12277 results for ""statistically+reactive"+taxa+in+microbial+community"

in 29.45 milliseconds.

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Patient-derived xenograft models of head and neck cancers

  Establishment and characterization of two patient-derived xenograft models from HNSCC patients , initiatlly treatment-naive, and for which cetuximab-acquired resistant model couterparts have been generated. All models have been characterized at genomic level. HNSCC tissues were obtained from surgical resections at Cliniques universitaires St Luc in Brussels (Belgium).

  Dac EGAC50000000502

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• Tumor Profiler Project - OV cell-free DNA data

  The dataset contains amplicon sequencing data from 48 samples from 35 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format.

  Dataset EGAD50000001410

• Long-read whole genome sequencing as a tool for variant detection in inherited retinal dystrophies

  WGS sequencing using nanopore long reads sequencing. These data is used for the diagnosis of patients with inherited retinal dystrophies.

  Study EGAS50000000846

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Targeted capture sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Targeted capture sequencing for 366 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study and 29 samples from a previously uploaded dataset.

  Dataset EGAD50000001364

• Whole-genome-sequencing and Whole-exome-sequencing in Spastic paraplegia

  To identify the genetic cause and modifiers of Spastic paraplegia, we performed Whole-genome-sequencing and Whole-exome-sequencing of Spastic paraplegia patients.

  Study JGAS000494

• cfDNA sWGS BAM — Metastatic colorectal cancer

  Plasma cirDNA sWGS for metastatic colorectal adenocarcinoma at diagnosis prior to systemic therapy. Libraries DSP/SSP (per sample). Sequencing by IntegraGen (2022–2024). Alignment: GRCh38 with BWA-MEM; BAMs sorted/indexed; delivered as primary mapped reads only (filters/MAPQ in analysis metadata). Controlled access

  Dataset EGAD50000001879

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• Ultra-long whole-genome and Cas9-targeted nanopore sequencing of fibroblasts: FSHD, BAMS, healthy controls

  Data from the D4Z4End2End study (Xiao et al. 2025), for genetic and epigenetic analysis of the D4Z4 macrosatellite in health and disease.

  Dataset EGAD50000001551

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• WGS for 21 samples

  This dataset contains whole-genome sequencing (WGS) data from 14 acute leukemia cases of the newly identified FOXF1/FENDRR ALL subtype, including diagnosis or relapse samples, as well as 7 matched germline samples. All the 21 samples are in bam file type.

  Dataset EGAD50000001790

• Sorted WGS for three samples

  This dataset contains Whole Genome Sequencing (WGS) data from two cell populations (myeloid and lymphoid) and the germline population sorted from a primary sample of the novel FOXF1/FENDRR ALL subtype. All the three samples are in bam file type.

  Dataset EGAD50000001792

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• Combination Therapies for Personalised Cancer Medicine in 11-18 (2019-06-10)

  This study involves mutagenizing 11-18 with ENU to identify those mutations which engender resistance to targeted treatment. . This dataset contains all the data available for this study on 2019-06-10.

  Dataset EGAD00001005081

• SMRT-seq

  In this study, we enhanced 5mC detection using SMRT sequencing by holistically analyzing kinetic signals of a DNA polymerase and sequence context for every base within a measurement window. We employed a convolutional neural network to train a methylation classification model.

  Dataset EGAD00001006875

• Chromatin Profiling in Twins (2019-08-21)

  50 lymphoblastoid cell lines of adult female Twins which are part of the MuTHER study, subjected to Chromatin Immunoprecipitation using an antibody for H3K4me1. H3K4me1 peaks mark distal regulatory elements. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005274

• DKFZ-St.Jude Medulloblastoma - 218 CEF control exomes

  218 control exomes, CEF cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006659

• Sporadic and endemic Burkitt lymphoma have frequent FOXO1 mutations but distinct hotspots in the AKT recognition motif

  Sample set of 74 whole-exome sequencing samples from sporadic Burkitt lymphoma patients from the UK. 33 of these samples have matched constitutional data, giving a total number of 107 samples

  Dataset EGAD00001005105

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• Phenotypic characterisation of LRRN4CL over-expression

  This study aims to use RNAseq to identify differentially expressed transcripts in human melanoma cells that over-express the cell surface protein, LRRN4CL, relative to empty-vector control cells, to provide mechanistic insight into how LRRN4CL over-expression confers enhanced pulmonary metastatic colonisation abilities.

