10639 results for "800k fc coins Navštivte Buyfc26coins.com Speciální balíčky na prázdniny a dovolené..dQVy"

in 29.94 milliseconds.

• MutWP5__CRUK_Mutographs_of_Cancer__Breast__Cancer_Mastectomy__Exome_

  Sequencing of LCM-derived microbiopsies from 30 women who underwent mastectomies due to a breast cancer diagnosis. Goal to assess the mutational burden, spectrum, and clonal dynamics within the tissue. Exome data will be used as a driver and clonality screen, highly clonal or driver-containing samples will subsequently be sent for whole-genome sequencing. Results from this portion of the study will be compared to women who had cosmetic breast reduction surgeries and those with germline BRCA 1/2 mutations.

  Study EGAS00001003319

• Comprehensive single-cell genome analysis at nucleotide resolution using the PTA Analysis Toolbox

  We developed a comprehensive bioinformatic workflow, called the PTA Analysis Toolbox (PTATO), to accurately detect single base substitutions, insertions-deletions (indels) and structural variants in PTA-based WGS data. PTATO includes a machine learning approach and filtering based on recurrency to distinguish PTA-artefacts from true mutations with high sensitivity (up to 90%), outperforming existing bioinformatic approaches. Our results show that PTATO enables studying somatic mutagenesis in the genomes of single cells with unprecedented sensitivity and accuracy.

  Study EGAS00001007288

• Investigation of different library preparation and tissue of origin deconvolution methods for urine and plasma cfDNA methylome analysis

  In this study, a single- and a double-stranded library preparation approach was evaluated with respect to their technical biases when applied on cfDNA from plasma and urine. This study thus outlines potential limitations of double-stranded library preparation for methylation analysis of cfDNA especially for urinary cfDNA. While the double-stranded method allows jagged end analysis in addition to TOO analysis, it leads to significant methylation bias in urinary cfDNA, which single-stranded methods can overcome.

  Study EGAS00001007314

• Fixative optimisation study for BRITROC project

  The British Translational Research Ovarian Cancer Collaborative (BriTROC), spanning more than 10 centres across UK, is a prospective observational project focused on relapsed high-grade serous ovarian cancer (HGSOC). The first study, as a part of the project, is the Fixative optimisation study, which analyses the utility for next-generation sequencing of UMFIX samples compared to NBF-fixed and fresh frozen samples. Various DNA and sequencing quality analyses were performed to compare fixation methods in bulk tumour and biopsy samples.

  Study EGAS00001001433

• Targeted sequencing of brain expressed miRNA genes

  As regulators of gene expression, microRNAs (miRNAs) are likely to play an important role in the development of disease. In this study we present a large-scale strategy to identify miRNAs with a role in the regulation of neuronal processes by screening 289 brain expressed miRNAs. Thereby we found variant rs7861254 located near the MIR204 gene to be significantly associated with schizophrenia. This variant resulted in reduced expression of miR-204 in neuronal-like SH-SY5Y cells.

  Study EGAS00001001607

• Clonal_expansion_of_mutated_cell_population_in_bladder_urothelium_

  1cm biospies of from patients undergoing bladder cystectomy will be collected. The underlying muscle and stroma will be removed and the remaining epithelia dissected into small sequential areas which will be sent for ultra-deep exome sequencing using a panel of known cancer and viral genes. Sequence analysis using similar methods to Martincorena I et al (Science 2015, 348:880) will provide an idea of the somatic mutational landscape in these patient samples. Individual patient muscle samples will also be sequenced as a reference.

  Study EGAS00001001687

• Egypt_Genome_Project___high_coverage_whole_genome_sequencing

  All humans outside Africa are descendants of the same single exit, usually dated at 50-70 thousand years ago. However, the route taken out of Africa is still debated. The two main candidates are a northern route via Egypt and the Levant, or a southern route via Ethiopia and the Arabian Peninsula. We are generating genetic data to evaluate these two possibilities. In this study we propose to generate high-coverage sequencing data for 3 Egyptian samples.

  Study EGAS00001000482

• Targeted_sequencing_of_genes_recurrently_mutated_in_AML___part2

  Genomic libraries will be generated from total genomic DNA derived from 4000 samples with Acute Myeloid Leukaemia. Libraries will be enriched for a selected panel of genes using a bespoke pulldown protocol. 64 Samples will be individually barcoded and subjected to up to one lanes of Illumina HiSeq. Paired reads will be mapped to build 37 of the human reference genome to facilitate the characterisation of known gene mutations in cancer as well as the validation of potentially novel variants identified by prior exome sequencing.

  Study EGAS00001000570

• WES sequencing of malignant peripheral nerve sheath tumours

  Investigate the genomic landscape of MPNST tumours. Cases where a diagnosis of MPNST had been considered in the differential diagnosis with a variable degree of confidence was included. The diagnosis of MPNST was excluded in 12/51 (49 cases had WES data) of the sequenced tumours following review of the pathology, new IHC, molecular tests and clinical information. Article: Lyskjær et al, 2020, J Pathol, "H3K27me3 expression and methylation status in histological variants of malignant peripheral nerve sheath tumours".

  Study EGAS00001004527

• Investigating_the_genetics_of_immunity_against_Salmonella_in_humans

  This study entails whole genome sequencing of an interleukin (IL)-12 b-1 receptor-deficient individual who presented with a chronic systemic Salmonella Enteritidis infection that did not resolve with standard IFNg and antibiotic treatment. Whole genome sequencing of the patient’s parents are also included.This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001001664

• We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas.

  Schwannomas are common peripheral nerve sheath tumors that can cause significant debilitating morbidities. We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas. Exome sequence analysis with validation by targeted DNA-sequencing of 125 samples uncovered, in addition to expected NF2 disruption additional recurrent mutations. RNA sequencing identified a recurrent in-frame SH3PXD2A-HTRA1 fusion in 12/125 (10%) cases, and genomic analysis demonstrated the mechanism as resulting from a balanced 19Mb chromosomal inversion on chromosome 10q.

  Study EGAS00001001886

• Mutational Landscape of Plasmablastic Lymphoma

  Plasmablastic lymphoma (PBL) represents a clinically heterogeneous subtype of aggressive B-cell non-Hodgkin lymphoma. Although targeted sequencing studies and a single center whole exome sequencing (WES) study in HIV+ patients recently revealed several genes, associated with PBL pathogenesis, the global mutational landscape and transcriptional profile of PBL remain elusive. To inform on disease-associated mutational drivers, mutational patterns and perturbed pathways in HIV+ and HIV- PBL we performed WES and RNA-sequencing (RNA-seq) of 34 PBL tumors.

  Study EGAS00001004906

• Blood RNA-seq from Mexican DMD patients and healthy controls

  These data are part of a study that aimed to assess the potential of blood RNA-seq to track non-invasively disease progression for DMD. In particular, here we focus on a study designed to compare gene expression in blood from DMD patients to that of healthy controls. These data are analysed in the following manuscript: Signorelli, M., Ebrahimpoor, M. et al. (accepted). Peripheral blood transcriptome profiling enables monitoring disease progression in dystrophic mice and patients. To appear in EMBO Molecular Medicine.

