10841 results for "800k fc coins Navštivte Buyfc26coins.com Speciální balíčky na prázdniny a dovolené..dQVy"

in 75.54 milliseconds.

• Cancer of Low survival and UnMet Need – Pathologist Initiated

  Despite significant advances in diagnostic cancer histopathology, a subset of tumors remain unable to be classified using WHO criteria. The resulting diagnostic uncertainty can result in inappropriate clinical management and negative patient outcomes. We investigated whether combining histopathology with whole genome and transcriptome sequencing (WGTS) could improve the classification of tumors that posed diagnostic dilemmas despite extensive histopathology and standard molecular work-up at a quaternary oncology center. We successfully sequenced 45 tumors from an initial set of 54 unclassified tumors (83% success rate). A confident diagnosis was made for 38/45 tumors (84%). Additionally, potential treatment targets were identified in 21/45 tumors (47%). Theoretical comparison with alternative assays demonstrated that WGTS was uniquely capable of detecting critical diagnostic findings in 15/38 tumors (39%). This work supports augmenting histopathology and standard molecular pathology with WGTS in the classification of difficult-to-diagnose tumors.

  Study EGAS00001008112

• Adipose transcriptome and plasma metabolome responses after a 6-day very-low energy fast in obesity: a single-arm feeding trial (FASTOMICS-6)

  Background: Fasting and ketogenic diets have gained popularity due to potential health benefits, in part via autophagy and other protective processes. However, although the basic physiology of fasting is well-established, we lack a deeper understanding of mechanisms on the tissue level and associated metabolome changes, particularly in humans. Method: 4 males and 9 females with severe obesity underwent a very-low-energy in-hospital feeding study (600 kcal/day). Plasma (n=13) and subcutaneous adipose tissue (sAT) samples (n=12) were collected in the morning before and after 6 days and analysed by GC-MS/MS and RNA-sequencing, respectively. Gene set enrichment analysis (GSEA) and weighted gene co-expression network analysis were used to identify biological pathways and modules of affected genes and their correlation with plasma ketones and metabolites.

  Study EGAS50000001015

• NHLBI TOPMed: Defining the Time-Dependent Genetic and Transcriptomic Responses to Cardiac Injury Among Patients with Arrhythmias

  The UMMS miRhythm Study is an ongoing study of adult patients undergoing an elective electrophysiology study or arrhythmia ablation procedure for a supraventricular or ventricular arrhythmia, including atrial fibrillation (AF). Atrial fibrillation is a major clinical and public health problem that is related to atrial pathologic remodeling. Few tools are available to quantify the activity or extent of this remodeling, rendering it difficult to identify individuals at risk for AF. Previous studies have suggested an important role for miRNA in cardiovascular disease through gene expression regulation, making this a promising avenue for studying AF mechanisms. The aim of the study is to determine the time-dependent changes to key circulating miRNAs in a model of planned atrial injury and remodeling via ablation. Such knowledge might provide additional insight into the biology and activity of the acute atrial injury response, and furthermore, inform new targets for development of preventative interventions or allow for better AF risk stratification. To assess pathways regulating atrial pathological remodeling, patient blood samples are collected prior to their ablation procedures and also at a regularly scheduled 1-month follow-up appointment. Plasma expression of miRNA is measured using high-throughput quantitative reverse transcriptase polymerase chain reaction (RT-qPCR), providing novel insights into the regulatory processes underlying AF, as well as acute atrial injury in vivo. Additionally, data collected from whole-genome sequencing (WGS) is used to supplement miRNA analyses and further explore new relations between genes and abnormal heart rhythm.

  Study phs001434

• Breast Cancer Family Registry

  The Breast Cancer Family Registry (BCFR) is a multi-center prospective cohort, comprised of over 30,000 women and men from nearly 12,000 families from the United States, Canada, and Australia. Our BCFR resource has been used, and continues to be used, by breast cancer researchers around the world in order to find new ways to prevent, diagnose, and treat cancer. The BCFR provides an extensive and diverse range of resources, expertise, and specialized skills, and has several unique strengths: 1) the collection of a large number of individuals and families across a wide spectrum of breast cancer risk, including both affected and unaffected individuals; 2) the large collection of families with early-onset breast cancer; 3) the large collection of racial/ethnic minority families not replicated elsewhere; 4) the extensive molecular characterization performed to date; and 5) active follow-up of both probands and family members. Thus, the BCFR comprises a unique cohort of probands and family members at familial/genetic risk of breast cancer that will continue to facilitate a wide range of research studies, such as gene discovery, examination of cancer-related outcomes and risk factors in high-risk subjects, investigation of novel behavioral interventions, and cancer prevention trials among at-risk family members. Consequently, the BCFR Cohort, as one of the few cohorts available worldwide with biospecimens and extensive molecular and genetic characterization, combined with epidemiologic data and long-term follow up, will be an invaluable resource for translational research in the genetic epidemiology of breast cancer.