  Dataset EGAD00001006249

• Data files for PCGP SJACT WES

  This dataset contains WES files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002679

• Primary tumor/metastatic/germline DNA trios equences files

  Exome sequences of primary tumor/metastatic/germline DNA trios. Tumoral and germline samples were sequenced to an expected depth of respectively 150M and 50M reads in order to obtain differential depth (>100X versus >30X). Submitted data are paired-end fastq files.

  Dataset EGAD00001006324

• CNA vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  CNA calls generated using the SomaticSniper-TITAN-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004440

• DKFZ-St.Jude Medulloblastoma - 70 PAN-GATC control exomes

  Exome controls for 70 individuals, PAN-GATC cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006661

• Non-small cell lung cancer targeted sequencing

  Targeted sequencing of non-small cell lung cancer samples. BAM files of paired end reads aligned to hg19 using BWA MEM v0.7.1573. This targeted panel covers 370 genes of clinical relevance in non-small cell lung cancer.

  Dataset EGAD00001007918

• Pre and Post BCG treated bulk RNAseq dataset.

  We have in total 16 files, technical duplicates of 8 unique samples from Pre and Post BCG samples collected from four non muscle invasive bladder cancer patients. These are bulk RNAseq samples generated by high-throughput sequencing platform.

  Dataset EGAD00001006634

• Whole exome sequencing of 3 primary Plasma Cell Leukemia samples

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 3 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001005306

• Sequencing data for oesophageal / related samples - Foley, Shorthouse et al (RNA)

  Data supporting: "SMAD4 and KCNQ3 Alterations are Associated with Lymph Node Metastases in Oesophageal Adenocarcinoma" RNAseq (FASTQ files) 6 samples

  Dataset EGAD00001011065

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003909

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003957

• HERBY trial RNASeq

  RNA sequencing of non-brainstem paediatric high grade glioma from the HERBY phase II randomised trial. RNA from fresh frozen surgical tissue in 20 cases was subjected to Illumina whole transcriptome paired end sequencing. Data is provided as paired-end FASTQ files

  Dataset EGAD00001004070

• 3_eCLIP_TDP-43

  eCLIP of TDP-43 from iPSC-derived motor neurons in 2 control lines. Per line input and IP samples and analysis including bigWig files and peak files.

  Dataset EGAD00001008426

• PSC-IBD-CRC

  Formalin-fixed, paraffin-embedded samples from 19 PSC-IBD-CRCs, 15 adjacent (non-tumour) mucosa samples and 18 non-mucosal DNA samples were collected via the nationwide network and registry of histo- and cytopathology in the Netherlands (PALGA). DNA was extracted for molecular analysis.

  Dataset EGAD00001006226

• EFFORT occupationally exposed human stool metagenomes (148 samples)

  Metagenomes of stool samples from 54 pig farmers, 24 broiler farmers and 70 slaughter line workers. Note: Access to the data will only be granted for antibiotic resistance studies in accordance with the EFFORT consents issued by the participants.

  Dataset EGAD00001005444

• The natural history of clonal haematopoiesis: phase 6 targeted

  Deep targeted sequencing of 56 genes associated with clonal haematopoiesis and haematological malignancy in peripheral blood-derived DNA from 11 older adults, each previously sampled 2-5 times over the preceding ~13 years.

  Dataset EGAD00001007683

• Bulk mRNA sequencing of GBM cell lines

  We expressed PDGFRAmut, wild-type PDGFRA and a GFP control from lentivirus, in two primary GBM patient-derived cell lines that we had cultured as monolayers.

  Dataset EGAD00001002269

• Dataset for Ewing_sarcoma_PNET-WHOLE_GENOME

  Rare cancer sequencing data of 18 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008874

• Dataset for colorectal_cancer-WHOLE_GENOME

  Rare cancer sequencing data of 54 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008872

• Shwachman-Diamond syndrome (SDS) Exome sequencing

  Shwachman-Diamond syndrome (SDS) is a rare autosomal recessive disorder characterized by exocrine pancreatic insufficiency, bone marrow dysfunction, leukemia predisposition, and skeletal abnormalities. We aim to characterise the structural effects of SDS in patients with this disorder by exome sequencing.

  Dataset EGAD00001000847

• BLUEPRINT Epigenetic characterization of megakaryocytes and erythroblasts

  Megakaryocytes and erythroblasts derive from the same progenitor cell type but carry out very different functions. In order to understand how the different functional phenotypes arise we have characterised the epigenetic landscape of these cells.