  Study EGAS00001004907

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Gene expression profiles of matched primary and recurrent fresh frozen tumor tissues from 66 HGSOC patients were obtained by RNA sequencing. RNA libraries were created using the Illumina TruSeq RNA sample preparation kit V2 according to the manufacturer’s instructions and sequenced on a HiSeq2000 (Illumina, California, USA) using a V3 flowcell generating 1 x 50 bp reads. Raw sequencing reads were mapped to the transcriptome and the human reference genome (NCBI37/hg19) using TopHat 2.0 and Bowtie 2.0.

  Study EGAS00001002660

• The WID-CIN test identifies women with, and at risk of, cervical intraepithelial neoplasia grade 3 and invasive cervical cancer (CIN3+)

  We analysed DNA methylation at >850,000 CpG sites across the genome using the Illumina EPIC array in a total of 1,254 cervical liquid-based cytology samples from cases of screen-detected histologically verified CIN1-3+ (98% hrHPV-positive) and population-based control women free from any cervical disease (100% hrHPV-positive). We developed the WID-CIN-test which is a DNA methylation signature consisting of 5,000 CpG sites.

  Study EGAS00001005078

• Sequencing of an adolescent patient with germline RET mutant alveolar rhabdomyosarcoma

  An adolescent patient presented with an alveolar rhabdomyosarcoma made more unique by the presence of a germline RET mutation ordinarily associated with and a known driver of multiple endocrine neoplasia type 2A (MEN2A) cancer. To better understand the role of this germline RET mutation in the genetics and phenotypic response of this unique alveolar rhabdomyosarcoma, we performed DNA and RNA sequencing of the patients in addition to functional studies on patient-derived cultures and genetically similar similar cell models.

  Study EGAS00001004359

• 46 CLL Whole Genome Sequencing Study

  Chronic lymphocytic leukaemia (CLL) consists of two biologically and clinically distinct subtypes defined by the abundance of somatic hypermutation (SHM) affecting the Ig variable heavy-chain locus (IgHV). The molecular mechanisms underlying these subtypes are incompletely understood. Here, we present a comprehensive whole-genome sequencing analysis of somatically acquired genetic events from 46 CLL patients, including a systematic comparison of coding and non-coding single nucleotide variants, copy number variants and structural variants, regions of kataegis and mutation signatures between IgHVmut and IgHVunmut subtypes.

  Study EGAS00001003254

• Identifying the role of ID3 in DNA repair and maintenance of genome integrity

  The inhibitor of DNA-binding 3 (ID3) is a transcriptional repressor protein that limits the binding of basic helix­loop-helix (bHLH) transcription factors to DNA. Preliminary results from our lab confirm that cellular depletion of ID3 is associated with an impaired DNA damage response. we hypothesize that ID3 has the potential to epigenetically affect DNA repair. This is based on our observation that upon cellular ID3 knockdown, a reduction of chromatin-bound H4K16ac and H3K36me3.

  Study EGAS00001004478

• Molecular analysis of FIT interval colorectal cancers

  To optimize a fecal immunochemical test-based screening program, the rate of missed colorectal cancers (CRCs), so-called FIT-interval CRCs, should be minimized. A specific molecular make-up of those CRCs could be an explanation for those interval CRCs. Knowledge of the molecular make-up of these missed lesions could facilitate more accurate detection of all precursor lesions. In this study we aimed to compare the molecular make-up of FIT-interval CRCs and screen-detected CRCs (SD-CRCs).

  Study EGAS00001004683

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• Induced pluripotent stem cell lines (iPSC lines) produced from skin and blood cells.

  The IMBA stem cell bank, iPSC Biobank, is a collection of induced pluripotent stem cell lines (iPSC lines) produced from skin and blood cells. The iPSC Biobank is integrated into the IMBA Stem Cell Core Facility. It stores and provides high-quality reference control panels of iPSC clones as a tool to the research community. The resource is available to all scientists and commercial institutions. The ethical guidelines of the iPSC Biobank are always based on prevailing laws and internal regulations.

  Study EGAS00001006262

• Human pan-cancer plasma cfRNA study - raw data

  This study contains mRNA capture sequencing data from plasma of 266 different human donors. The first, pan-cancer, cohort covers 25 high-grade to metastatic cancer types (8 cancer patients per type) and a control group (8 healthy donors). The validation cohort comprises additional plasma samples from ovarian, prostate and uterine cancer patients (12 per type) as well as additional samples from controls (22 new and 8 repeated). Samples were sequenced on a NovaSeq 6000 and are provided in FASTQ format.

  Study EGAS00001006755

• Whole exome sequencing identifies clinically relevant mutational signatures in resected hepatocellular carcinoma

  We conducted a multicentre pilot study on patients with localized HCC following complete radiological response to surgical resection. Patients received 250 mg oral gefitinib once daily as adjuvant therapy, up to a maximum of 6 months. The clinical endpoints included recurrence-free survival (RFS) and overall survival (OS), and correlative genetic analyses were conducted from whole exome sequencing data (n=33). All statistical analyses were carried out on an intention-to-treat basis. The study is registered with ClinicalTrials.gov (NCT00282100).

  Study EGAS00001004371

• Molecular analysis of cancer genomes in children with Lynch syndrome: exploring causal associations

  Lynch syndrome (LS) predisposes to cancer in adulthood and is caused by heterozygous germline variants in a mismatch repair (MMR) gene. Recent studies show an increased prevalence of LS among children with cancer, suggesting a causal relationship. For LS-spectrum (LSS) cancers, including high-grade gliomas and colorectal cancer, causality has been supported by typical MMR-related tumor characteristics, but for non-LSS cancers, causality is unclear. This dataset contains 5 patients with Lynch Syndrome from the INFORM registry.

  Study EGAS00001007146

• Blood neutrophils in COPD derive from activated progenitors in the bone marrow

  Chronic obstructive pulmonary disease (COPD) is a major respiratory disease characterized by small airway inflammation, emphysema and severe breathing difficulties. Low-grade systemic inflammation is an established hallmark of severe disease, however, the molecular changes in peripheral immune cells remain far from understood. We combined multi-color flow cytometry with single-cell RNA sequencing and showed that blood neutrophil numbers are significantly increased in COPD and they are a heterogeneous population. A transcriptomic state that expressed interferon response genes correlated with alveolar damage and acute exacerbations. Furthermore, bronchoalveolar neutrophils expressed gene signatures corresponding to certain blood neutrophil states. Last, our data in a murine model of cigarette smoke exposure demonstrated that bone marrow neutrophil progenitors are expanded in smoke-treated animals and display signs of immune activation. Our study provides evidence that COPD systemic inflammation may derive from an activated haematopoietic precursor compartment.

  Dataset EGAD00001008788

• Targeted DNA panel sequencing analysis of PanNEN tumors of varying grades using custom and commercial panels

  Targeted panel sequencing data from PanNEN samples. Sample ID is annotated in the following manner: each patient is given a number and "P" is appended to the patient number if it is a primary tumor, "M” if it is metastasis and "N" if it is normal (healthy tissue) sample. All NETG1 and NETG2 samples underwent panel sequencing using a custom panel (in-house PanNEN panel). All NEC and NETG3 samples (except PNET2, PNET77P and PNET77M) underwent panel sequencing using a commercial CCP panel.