  Study phs002835

• Clonally selected lines after CRISPR/Cas editing are not isogenic

  The CRISPR-Cas9 system has enabled researchers to precisely modify/edit the sequence of a genome. A typical editing experiment consists of two steps: (i) editing cultured cells and (ii) selection of clones, which are presumed to be isogenic, with and without the intended edit. The application of the CRISPR-Cas9 system may result in off-target edits, while cloning would reveal culture-acquired mutations. We analyzed the extent of the former and of the latter by whole genome sequencing (WGS) involving separate genomic loci in three experiments conducted by three independent laboratories. In all experiments we hardly found any off-target edits, while we detected hundreds to thousands of single nucleotide mutations unique to each clone after relatively short culture of 10-20 passages. Notably, clones also differed in copy number alterations that were several kb to several mb in size, representing the largest source of genomic divergence among clones. This study in dbGaP includes data from experiments carried out by investigators at the Oklahoma Medical Research Foundation and Baylor College of Medicine (OMRF/BCM) involving an iPSC line derived from fibroblasts of a female patient (line c7) carrying a constitutional heterozygous variant (chr1:1,464,679 C>T; GRCh37) in exon 15 of the ATPase family, AAA domain containing 3A (ATAD3A) gene. The parental line was edited by introducing a double stranded break at the variant allele to correct the variant by homology directed repair. Two unedited control clones (clone7 and clone8) and one edited clone (SC20) were selected for WGS.

  Study phs003110

• eMERGE: Genetics of Complex Pediatric Disorders from the Center for Applied Genomics

  The Center for Applied Genomics (CAG) is a specialized Center of Emphasis at the Children's Hospital of Philadelphia (CHOP) with the primary goal of translating basic research findings to medical innovations. The mission of CAG is to develop new and better ways to diagnose and treat children affected by rare and complex medical disorders. We aim to discover genetic causes for the most prevalent diseases of childhood including asthma, autism, diabetes, epilepsy, obesity, schizophrenia, pediatric cancer, and a range of rare diseases. Ultimately, our objective is to generate new diagnostic tests and to guide physicians to the most appropriate therapies. The CAG is one of the world's largest genetics research programs in pediatrics, and the only center at a pediatric hospital to have established a large-scale biobank of genotyped samples. The electronic Medical Records and Genomics (eMERGE) Network is a consortium of 9 clinical sites with EMR linked DNA biobanks, including Northwestern University and its NUgene biobank, funded by the NHGRI (National Human Genome Research Institute) to investigate the use of electronic medical record systems for genomic research. The goal of eMERGE is to conduct genome-wide association studies in approximately 100,000 individuals using EMR-derived phenotypes and DNA from linked biorepositories. Using electronic phenotyping methods, the consortium has been and is using DNA samples from all participating sites to explore the genetic determinants of approximately 80 phenotypes, including both diseases and traits, for which the electronic phenotyping algorithms have or are being published on PheKB.org.

  Study phs001165

• The Neonatal Microbiome and Necrotizing Enterocolitis

  The Neonatal Microbiome and Necrotizing enterocolitis (NEC) study is a multi-centered case control study testing the hypothesis that NEC is a direct or indirect consequence of the enteric biomass, its products, or both. Very low birth weight infants (VLBW; birth weight ≤ 1500 grams) admitted to the neonatal intensive care unit are prospectively followed over the first 5 week or until they reach 36 weeks gestation, whichever occurs later. VLBW infants with a lethal clinical condition are excluded. Over the course of the study period, prospective samples are obtained on all infants, and include all stools, and weekly blood samples, palm and oral swabs. Clinical data is collected over the course of the entire hospitalization. Cases are identified based on Bell's staging for NEC, requiring Bell's stage II (abdominal clinical signs and radiographic evidence of pneumatosis, portal venous gas or pneumoperitoneum). Controls are identified from the pool of prospectively enrolled subjects, matching for gestational age, birth weight, post-natal age and birth date. The microbial components of stool and its products before and at the onset of NEC, are then compared between cases and controls. The Aims of this proposal are to (1) conduct a case cohort study in which we compare clinical data and biological specimens from cases and well-matched controls; (2) determine if the kind and density of intestinal biomass, its gene content, and transcriptional activity are associated with, and potential determinants of, NEC; and (3) determine if host risk alleles for intestinal inflammation play a role in the development of NEC.

