 112 genes are as follows: ABCC1, ACRC, ANK3, ARHGAP35, ARID1A, ARID5B, ATCAY, ATM, ATR, BARD1, BCOR, BRCA1, BRCA2, BRD4, BRIP1, CAMTA1, CDC23, CDYL, CFAP54, CHD4, CHEK1, CHEK2, CTCF, CTNNB1, CUX1, DGKA, DISP2, DYNC2H1, EMSY, FAAP24, FAM135B, FAM175A, FAM65C, FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANCI, FANCL, FANCM, FAT1, FAT3, FBN2, FBXW7, FGFR2, FRG1, GPR50, HEATR1, HIST1H4B, HNRNPCL1, HOOK3, KIAA1109, KIF26A, KMT2B, KMT2C, KRAS, LAMA2, LRP1B, MLH1, MON2, MRE11A, MSH2, MSH6, MTOR, NBN, PALB2, PHEX, PIK3CA, PIK3R1, PLXNB2, PLXND1, PMS2, POLE, POLR3B, PPP2R1A, PTEN, PTPN13, RAD50, RAD51, RAD51B, RAD51C, RAD51D, RAD52, RAD54B, RAD54L, RICTOR, SACS, SIGLEC9, SLC19A1, SLX4, SPEG, STT3A, TAF1, TAF2, TAS2R31, TFAP2C, TNC, TONSL, TP53, TTC6, UBA7, VNN1, WT1, XIRP2, ZBED6, ZC3H13, ZFHX3, ZFHX4, ZMYM4.

  Study EGAS00001005914

• Targeted and Whole Exome Sequencing for Validation of PGDx elio tissue complete

  This dataset consists of 116 tumor and normal samples analyzed with whole exome sequencing on the HiSeq2500 instruments with 100bp paired-end reads as well as 760 tumor and normal samples analyzed with the PGDx elio tissue complete assay. The PGDx elio tissue complete assay is a hybrid capture approach targeting 500+ genes with sequencing on the NextSeq instruments with 150bp paired-end reads. The bam files provided have been adapter masked and contain duplicate reads.

  Dataset EGAD00001008099

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267

• Tumor Whole-exome sequencing

  20 tumor tissue WES data with paired cfDNA sWGS data. This data is used for concordance analysis between cfDNA-based and tissue-based CNA. The WES libraries were sequenced across 3 independent runs using multiple lanes.

  Dataset EGAD50000001864

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• Young-Boost Whole Exome Sequencing (WES)

  Datasets associated with Young Boost Trial for Breast Cancer patients. Whole Exome Sequencing (WES) performed on 109 Samples (75 Tumor and 34 Normal). WES was performed to identify potential predictive biomarkers for treatment response.

  Dataset EGAD50000001171

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• Spatial transcriptomics analysis of triple negative breast cancers

  Spatial transcriptomics analysis of triple negative breast cancers Both bulk sequencing and ST were performed Counts, images etc are available at https://zenodo.org/doi/10.5281/zenodo.8135721

  Dataset EGAD50000000686

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• RNA-seq data for Heterogeneity of IKZF1 genomic alterations and risk of relapse in childhood BALL

  RNA-seq data for 14 samples with B-cell acute lymphoblastic leukemia

  Dataset EGAD50000000151

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• Pacbio_methylation_controls

  The PacBio control dataset for differential methylation analysis included 39 control samples without methylation disorders. All samples were sequenced using PacBio Revio® HiFi reads at a matched coverage of 15X, and methylation was called using pb-cpg-tools on aligned BAM files.

  Dataset EGAD00010002806

• Peru.mg.maf.subsetEGA

  Genotypes generated for study investigating signals of selection in Peruvians from three ecological regions. 96 genotypes in plink format after QC filtering (missingness per individual, per variant and minor allele freq). See publication for more details on QC filtering.

  Dataset EGAD00010002261

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716

• GATCI_Oncoscan_Data

  This dataset contains files generated from Affymetrix Oncoscan Arrays. For each sample there are two paired cel files containing the raw data from AT and GT channels. Raw data has been transfromed to OSCHP signal files also within this dataset.

  Dataset EGAD00010001579

• BLUEPRINT Gene expression profiles of human hematopoietic progenitors

  Gene expression was analyzed for stem/progenitor cell types and terminally differentiated cell types of the human blood lineage (HSC, MPP, CMP, GMP, CLP, MLP0, MLP1, MLP2, MLP3).

  Dataset EGAD00001002733

• JIA family

  Exome sequencing data for two sibs with juvenile idiopathic arthitis and one unaffected sib

  Dataset EGAD00001004806

• WGS datasets of pediatric glioblastoma

  WGS with linked reads of pediatric glioblastoma. For each patient, blood and tumor tissue were sequenced. For two patients, we also provide sequencing data for the blood of their parents.

  Dataset EGAD00001005212

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• MDA whole exome sequencing data for bladder cancer

  46 BAM files from 23 urothelial bladder cancer patients on an immunotherapy clinical trial. PBMC normal samples and solid tumor samples are paired. Alignment was done by BWA with reference genome hg19.

  Dataset EGAD00001005712

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• Targeted panel sequencing for brainstem glioma

  Targeted panel sequencin on Illumina HiSeq X Ten of brainstem glioma primary tumor and blood samples

  Dataset EGAD00001006093

• WGS files for AML data

  WGS files for paper titled "Integrative Analysis of Pediatric Acute Leukemia Identifies Acute Myeloid/T-Lymphoblastic Leukemia Subtype that Spans a T Lineage and Myeloid Continuum with Distinct Prognoses"

  Dataset EGAD00001006442

• WXS files for AML data

  WXS files for paper titled "Integrative Analysis of Pediatric Acute Leukemia Identifies Acute Myeloid/T-Lymphoblastic Leukemia Subtype that Spans a T Lineage and Myeloid Continuum with Distinct Prognoses"

  Dataset EGAD00001006443

• RNASeq files for AML data

  RNASeq files for paper titled "Integrative Analysis of Pediatric Acute Leukemia Identifies Acute Myeloid/T-Lymphoblastic Leukemia Subtype that Spans a T Lineage and Myeloid Continuum with Distinct Prognoses"

  Dataset EGAD00001006444

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• High-resolution analysis for urinary DNA jagged ends

  consists 17 cases, 7 control cases and 10 cancer cases.

  Dataset EGAD00001008594