  Dataset EGAD00001008432

• Blood neutrophils in COPD derive from activated progenitors in the bone marrow sc Seqwell

  Chronic obstructive pulmonary disease (COPD) is a major respiratory disease characterized by small airway inflammation, emphysema and severe breathing difficulties. Low-grade systemic inflammation is an established hallmark of severe disease, however, the molecular changes in peripheral immune cells remain far from understood. We combined multi-color flow cytometry with single-cell RNA sequencing and showed that blood neutrophil numbers are significantly increased in COPD and they are a heterogeneous population. A transcriptomic state that expressed interferon response genes correlated with alveolar damage and acute exacerbations. Furthermore, bronchoalveolar neutrophils expressed gene signatures corresponding to certain blood neutrophil states. Last, our data in a murine model of cigarette smoke exposure demonstrated that bone marrow neutrophil progenitors are expanded in smoke-treated animals and display signs of immune activation. Our study provides evidence that COPD systemic inflammation may derive from an activated haematopoietic precursor compartment.

  Dataset EGAD00001008908

• Blood neutrophils in COPD derive from activated progenitors in the bone marrow sc Rhapsody

  Chronic obstructive pulmonary disease (COPD) is a major respiratory disease characterized by small airway inflammation, emphysema and severe breathing difficulties. Low-grade systemic inflammation is an established hallmark of severe disease, however, the molecular changes in peripheral immune cells remain far from understood. We combined multi-color flow cytometry with single-cell RNA sequencing and showed that blood neutrophil numbers are significantly increased in COPD and they are a heterogeneous population. A transcriptomic state that expressed interferon response genes correlated with alveolar damage and acute exacerbations. Furthermore, bronchoalveolar neutrophils expressed gene signatures corresponding to certain blood neutrophil states. Last, our data in a murine model of cigarette smoke exposure demonstrated that bone marrow neutrophil progenitors are expanded in smoke-treated animals and display signs of immune activation. Our study provides evidence that COPD systemic inflammation may derive from an activated haematopoietic precursor compartment.

  Dataset EGAD00001009704

• Metabolic reprogramming towards OXPHOS identifies a novel therapeutic target for mantle cell lymphoma

  Metabolic reprogramming is linked to cancer cell growth and proliferation, metastasis, and therapeutic resistance in a multitude of cancers. Targeting dysregulated metabolic pathways to overcome resistance, an urgent clinical need in all relapsed/refractory cancers, remains difficult. Through genomics analysis of clinical specimens, we show that metabolic reprogramming towards oxidative phosphorylation (OXPHOS) and glutaminolysis is associated with therapeutic resistance to the Bruton’s tyrosine kinase inhibitor ibrutinib in mantle cell lymphoma (MCL), an incurable B-cell lymphoma with poor clinical outcomes. Inhibition of OXPHOS with a novel, clinically applicable small molecule, IACS-010759, which targets complex I of the mitochondrial electron transport chain, results in significant growth inhibition in vitro and in vivo in ibrutinib-resistant patient-derived cancer models. This work suggests that targeting metabolic pathways to subvert therapeutic resistance is a clinically viable approach to treat highly refractory malignancies.

  Dataset EGAD00001004577

• The landscape of somatic mutation in normal colorectal epithelial cells

  The colorectal adenoma-carcinoma sequence has provided a paradigmatic framework for understanding the successive somatic genetic events and consequent clonal expansions leading to cancer. As for most cancer types, however, understanding of the earliest phases of colorectal neoplastic change, which may occur in morphologically normal tissue, is comparatively limited because of the difficulty of detecting somatic mutations in normal cells. Each colorectal crypt is a small clone of cells derived from a single recently-existing stem cell. Here, we sequenced hundreds of normal crypts from 42 individuals. Signatures of multiple mutational processes were revealed, some ubiquitous and continuous, others only found in some individuals, in some crypts or during some phases of the cell lineage from zygote to adult cell. Likely driver mutations were present in ~1% of normal colorectal crypts in middle-aged individuals, indicating that adenomas and carcinomas are rare outcomes of a pervasive process of neoplastic change across morphologically normal colorectal epithelium.

  Dataset EGAD00001004193

• Chromosome Segregation Errors Promote a Diverse Spectrum of Simple and Complex Genomic Rearrangements

  Cancer genomes are frequently characterized by numerical and structural karyotypic abnormalities. Here we combined an inducible centromere-specific inactivation approach with selection for a conditionally essential gene, a strategy we term ‘CEN-SELECT’, and show that single-chromosome missegregation during cell division can directly drive a broad spectrum of structural rearrangement types. Cytogenetic profiling revealed that missegregated chromosomes are 120-fold more susceptible to developing seven major categories of structural variants, including translocations, insertions, deletions, and reassembly into chromothriptically rearranged chromosomes. Whole-genome sequencing of clones with genetically propagatable derivative chromosomes identified complex rearrangements and copy-number alterations that can result in gene inactivation or extrachromosomal gene amplification. We conclude that chromosome segregation errors are sufficient to drive extensive structural variation that recapitulates those commonly associated with human cancers.

  Dataset EGAD00001004163

• Next Generation Sequencing in an IBD Pedigree Whole Genome Data

  In 2009 we identified a four-generation family with over 700 members and 41 affected with Crohn's disease (CD). At the time we sequenced the exome of 6 affected individuals but did not identify any coding variants which appear to explain the high prevalence of disease. Since then we have collected DNA from a large number of additional family members, genotyped linkage arrays on the entire family to refine genomic regions shared by identity by descent and genotyped affected and unaffected members at known CD risk loci identified by Genome Wide Association Studies (GWAS). These analyses have confirmed that a significant unexplained excess of disease remains after accounting for all known genetic factors, and that several regions of the genome are shared by a large fraction of affected individuals. We therefore perform whole genomes sequencing from 8 individuals which will allow us to impute the complete sequence of nearly all the members of the two largest and most severely affected branches of the family.

  Dataset EGAD00001000399

• Genomic Landscape of Human Skin at a Single-Cell Resolution

  Every cell in the human body has a unique set of somatic mutations, yet it remains difficult to comprehensively genotype an individual cell. Here, we developed solutions to overcome this obstacle in the context of normal human skin, thus offering the first glimpse into the genomic landscapes of melanocytes at single-cell resolution. We comprehensively genotyped 133 melanocytes from 19 sites across 6 donors. As expected, sun-shielded melanocytes had fewer mutations than sun-exposed melanocytes. However, within sun-exposed sites, melanocytes on chronically sun-exposed skin (e.g. the face) displayed a lower mutation burden than melanocytes on intermittently sun-exposed skin (e.g. the back). Melanocytes from donors with a history of skin cancer had higher mutation burdens than melanocytes from donors without skin cancer, implying that the mutation burden of normal skin can be harnessed to measure cumulative sun damage and skin cancer risk. Moreover, melanocytes from healthy skin commonly harbor pathogenic mutations, likely explaining the origins of the melanomas that arise in the absence of a pre-existing nevus. Phylogenetic analyses identified groups of related melanocytes, suggesting that melanocytes spread throughout skin as fields of clonally related cells, invisible to the naked eye. Overall, our study offers an unprecedented view into the genomic landscapes of individual melanocytes, revealing key insights into the causes and origins of melanoma.