  Dataset EGAD00001001871

• SNV vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  SNV calls generated using the MuTect-Battenberg-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004434

• SNV vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  SNV calls generated using the SomaticSniper-Battenberg-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004432

• CNA vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  CNA calls generated using the MuTect-TITAN-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004442

• CNA vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  CNA calls generated using the MuTect-Battenberg-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004443

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Variants from germline WES data of pediatric cancer patients

  This dataset contains germline variants (in .vcf format) from six pediatric cancer patients (sample IDs D1 - D6). WES data of the children and their parents was mapped to hg38. A consensus of four variant callers was used to obtain germline variants of the children.

  Dataset EGAD00001009678

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• SNV vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  SNV calls generated using the SomaticSniper-TITAN-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004431

• Genetic factors underlying premature MI in Greek families without vessel disease

  The study will analyse by exome sequencing 8 Greek family members with an excess of potentially damaging mutations relating to premature MI and no vessel disease, to identify genetic factors underlying this condition. This is a follow on from project GPMI-NVD

  Dataset EGAD00001002178

• MDS primary and xenografted samples

  This dataset contains bam files mapped to hg19 that either were primary bone marrow cells or sorted human cells after long term engraftment in NSG mice.

  Dataset EGAD00001007760

• CNA vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  CNA calls generated using the SomaticSniper-TITAN-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004441

• Somatic mutations of 256 whole-genome sequenced colorectal cancer tumors.

  Somatic mutations of 256 whole-genome sequenced colorectal tumors. 234 MSS, 19 MSI and 3 POLE mutants. See Katainen R. et al. CTCF/cohesin-binding sites are frequently mutated in cancer, Nature Genetics 2015. doi:10.1038/ng.3335

  Dataset EGAD00001004329

• Dataset for NSCLC-EXON

  Rare cancer sequencing data of 42 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008892

• Whole Transcriptome Sequencing

  RNA-seq data of 15 snap-frozen tissue of peritoneal mesothelioma. The strand specific RNA library prepared using TruSeq (Illumina) and pair-end sequencing performed in Illumina HiSeq 4000. The datasets contains paired fastq files for each of 15 tumor samples.

  Dataset EGAD00001004504

• scATAC-seq of first and second trimester human gonads - HUGODECA dataset

  Comprehensive map of first- and second-trimester gonadal development in humans using a combination of single-cell and spatial transcriptomics, chromatin accessibility assays, and imaging. ArrayExpress Accession: E-MTAB-10570

  Dataset EGAD00001009387

• Gene expression profile of mesothelial cells from peritoneal adhesion biopsies

  RNA-sequencing analysis was carried out on mesothelial cells isolated from peritoneal adhesion biopsies and compared to control human peritoneal mesothelial cells to identify a mesothelial-to-mesenchymal transition (MMT)-related gene signature in patients.

  Dataset EGAD00001008324

• Primary plasma cell leukemia genomic abnormalities

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 20 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001004323

• IBDCA_Edinburgh

  In this experiment we have sequenced tumour normal pairs from patients presenting with CRC who have a prior history of inflammatory bowel disease. The idea is to identify driver mutations, new genes and novel pathways associated with the development of these malignancies.

  Dataset EGAD00001001330

• Exploration of neuroblastoma xenograft models for tumor extracellular RNA profiling in murine blood plasma

  Total RNA sequencing (SMARTer Stranded Total RNA-Seq Kit v2) data of extracellular RNA (exRNA) from liquid biopsies of neuroblastoma xenograft models.

  Dataset EGAD00001010905

• multi-region sequencing of tumor samples from PDAC patients

  This study includes 542 of multi-region sampled whole exome sequencing data from 83 pancreatic cancer patients in 6 individual experiments : Kras wildtype, local recurrence, treatment-naive (MetomeV2), radiotherapy plus chemotherapy (Radome), chemotherapy-only group (Treatome) and Proj_B-100-478.

  Dataset EGAD00001011109

• Metastatic Breast Cancer Whole Genome

  We propose to definitively characterise the somatic genetics of Metastatic breast cancer through generation of comprehensive catalogues of somatic mutations in Metastatic breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000899

• Dataset for EGAS00001007937

  WGS, RNAseq, Methylation, variant calling analysis for a Novel paediatric case of a spinal high-grade astrocytoma with piloid features in a patient with Noonan Syndrome

  Dataset EGAD00001015412

• RNA-seq data of patients with glioblastoma IDH-wt (CNS WHO grade 4) with matched primary and relapse samples.