  Study phs000247

• Early Methamphetamine Abstinence: fMRI and Brain Function

  This study included two groups of subjects, methamphetamine-dependent and healthy control participants, with the purpose of characterizing brain structure and cognition during the first month of abstinence from methamphetamine. Participants were able to participate in one or both phases of the study. Methamphetamine abusers were held as inpatients and abstained from methamphetamine use during the entirety of the study. Phase I covered the 1st week of abstinence and Phase II covered the next 3-4 weeks of abstinence. Control subjects participated as outpatients at timeframes which corresponded to the assessments taken of methamphetamine users. The following outlines the procedures in more detail. After initial telephone screening, in-person screening and recruitment procedures took place at the UCLA Neuropsychiatric Institute. Each methamphetamine abuser subject entered the study after completing an interview and questionnaires on drug use history, and providing a positive urine test for methamphetamine. The evaluation included a psychiatric diagnostic interview according to the Structured Clinical Inventory for DSM-IV (SCID-IV), a medical history and physical examination, blood tests [including a complete chemistry panel, hepatic panel, and tests for hepatitis-C and HIV]. Urine samples were also taken for drug screening of illicit drugs, and to test for pregnancy (female subjects). The methamphetamine abusers were then admitted to the General Clinical Research Center (CRC) and participated on a residential basis, where they were administered daily questionnaires about drug craving, withdrawal and mood. The current study makes available phenotype and genotype data, and interested investigators may contact the principal investigator regarding potential sharing of fMRI data.

  Study phs001198

• Rare Diseases Clinical Research Network (RDCRN) Vasculitis Clinical Research Consortium (VCRC) Longitudinal Protocol for Polyarteritis Nodosa

  The development and validation of accurate biological markers and predictors of disease activity and outcome in Polyarteritis Nodosa (PAN), a form a idiopathic vasculitis, would have a major positive impact on the clinical care of patients with this rare disease, be an important advance in the design of clinical trials and feasibility of new drug development, and provide important insight into the pathogenesis of this condition. Current measures of disease activity, including erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP), while helpful in selected settings, are mostly considered highly flawed and markers whose poor correlation with disease flares makes them inadequate to help guide therapy. Similarly, ESR and CRP are clearly unhelpful as diagnostic tests for vasculitis. The current state of clinical investigation for vasculitis relies heavily upon determination of disease status solely by clinical presentation and investigator opinion. Thus, discovery and validation of more precise markers that quantifiably measure activity, predict disease course, and correlate with an important biological process, would be of great importance. Knowledge to be gained from this study could potentially be highly important. Discovery of effective biomarkers of vasculitis and assessment of long term disease course and complications by the collection of clinical and diagnostic imaging studies proposed could lead to better care and less toxic treatment regimens. Furthermore, insight into the pathophysiology of vasculitis could be gained and this might lead to better treatments and improved outcomes in terms of reduction of vascular and treatment related complications. Ideally, excellent biomarkers reflect a sophisticated understanding of the pathophysiology of a disease.

  Study phs000590

• Genetics of Mood Disorders: Aging and Emotion Regulation Brain Circuitry in Bipolar

  This single-site study is designed to investigate age-related changes in structure and function of a ventral prefrontal cortex (VPFC) neural system, that subserves emotion processing and regulation, during mid to later adulthood in individuals with bipolar disorder (BD), compared to healthy controls (HC). It is a 5-year study of age-related changes in mood, emotion regulation and related symptoms and behaviors using multimodality imaging measures [structural magnetic resonance imaging (MRI) of gray matter, diffusion tensor imaging (DTI) of white matter, and functional MRI measures of functional connectivity and of brain responses during implicit and explicit emotion regulation] comparing BD and HC groups ages 40-79 years, 50% female; a subgroup will be reassessed and rescanned after 2 years to study brain and associated behavioral changes over time. We will explore relationships between brain aging with risk factors implicated in progression. This will include genes, as well as adverse outcomes of progression such as suicide ideation and behavior. As there has been little study of effects of aging of the VPFC emotional circuitry in healthy individuals, findings could provide new insights into brain circuitry and emotional regulation in older adults. In addition to the importance of contributing to understanding BD, as BD is unique in having both elevated and depressive episodes, its study can provide a model for understanding progressive emotion dysregulation to both intervention and prevention that can be better targeted specifically for older individuals with BD. A de-identified blood sample will be sent to the Repository and Genomics Resource.