  Study phs001979

• Personalized peptide vaccination among 173 patients with IDH wildtype glioblastoma: a retrospective analysis

  Tumors from 173 GBM patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Exome libraries for 173 glioblastoma tumors and matched normal DNA were sequenced on Illumina platform, alongside whole transcriptomes from the tumor samples. Paper Abstract: Current treatment outcome of patients with glioblastoma (GBM) remains poor. Following standard therapy, recurrence is universal with limited survival. GBM tumors from 173 patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Among all patients, including 70 treated prior to progression (primary) and 103 treated after progression (recurrent), the median overall survival from first diagnosis was 31.9 months (95% CI: 25.0-36.5). Side effects were infrequent and were predominantly grade 1 or 2. A vaccine-induced immune response to at least one of the vaccinated peptides was detected in blood samples of 87 of 99 (88%) monitored patients. T-cell responses to vaccinated neoepitope peptides were durable in most patients. Significantly prolonged survival was observed for patients with multiple vaccine-induced immune responses (53 months) compared to those with no/low induced responses (27 months; P=0.03). Altogether, our results highlight that the application of personalized neoantigen-targeting peptide vaccine is feasible and represents a promising potential treatment option for GBM patients.

  Study EGAS50000000449

• Mid-pass Whole-genome Sequencing in a Malagasy Cohort Uncovers Body Composition Associations

  The majority of human genomic research studies have been conducted in European-ancestry cohorts, reducing the likelihood of detecting potentially novel and globally impactful findings. Here, we present mid-pass whole-genome sequencing data and a genome-wide association study in a cohort of 264 self-reported Malagasy individuals from three locations on the island of Madagascar. We describe genetic variation in this Malagasy cohort, providing insight into the shared and unique patterns of genetic variation across the island. We observe phenotypic variation by location, and find high rates of hypertension particularly in the Southern Highlands sampling site as well as elevated self-reported malaria prevalence in the West Coast site relative to other sites. After filtering to a subset of 214 minimally-related individuals, we find a number of genetic associations with body composition traits, including many variants that are only observed in African populations or populations with admixed African ancestry from the 1000 Genomes Project. This study highlights the importance of including diverse populations in genomic research for the potential to gain novel insights, even with small cohort sizes. This project was conducted in partnership and consultation with local stakeholders in Madagascar and serves as an example of genomic research that prioritizes community engagement and that has potential impacts on our understanding of human health and disease.

  Study EGAS50000000496

• A comprehensive DNA methylation landscape of human and mouse cell lines derived from hematological malignancies

  Human cancer cell lines constitute useful models to study the primary disease and many relevant findings in tumor biology have been originated from them since the first immortalized cell line (HeLa) was obtained. The easy experimental intervention, the purity of the transformed cells and their versatility to undergo high-throughput screenings represent advantageous features of the established cancer cell lines. In recent years, major efforts have characterized in detail the multiomics make-up of hundreds of cancer cell lines and studied their association with sensitivity to anticancer drugs. Most of these studies have been genetic-centric and have not characterized in detail the epigenetic profiles underlying the characteristics of these cells or their impact on the efficacy of antitumoral compounds. In this regard, a past version of a DNA methylation microarray or a less accessible and more time-consuming such as reduced representation bisulfite sequencing have been used in those attempts to interrogate the epigenetic setting. Herein, we have obtained the DNA methylation profiles of 210 cell lines derived from hematological malignancies utilizing comprehensive DNA methylation microarrays that interrogates more than 850,000 and 285,000 CpG sites from human and mouse genomes, respectively. Importantly, we also provide a pharmacoepigenetic example of the potential use of this resource by showing how DNA methylation can predict response to nucleoside analogues.

  Study EGAS50000000627

• DUX4 activates novel intergenic transcripts and isoforms in a tissue-specific context

  DUX4, a transcription factor driving zygotic genome activation during the embryonic cleavage stage in mammals, regulates the expression of genic and non-genic elements and modulates chromatin accessibility. Its misexpression in skeletal muscle causes Facioscapulohumeral muscular dystrophy (FSHD). The sporadic expression of DUX4 in FSHD muscle and the limitations of short-read RNA sequencing challenge, however, a comprehensive grasp of its consequences on the muscle transcriptome. Here, leveraging full-length isoform RNA sequencing with short-read RNA sequencing on DUX4-inducible myoblasts, we elucidated DUX4-induced transcriptomic changes within a myogenic context. DUX4 yields a complex transcriptome featuring numerous unannotated isoforms from known and novel loci. Moreover, we observed distinct isoform usage of DUX4 target genes between myogenic and embryonic cleavage states highlighting the distinct differences between DUX4 transcription factor activity in skeletal muscle and during the cleavage stage. We also identified ~1,400 unannotated intergenic isoforms predominantly originating from repetitive elements such as LTRs, LINEs, and SINEs. Integration with available datasets delineates the transcriptional and epigenetic landscape of these loci across myogenic and embryonic backgrounds. Like the cell type-specific isoform production, the usage of DUX4 binding sites at these intergenic loci is in part cell type-specific. Collectively, these findings demonstrate substantial and context-specific transcriptomic alterations induced by DUX4 further enriching our understanding of DUX4-induced muscle pathology.

  Study EGAS50000000503

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  KIR+NKG2A- Natural Killer (NK) cells have the unique ability to detect downregulation of single HLA-I allotypes, frequently occurring in malignantly-transformed and virus-infected cells in order to escape T cell recognition. We have recently shown that circulating Innate Lymphoid Cells 1 (cILC1) have the potential to generate such KIR+NKG2A- NK cells but their developmental origin was unknown. Here we demonstrate that the development of cILC1 is thymus-dependent and identify a putative progenitor of cILC1s in the thymus, called thyILC1. Single-cell RNAseq analysis revealed a close relationship of thyILC1s to CD34+ double-negative (DN) thymocytes, but in contrast to DNs, thyILC1s had lost T cell differentiation potential. However, like cILC1s they could be efficiently differentiated into KIR+NKG2A- NK cells. thyILC1s strongly expressed RAG1/2, PTCRA (preTCR, and NOTCH1/3, but lacked expression of TCR chains, suggesting that they failed to pass the -selection checkpoint of thymocyte development. Finally, analyses of patients with FOXN1het deficiency, showing thymic hypoplasia due to lack of mature thymic epithelial cells, exhibited a profound deficiency of cILC1s but not cILC2s and cILC3s, demonstrating thymus dependency of cILC1s. Together, the data suggest that thyILC1s are the source of a novel thymus-dependent NK cell differentiation pathway that promotes generation of KIR+NKG2A- NK cells.