  Between January 1st, 2016, and December 31th, 2021, patients with glioblastoma IDH-wt (CNS WHO grade 4) were included. RNA-seq was performed in a subset of patients.

  Dataset EGAD00001015683

• Ovarian cancer/normal cell lines

  We performed whole genome sequencing of nine OC patient-derived cell lines and one normal cell line (HOSEpiC) to analyze if the cell lines harbor OC-typical genomic aberrations absent in normal cells and to relate genomic features to drug sensitivities.

  Dataset EGAD00001003146

• RNA bam files of Renal Cell Carcinoma patients

  the dataset contains RNA bam files of Renal Cell Carcinoma patients, which belongs to "An Empirical Approach Leveraging Tumorgrafts to Dissect the Tumor Microenvironment in Renal Cell Carcinoma Identifies Missing Link to Prognostic Inflammatory Factors"

  Dataset EGAD00001003895

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003975

• Sequencing-based counting and size profiling of plasma Epstein-Barr virus DNA enhance population screening of nasopharyngeal carcinoma.

  We used targeted sequencing to capture and measure the abundance as well as the size profiles of EBV DNA in plasma of subjects with and without NPC

  Dataset EGAD00001004204

• SNV vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  SNV calls generated using the MuTect-TITAN-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004433

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Whole Genome Sequencing of 18 sequential samples from 3 CLL patients

  Whole Genome Sequencing to track subclonal heterogeneity in 18 samples from 3 Chronic Lymphocytic Leukemia patients subjected to repeated cycles of therapy. NOTE: There are only 12 BAM files available to download. The other 6 files are missing.

  Dataset EGAD00001000972

• Transposome Bisulfite Sequencing

  DNA belonging to 16 tumour/normal samples were treated with bisulfite, then up to 5 different bisulfite PCRs were performed in each one of the samples. Amplicons form the same sample were pooled and submitted to sequencing on a MiSeq platform.

  Dataset EGAD00001001028

• ICGC PCAWG Dataset: ORCA-IN_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: ORCA-IN.

  Dataset EGAD00001002120

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Exome sequencing of 7-member healthy family (father, mother, their three biological daughters and monozygotic twin sons)

  The dataset contains exome sequencing data of seven healthy family members, all in FASTQ format. The samples were taken from peripheral blood mononuclear cells. Furthermore, corresponding proteomics data are available as well.

  Dataset EGAD00001004949

• Skin Fibroblast Transcriptome of Type 2 Diabetic Patients

  Comparative analysis of transcriptomes of skin fibroblasts in 17 Type 2 Diabetic individuals by RNA sequencing.

  Dataset EGAD00001004980

• EGAS00001003405 combined RNA, WES, WGS data of 16 gastrointestinal tumor patients

  50 samples of 16 individuals with Gastrointestinal Tumor. Patients were sequenced in various combinations of WGS, Exome and RNA sequencing.

  Dataset EGAD00001005113

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Familial adult myoclonic epilepsy type 1 in Sri Lankan and Indian families

  Whole genome sequencing data from four affected and one unaffected individuals from two families with familial adult myoclonic epilepsy, one of Sri Lankan origin and one of Indian origin. BAM files aligned to hg19 reference genome.

  Dataset EGAD00001005777

• Analysis File for 87 Argentinean individuals

  VCF for 87 Argentinean samples. Only SNPs (no indels) that passed the Affymetrix QC. Data from Luisi et al. 2020. Plos One. Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina. Reference Allele column does NOT contain reference allele from genome assembly.

  Dataset EGAD00001006227

• The application of RNA sequencing for the diagnosis and genomic classification of pediatric acute lymphoblastic leukemia

  RNA-seq data for ALL patients as described in "The application of RNA sequencing for the diagnosis and genomic classification of pediatric acute lymphoblastic leukemia"

  Dataset EGAD00001006335

• RNASeq files for Mullighan TXVI dataset

  RNASeq files for paper titled "Prognostic and therapeutic significance of leukemia subtypes and minimal residual disease measurements in pediatric acute lymphoblastic leukemia treated with contemporary risk-directed trial: a cohort study"

  Dataset EGAD00001006609

• 1000IBD.eQTL.study.release.eQTLsummary&GeneTable

  eQTLsummary&GeneTable from eQTL study in 299 intestinal biopsy samples from IBD

  Dataset EGAD00001006789