  Study EGAS50000000760

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells - sc

  KIR+NKG2A- Natural Killer (NK) cells have the unique ability to detect downregulation of single HLA-I allotypes, frequently occurring in malignantly-transformed and virus-infected cells in order to escape T cell recognition. We have recently shown that circulating Innate Lymphoid Cells 1 (cILC1) have the potential to generate such KIR+NKG2A- NK cells but their developmental origin was unknown. Here we demonstrate that the development of cILC1 is thymus-dependent and identify a putative progenitor of cILC1s in the thymus, called thyILC1. Single-cell RNAseq analysis revealed a close relationship of thyILC1s to CD34+ double-negative (DN) thymocytes, but in contrast to DNs, thyILC1s had lost T cell differentiation potential. However, like cILC1s they could be efficiently differentiated into KIR+NKG2A- NK cells. thyILC1s strongly expressed RAG1/2, PTCRA (preTCR, and NOTCH1/3, but lacked expression of TCR chains, suggesting that they failed to pass the -selection checkpoint of thymocyte development. Finally, analyses of patients with FOXN1het deficiency, showing thymic hypoplasia due to lack of mature thymic epithelial cells, exhibited a profound deficiency of cILC1s but not cILC2s and cILC3s, demonstrating thymus dependency of cILC1s. Together, the data suggest that thyILC1s are the source of a novel thymus-dependent NK cell differentiation pathway that promotes generation of KIR+NKG2A- NK cells.

  Study EGAS50000000790

• What is metadata?

  What is metadata? Data represents units of information and metadata can be seen, simply put, as data about other data. For example, in a simple experiment in which a patient genome was sequenced, there are multiple and diverse fields of metadata: from the biological sex of the patient to the sequencing platform used. Another way to understand metadata, following our genomic experiment example, is going through the different layers of (meta)data: One of the basic units of information (data) would be the sequence of nucleotides (e.g. GCTGG and GCCGG). This DNA sequence can be contextualised within a chromosome by providing its locus (e.g. β-globin gene). This data, the locus, is about other data, the sequence of nucleotides, which would render it metadata. We can go one step further, and provide more context, by giving the associated phenotype of each of these sequences: GCTGG corresponds to a healthy individual, while GCCGG corresponds to a person with β-thalassaemia. Once again, this data is contextualising the data we have provided up to this point, which makes it metadata. With this simple example, what we are doing is adding layers of data that describe the ones below. Had we given the sequences alone, little would be possible from the researchers' point of view. But, now that the data has its accompanying metadata, a researcher could compare both sequences and their phenotypes to infer a possible cause of the disorder. Each layer of information broadens the possible applications of the data. Now that we know what metadata is, it is time to emphasise the importance of submitting good quality metadata. The quality of the metadata will determine whether the data is usable, discoverable, and interpretable by researchers and clinicians. One example that highlights the importance of good quality metadata is the description of biological sex of a patient: while the terms "female," "girl," or "woman" all represent the same concept, they are not harmonised. These different representations of a concept can create confusion and errors in data analysis. By applying standard definitions and terminologies to biological sex metadata, we can avoid misunderstandings and facilitate the integration of different datasets.  In order to comply with the FAIR principles and, more specifically, to allow for the (meta)data to be interoperable (i.e. used universally and unambiguously), we need to place some standards onto the (meta)data EGA  archives. These can be as simple as asserting that the given patient's biological sex is one of the correct terms (e.g. female or male); or as complex as multiple layers and combinations of validation steps with existing records. You can find further details on how EGA manages these standards on our metadata model page.

  Documentation submission/metadata/what-is-metadata

• A Cancer Cell-Line Titration Series for Evaluating Somatic Classification

  Accurate detection of somatic single nucleotide variants and small insertions and deletions from DNA sequencing experiments of tumour-normal pairs is a challenging task. Tumour samples are often contaminated with normal cells confounding the available evidence for the somatic variants. Furthermore, tumours are heterogeneous so sub-clonal variants are observed at reduced allele frequencies. We present here a cell-line titration series dataset that can be used to evaluate somatic variant calling pipelines with the goal of reliably calling true somatic mutations at low allele frequencies. Cell-line DNA was mixed with matched normal DNA at 8 different ratios to generate samples with known tumour cellularities, and exome sequenced on Illumina HiSeq to depths of >300x. The data was processed with several different variant calling pipelines and verification experiments were performed to assay >1,500 somatic variant candidates using Ion Torrent PGM as an orthogonal technology. By examining the variants called at varying cellularities and depths of coverage, we show that the best performing pipelines are able to maintain a high level of precision at any cellularity. In addition, we estimate the number of true somatic variants undetected as cellularity and coverage decrease. Our cell-line titration series dataset, along with the associated verification results, is effective for this evaluation and will serve as a valuable dataset for future somatic calling algorithm development.

  Study EGAS00001001016

• Double mutant DNMT3A AML: a unique subtype

  Mutation of DNMT3A, encoding a de novo methyltransferase essential for cytosine methylation, is a common early event in clonal hematopoiesis (CH) and adult acute myeloid leukemia (AML). Spontaneous deamination of methylated cytosines damages DNA, which is repaired by the base excision repair (BER) enzymes MBD4 and TDG. Congenital MBD4-deficiency has been linked to early-onset CH and AML, and is marked by exceedingly high levels of DNA damage and mutation of DNMT3A. Strikingly, wildtype (WT) DNMT3A binds TDG, thereby potentiating its repair activity. Since TDG is the only remaining BER enzyme in MBD4-deficient AML patients capable of repairing methylation damage, we investigated whether mutant DNMT3A negatively affects the repair function of TDG. We found that, whereas WT DNMT3A stimulates TDG function, mutant DNMT3A impairs TDG-mediated repair of DNA damage in vitro. In light of this finding and to extrapolate our observations to the broader AML patient population, we investigate here the genetic profiles and survival outcomes of AML patients with single (SM) versus double mutant (DM) DNMT3A. DM DNMT3A AML patients show a characteristic driver mutation landscape and reduced overall survival when compared to SM DNMT3A AML patients. Importantly, whole-genome sequencing showed a trend for increased DNA damage in primary DM DNMT3A AML samples, especially when DNMT3A mutations are located at the DNMT3A-TDG interaction interface.

  Study EGAS00001007966

• GoT2D: Genetics of Type 2 Diabetes, a study of the the genetic architecture of type 2 diabetes using low pass whole genome sequencing and high density SNP genotyping in 2,657 individuals.

  The Genetics of Type 2 Diabetes Consortium (GoT2D) is a collaboration between the University of Michigan, the Broad Institute and the Wellcome Trust Centre for Human Genetics. The overall aim is to extend upon recent efforts, such as genome-wide association studies (GWAS) and large scale meta-analyses. While they have proved successful at mapping genomic loci that influence human diseases, like type 2 diabetes, much of the heritability remains unexplained. In this study, we use next generation sequencing and genotyping technologies to query for lower frequency variants in the human genome. Thereby, allowing a deeper characterization of the spectrum of alleles associated with type 2 diabetes risk, and a better assessment of the genes that play a role in the etiology of type 2 diabetes development. We studied 1,326 T2D cases and 1,331 normoglycemic controls from Northern and Central Europe (Sweden, Finland, UK, and Germany). To efficiently characterize the entire genome sequence of each individual, we performed low-coverage (~5x) whole-genome sequencing, augmented by deep coverage (~100x) sequencing of the exome, and dense (2.5M) single nucleotide polymorphism (SNP) genotyping using the HumanOmni2.5 array. The data deposited in EGA will include all the Swedish, Finnish, UK, and German samples.

  Study EGAS00001001459

• Glioblastoma epigenome profiling identifies SOX10 as a master regulator of molecular tumour subtype

  Glioblastoma in adult patients are classified into four subtypes, IDH, MES, RTK I, and RTK II, based on DNA methylation and RNA expression data. Tumour subtype transitions commonly occur during the treatment of glioblastoma patients, and transitions to the mesenchymal (MES) subtype have been associated with therapy resistance and adverse prognosis. Here, we generate DNA methylome and histone modification data of glioblastoma primary tumours and show that glioblastoma subtypes differ by their enhancer landscapes. Using Core Regulatory Circuitry analysis of H3K27ac data, and independent analysis of RNA-derived gene regulatory networks, we identified 38 subtype master regulators whose cell type-specific activities we mapped in single-cell RNA sequencing data. These analyses identified the chromatin modifier SRY-Box 10 (SOX10) as a master regulator in tumours of the RTK I subtype. In functional studies we demonstrate that SOX10 loss causes a transition of RTK I tumour cells to a mesenchymal cellular state by altering the accessibility of enhancer-rich chromatin regions and their occupancy by Bromodomain Containing 4 (BRD4), a dynamic constituent of super-enhancers. Treatment with the BRD4 inhibitor JQ1 blocked this transition. These data demonstrate the fundamental role of enhancer chromatin remodelling and master regulator activity in the establishment, maintenance and plasticity of glioblastoma cellular states. We also make our data publically browsable at https://dkfz-b060.github.io/gb_browse/

  Study EGAS00001003953

• A Platform Study of Combination Immunotherapy for the Neoadjuvant and Adjuvant Treatment of Patients with Surgically Resectable Adenocarcinoma of the Pancreas

  This is a single-institutional, randomized, open label platform clinical trial testing various immunotherapy combinations. Patients with newly diagnosed and surgically resectable pancreatic ductal adenocarcinoma (PDA) and scheduled to undergo the Whipple procedure at Johns Hopkins Hospital were eligible to participate in this study. Criteria for determining resectability strictly followed National Comprehensive Cancer Network (NCCN) guidelines. The study consisted of 6 parts: parts 1-5 constituted the Prime Phase (see below), and part 6 was the Extended Treatment Phase. Part 1: Participants received one cycle of immunotherapy two weeks prior to undergoing the Whipple procedure. Part 2: Subjects underwent the Whipple procedure. Part 3: Subjects received a second cycle of immunotherapy 4-10 weeks following the Whipple procedure (2-4 weeks prior to adjuvant chemoradiation). Part 4: Subjects underwent chemoradiation. Part 5: Subjects received 4 additional 28-day cycles of immunotherapy beginning 1-2 months after completing chemoradiation for a total of six cycles (two before chemoradiation and 4 following chemoradiation). Eligible subjects were randomized to Arms A and B in a 1:1 ratio, stratified up-front by age (≤65, >65). Arm A participants received Cy/GVAX. Arm B participants received the combination of Cy/GVAX and nivolumab. GVAX Vaccine consists of equal numbers (2.5 x 108 each) of Panc 6.03 pcDNA1GM-CSF and Panc 10.05 pcDNA1GM-CSF combined into a single vaccination. Each vaccination consisted of six total intradermal injections. A single intravenous (IV) dose of 200 mg/m2 Cy (CytoxanR) was given one day prior to GVAX. Anti-PD-1 Therapeutic Antibody Nivolumab 480 mg every 4 weeks was administered as an intravenous infusion. The primary objective for Arms A and B was to compare IL17 expression (Th17) in vaccine-induced lymphoid aggregates between resected PDAs from patients treated with the combination of Cy/GVAX and anti-PD-1 blockade antibody vs. the treatment of Cy/GVAX alone. Secondary objectives were to assess the safety, overall survival (OS), and disease free survival (DFS) of patients treated with each of the study drug combinations, and to assess the effects of each of the immunotherapy study drug combinations on PD-L1/PD-1 associated pathways, vaccine-induced immune regulatory signatures, and peripheral and intratumoral antigen specific T cell responses. The exploratory objective was to explore the effects of therapy on tumor and peripheral blood and tumor infiltrating immune cells, and to explore potential molecular determinants of response, progression and disease stability. To these ends, tumor infiltrating immune cells (TIICs) were obtained from surgically resected tumors following the neoadjuvant treatment of the study immunotherapy. TIICs were sorted into CD3+CD4+ T cells, CD3+CD8+ T cells, CD3-CD19+ B cells, and CD3-CD19-CD11b+ myeloid cells by flow cytometry. The sorted immune cell subtype pellets were sent to the commercial vendor (Eurofins) for RNA extraction and sequencing. SMART-seq v4 Ultra Low Input mRNA Sample Prep Kit was used for library preparation with 100bp paired end reads. FASTQ files, that were returned from the vendor, are deposited here.

  Study phs003002

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• WGS and RNA-Seq data from a GBM patient PT-PV2594

  WGS and RNA-Seq data from a GBM patient PT-PV2594

  Dataset EGAD00001008526

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• HV31 - De novo assembly of eight immune system regions

  De novo assembly of eight immune system regions for individual HV31, generated using a multi-platform pipeline. A full description of the generation of these assemblies can be found at https://doi.org/10.1101/2021.02.03.429586.

  Dataset EGAD00001007050

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• RNA-seq data for study 'Smoking-dependent expression alterations in nasal epithelium reveal immune impairment linked to germline variation and lung cancer risk.'

  RNA-seq data from nasal and bronchial tissues in 649 subjects, many with lung cancer. Lung cancer is the leading cause of cancer-related death in the world. In contrast to many other cancers, a direct connection to lifestyle risk in the form of cigarette smoke has long been established. More than 50% of all smoking-related lung cancers occur in former smokers, often many years after smoking cessation. Despite extensive research, the molecular processes for persistent lung cancer risk are unclear. CT screening of current and former smokers has been shown to reduce lung cancer mortality by up to 26%. To examine whether clinical risk stratification can be improved upon by the addition of genetic data, and to explore the mechanisms of the persisting risk in former smokers, we have analyzed transcriptomic data from accessible airway tissues of 487 subjects. We developed a model to assess smoking associated gene expression changes and their reversibility after smoking is stopped, in both healthy subjects and clinic patients. We find persistent smoking associated immune alterations to be a hallmark of the clinic patients. Integrating previous GWAS data using a transcriptional network approach, we demonstrate that the same immune and interferon related pathways are strongly enriched for genes linked to known genetic risk factors, demonstrating a causal relationship between immune alteration and lung cancer risk. Finally, we used accessible airway transcriptomic data to derive a non-invasive lung cancer risk classifier. Our results provide initial evidence for germline-mediated personalised smoke injury response and risk in the general population, with potential implications for managing long-term lung cancer incidence and mortality.

  Dataset EGAD50000000333

• UK Biobank whole cohort directly genotyped and imputed data (~500,000 participants)

  Genotype data is available for all 500,000 participants in the UK Biobank cohort. Genotyping has been performed using the Affymetrix UK BiLEVE Axiom array on an initial 50,000 participants and the remaining 450,000 participants have been genotyped using the Affymetrix UK Biobank Axiom® array. The two arrays are extremely similar (with over 95% common content).Quality control and imputation (to over 90 million SNPs, indels and large structural variants) has been performed by a collaborative group headed by the Wellcome Trust Centre for Human Genetics.The following data are available:* A clean set of QC’ed genotype calls* Confidence values that a genotype call is correct* Intensity data to generate cluster plots* Extensive QC information regarding SNPs and samples including SNP metrics, batch effects, population structure and relatedness* Imputed dataFor further information, please refer to the UK Biobank website

  Study EGAS00001002399

• Whole Genome Association Study of Bipolar Disorder

  The goal of the project is to identify genes that make individuals more susceptible to bipolar disorder (manic depressive illness) and to better understand the brain pathways involved in the disease. Dataset versioning Version 1: European-American (EA) ancestry only Version 2: Version 1 plus African-American (AA) ancestry Version 3: EA and AA samples plus updated diagnostic criteria Consent groups and participant set General research use (GRU): 1767 controls (1081 EA controls, 686 AA controls) This consent group includes all controls for the Bipolar study, which are a subset of controls for the Schizophrenia study (subset of Schizophrenia: GRU). Bipolar and related disorders (BARD): 841 cases (691 EA cases, 150 AA cases) This consent group includes a subset of the Bipolar cases. Bipolar disorder only (BDO): 653 cases (388 EA cases, 265 AA cases) This consent group includes a subset of the Bipolar cases.

  Study phs000017

• Center for Common Disease Genomics [CCDG] - Cardiovascular ATVB: Atherosclerosis Thrombosis and Vascular Biology

  Italian Atherosclerosis Thrombosis and Vascular Biology study is a prospective, nationwide, case-control study involving 125 coronary care units in Italy. The cases were patients who were hospitalised for a first MI before the age of 45 years and underwent coronary angiography. Acute MI was defined as resting chest pain lasting more than 30 minutes, accompanied by persistent electrocardiographic changes, and confirmed by an increase in total creatine kinase or in the MB fraction to more than twice the upper normal limits. The controls were healthy subjects without a history of thromboembolic disease who were unrelated to the patients, but individually matched with them by age, gender and geographical origin. They were enrolled from among the blood donors or staff of the same participating hospitals. Recruitment of cases and controls took place between 1994 and 2007. This site hosts data from ~60 whole exomes.

  Study phs001592

• HuBMAP: KULMAP - Human Kidney, Urinary Tract, and Lung Mapping Center

  The major goal of the Human Kidney, Urinary Tract, and Lung Mapping Center (KULMAP) is to generate multi-omic and spatially resolved molecular anatomical maps of the human bladder, ureter and kidneys (BUKMAP) and the lung airways and parenchyma (LAPMAP) at a single cell resolution. This entails sequencing of the transcriptomes and epigenomes of dissociated single cells in a massively parallel manner. These profiles will then inform on highly multiplexed RNA in situ imaging for spatial mapping of hundreds of molecular targets in the tissue sections, at a subcellular resolution. These spatial molecular maps will serve as scaffolds for computational registration of cell types and the associated transcriptome/chromatin maps to the tissue space. The combination of sequencing single dissociated cells and multiplexed in situ mapping will allow the construction of detailed spatial maps for these large organs.

  Study phs002249

• Rapid Acceleration of Diagnostics - Digital Health Technologies (RADx-DHT): NIH Digital Health Solutions for COVID-19: IBM Covid19 Contact Tracing and Data Exchange Tools

  The goal of this project is to develop both contact tracing and secure data exchange tools. The contact tracing solution securely combines data from a variety of sources (including manual self-report data and mobile device surveys) to enable tracing of contacts with individuals that have tested positive for COVID-19 or have been exposed to COVID-19. The data exchange solution is a secure mechanism that empowers users to control the data they share in the course of their return to work, including the ability to provide a verifiable health status claim. These tools are being used by an employer to evaluate the risk of allowing individuals to return to normal activities, and also the ability to trace user contact with individuals diagnosed with or suspected of having contracted COVID-19. DOI: https://rapids.ll.mit.edu/10.57895/h0an-m559

  Study phs002516

• Breast Cancer Susceptibility

  Genetic factors account for a large fraction of breast cancer risk and it is estimated that up to 30% of breast cancers have a heritable component. Inherited cancer susceptibility is associated with early-onset of malignancies in general. Although 20% of young women with breast cancer have germline mutations in the best understood breast cancer susceptibility genes, BRCA1, BRCA2 and TP53, in the remaining 80% of women with early-onset breast cancer, the genetic factors contributing to disease remain unexplained. By studying the extreme phenotype of women diagnosed at an early age there is enrichment for genetic factors that contribute to breast cancer. This study contains the whole exome sequence of 384 women diagnosed with invasive breast cancer prior to 40 years of age. Each of the subjects reported a family history of breast cancer and lacked mutations in BRCA1 and BRCA2.

  Study phs001017

• Deciphering Maternal-Fetal Crosstalk in the Human Placenta During Parturition Using Single-Cell RNA-Sequencing

  Labor is a complex physiological process requiring a well-orchestrated dialogue between the mother and fetus. However, the cellular contributions and communications that facilitate maternal-fetal crosstalk in labor have not been fully elucidated. In this latest version (#5), scRNA-seq was applied to decipher maternal-fetal signaling in the human placenta and chorioamniotic membranes during term labor. Samples were obtained from women who underwent spontaneous labor (n = 24) or who were delivered in the absence of spontaneous labor (n = 18) at term. Samples from previous versions (#1-3) of this study include the placental villous tree, basal plate, and chorioamniotic membranes of women across a range of pregnancy physiologic and pathologic conditions, including the processes of labor (term labor and preterm labor), and COVID-19 (version #3). Version #4 includes samples from the human myometrium during spontaneous term labor.

  Study phs001886

• Study of Adaptation to Hypoxia in Ethiopian Highlanders via Whole Genome Sequencing

  Although it has long been proposed that genetic factors contribute to adaptation to high altitude, such factors remain largely unverified. Recent advances in high-throughput sequencing have made it feasible to analyze genome-wide patterns of genetic variation in human populations. Since traditionally such studies surveyed only a small fraction of the genome (either exons or a subset of SNPs) or a group of candidate genes, interpretation of the results was limited. We focused our study on Ethiopian highlander populations, which have been found to be well adapted to high altitudes (~3500m). We sequenced and analyze the genomes of 13 high altitude native Ethiopians: 6 individuals of Oromo heritage living on Bale Plateau (labeled "Oromos"), and 7 individuals residing on the Chennek field in the Simien Mountains (labeled "Amhara"). Our study revealed evolutionarily conserved genes that modulate hypoxia tolerance.

  Study phs000647

• Genome-Wide Analysis of Splenic Marginal Zone Lymphoma

  Splenic Marginal Zone Lymphoma (SMZL) is a B-cell malignancy of unknown pathogenesis and thus orphan of targeted therapies. By integrating whole-exome sequencing and copy-number analysis of 8 paired tumor-normal DNAs from patients with SMZL, we show that the typical SMZL exome carries ~30 genetic alterations. Targeted resequencing of selected candidates in an extended panel of 40-117 samples revealed activating mutations of NOTCH2, a gene required for marginal-zone (MZ) development, as the most frequent and SMZL-specific lesion, accounting for approximately 20% of cases. Additional altered genes suggest that deregulation of signaling pathways normally involved in MZ development (NOTCH, NF-kappa B, and B-cell receptor) represents a critical event in SMZL pathogenesis. These findings have direct implications for the treatment of SMZL patients since drugs are available which can target NOTCH as well as other pathways deregulated in this disease.

  Study phs000502

• DAXX restoration suppresses alternative lengthening of telomeres in ATRX wild-type cells

  Many tumors maintain chromosome ends through a telomerase-independent, homologous recombination based mechanism called alternative lengthening of telomeres (ALT). While ALT occurs in only a subset of tumors, it is strongly associated with mutations in the genes encoding components of the histone H3.3 chaperone complex, ATRX and DAXX. To date the mechanistic role of ATRX and particularly DAXX mutations in potentiating ALT remains poorly understood. We identify an osteosarcoma cell line, G292, with a unique chromosomal translocation resulting in loss of DAXX function, while retaining functional ATRX. Using this distinctive resource, we demonstrate that introduction of wild type DAXX suppresses the ALT phenotype and restores localization of the ATRX/DAXX complex to PML bodies. This provides the first direct molecular evidence that ongoing DAXX deficiency is essential for maintenance of the ALT phenotype and highlights the potential for therapeutic targeting of this oncogenic pathway.

  Study phs001495

• Massachusetts General Hospital (MGH)/Broad Hurthle cell carcinoma whole exome sequencing study

  In this study, we performed whole-exome sequencing of 41 patients with Hurthle cell carcinoma, a thyroid cancer variant with abundant mitochondria. We were able to identify recurrent somatic mutations in both the nuclear and mitochondrial genomes of Hurthle cell carcinoma. Our study identifies mutations in DAXX (GeneID: 1616), TP53 ( GeneID:7157), NF1(GeneID:4763) , NRAS (GeneID:4893), CDKN1A (GeneID:1026), ARHGAP35 (GeneID:2909), the TERT (GeneID:7015) promoter, and mitochondrial-encoded complex I genes to be candidate driver events in Hurthle cell carcinoma. Furthermore, copy number analysis revealed widespread chromosomal losses, resulting in loss-of-heterozygosity and a near-haploid state, to be a defining feature of these tumors. Finally, by analyzing locoregional recurrences and metastases, we were able to identify that widespread chromosomal losses and mitochondrial complex I mutations appear to be early driver events that are selected during clonal evolution.

  Study phs001580

• National Heart, Lung, and Blood Institute SNP Health Association Asthma Resource Project (SHARP)

  SNP Health Association Resource (SHARe) Asthma Resource project (SHARP) is conducting a genome-wide analysis in adults and children who have participated in National Heart, Lung, and Blood Institute's clinical research trials on asthma. This includes 1041 children with asthma who participated in the Childhood Asthma Management Program (CAMP), 994 children who participated in one or five clinical trials conducted by the Childhood Asthma Research and Education (CARE) network, and 701 adults who participated in one of six clinical trials conducted by the Asthma Clinical Research Network (ACRN). There are three study types. The longitudinal clinical trials can be subsetted for population-based and/or case-control analyses. Each of the childhood asthma studies has a majority of children participating as part of a parent-child trio. The ACRN (adult) studies are probands alone. Control genotypes will be provided for case-control analyses.

  Study phs000166

• National Human Genome Research Institute Tumor Sequencing Project (TSP) - Lung Adenocarcinoma

  The Tumor Sequencing Project (TSP) Consortium is a collaboration among participants at the Baylor College of Medicine Human Genome Sequencing Center, the Broad Institute Genome Sequencing Platform, the Dana Farber Cancer Institute, the Memorial Sloan-Kettering Cancer Center, the Genome Sequencing Center and Siteman Cancer Center at Washington University, the M.D. Anderson Cancer Center and the University of Michigan Medical Center. The TSP Part A will pilot approaches to large-scale identification of genomic changes in tumors by sequencing the exonic regions of 623 genes in 188 specimens of adenocarcinoma of the lung, as well as using high density SNP genotyping arrays for high resolution identification of changes in chromosomal copy number. The TSP Part B will pilot approaches to tumor characterization of lung adenocarcinoma samples using next-generation sequencing technologies and benchmark those results against Part A data generated with ABI3730 instruments.

  Study phs000144

• A phase II trial of the aurora kinase A inhibitor alisertib for patients with castration resistant and neuroendocrine prostate cancer: efficacy and biomarker evaluation

  Neuroendocrine prostate cancer (NEPC) is an aggressive variant of prostate cancer that may develop de novo or as a mechanism of treatment resistance. N-myc is capable of driving NEPC progression. Alisertib inhibits the interaction between N-myc and its stabilizing factor Aurora-A, inhibiting N-myc signaling, and suppressing tumor growth. In this single arm, multi-institutional open label phase 2 clinical trial of alisertib, sixty men were treated with alisertib 50mg twice daily for 7 days every 21-days. Eligibility included metastatic prostate cancer and at least one: small cell neuroendocrine morphology; ≥50% neuroendocrine marker expression; new liver metastases without PSA progression; elevated serum neuroendocrine markers. The primary endpoint was six-month radiographic progression free survival. Pre-treatment biopsies were evaluated by whole exome and RNA-seq.

  Study phs001666

• ASsessing and Predicting Infant RSV Effects and Severity (AsPIRES) Study

  A prospective multi-year clinical translational study including three cohorts of term infants experiencing their first Respiratory Syncytial Virus (RSV) season. All infants are less than or equal to nine months of age at study entry. The three subject cohorts represent the full spectrum of RSV disease severity and include a birth cohort, a cohort of infants hospitalized for RSV disease and infants evaluated at ambulatory settings for RSV infection. All infants are followed longitudinally and evaluated at recognition of acute RSV infection and twice during convalescence. Innate and adaptive immune status are comprehensively measured in association with clinical, environmental, viral, and bacteriologic factors. Genome-wide expression is assessed in the nasal airways, and in sorted peripheral blood lymphocytes. The study goal is to Identify host responses to RSV infection and factors associated with severe disease.

  Study phs001201

• Genetics of Hypertension Associated Treatment (GenHAT) Study, Genomic Background of Blood Pressure Response to Treatment in African Americans

  The GenHAT study is an ancillary pharmacogenomics study to the Antihypertensive and Lipid Lowering Treatment to Prevent Heart Attack Trial (ALLHAT). ALLHAT was a randomized, double-blind, multi-center trial that enrolled 42,418 participants ≥55 years of age with hypertension and at least one additional risk factor for cardiovascular disease (CVD). Participants were randomized to treatment with one of four primary antihypertensive drugs: chlorthalidone (thiazide-like diuretic), amlodipine (CCB), lisinopril (ACE-i), or doxazosin (alpha-adrenergic blocker) in a ratio of 1.7:1:1:1, respectively. Participants were followed for treatment response and CVD outcomes. The original GenHAT study (N=39,114) evaluated the association of candidate hypertensive genetic variants with CVD outcomes for participants consenting to genetic research. The current GWAS study focuses on a subset of African American GenHAT participants (n=6908).  

  Study phs002716