  Study phs001631

• Non-Coding Autoimmune Risk Variant Defines Role for ICOS in T Peripheral Helper Cell Development

  Our fine-mapping of 76 non-MHC loci associated with risk for rheumatoid arthritis (RA, 11,475 cases, 15,870 controls) has recently identified rs117701653, a non-coding single nucleotide polymorphism (SNP) in the CTLA4/CD28/ICOS locus, as the variant most likely to modulate RA risk within this region, with the minor allele C showing disease protection compared to the major allele A. We found that this SNP exhibits allele-specific protein binding and transcriptional modulation, further supporting its regulatory nature. Here, we aimed to determine whether the functional non-coding variant rs117701653 modulates the expression of genes within the CD28/CTLA4/ICOS locus. To address this question, we employed low-input RNA sequencing using the Illumina SmartSeq2 platform on resting total CD4+ T cells from the blood of 24 healthy subjects (8 AA, 8 AC, 8 CC) recruited based on genotype from the Mass General Brigham biobank. We performed a targeted cis-eQTL mapping analysis for protein coding genes with transcription start sites (TSS) within a 1MB window of SNP rs117701653. These genes included WDR12, NBEAL1, CYP20A1, ABI2, RAPH1, CD28, CTLA4, ICOS, and PARD3B. Surprisingly, allelic variation at rs117701653 correlated strongly with expression of ICOS. This suggests that individuals carrying the protective allele C at rs117701653 express lower levels of ICOS, implicating ICOS as a plausible target gene influenced by this protective allele. The raw sequence data from the 24 healthy individuals are available through dbGAP. Gene expression matrices have been deposited to GEO accession GSE235868.

  Study phs003448

• NCI Cancer Model Development for the Human Cancer Model Initiative (HCMI)

  The Cancer Model Development Center (CMDC) project is part of the Human Cancer Model Initiative (HCMI) and is managed by the Office of Cancer Genomics within the Center for Cancer Genomics at the National Cancer Institute (NCI). The goal of the HCMI is to generate approximately 1000 novel human "next generation" tumor-derived models as a community resource. The models aim to faithfully recapitulate the cellular complexity and heterogeneity of human tumors. The CMDCs are tasked by the NCI with producing a proportion of the cancer models. Wellcome Sanger Institute (WSI) is a contributing member of the HCMI. Models developed by HCMI are being derived from a number of tumor types and subtypes (see below), including rare adult, pediatric and understudied cancers. The number of models and the clinical sites from which patient samples are acquired is increasing. Normal tissue, originating tumor, and tumor-derived models are sequenced. The next generation cancer models are associated with rich clinical and genomic data through the NCI Genomic Data Commons for all researchers to advance cancer research. The CMDC and HCMI models will serve as excellent tools in research to provide insight into the pathways that influence tumor growth and progression, how tumors respond to therapy, etc. Ultimately, the data generated using these models will support the development of personalized oncology. There is a delay between registered IDs and model availability. The current model count is found in The HCMI Searchable Catalog which is updated when new models are available for distribution to the research community.

  Study phs001486

• PCPT and SELECT Cohorts: Core Infrastructure Support for Cancer Research

  SELECT study: SELECT was a phase III, double-blind, placebo-controlled 4-arm study of selenium, vitamin E, selenium and vitamin E together, and placebo designed to assess the effect of these supplements on the incidence of prostate cancer. Funded by the National Cancer Institute and conducted by SWOG, the study opened in August 2001 and quickly exceeded its accrual goal of 35,533 men.In the fall of 2008, the trial's Data Safety and Monitoring Committee recommended that participants discontinue taking study supplements due to convincing evidence (planned interim futility analysis) that neither vitamin E nor selenium supplements were associated with the prevention of prostate cancer. A subsequent analysis in 2011 showed a significant 17% increase in prostate cancer incidence in participants who were on the vitamin E only arm. Approximately 17,000 participants from the original trial recently completed an additional four years of centralized follow-up. This follow-up ended on May 31, 2014 and SELECT is now closed. PCPT study: The Prostate Cancer Prevention Trial (PCPT) was a SWOG Cancer Research Network-coordinated study designed to test whether the drug finasteride (Proscar®) would prevent prostate cancer in men ages 55 and older. This study was closed on June 24, 2003 because the study objective had been reached. The results of the study, which did find a preventive benefit for the drug, were published as "The Influence of Finasteride on the Development of Prostate Cancer," in the New England Journal of Medicine on July 17, 2003.

  Study phs003382

• Study on the Genetics of Alcoholism (COGA): Smoke Screen and Exome Sequencing

  This is a family study of alcoholism, in which the subjects have been drawn from the Collaborative Study on the Genetics of Alcoholism (COGA), a large, ongoing family-based study that includes subjects from seven sites around the US. COGA has gathered detailed, standardized data on study participants, including diagnostic and neurophysiological assessments. This project has already proved successful in identifying several genes that influence the risk for alcoholism and neurophysiological endophenotypes, which have been independently replicated. COGA data were included as part of two Genetic Analysis Workshops, and the phenotypes are familiar to the genetics community. Alcoholic probands were recruited from treatment facilities, assessed by personal interview, and after securing permission, other family members were also assessed. A set of comparison families was drawn from the same communities as the families recruited through an alcoholic proband. Assessment involved a detailed personal interview developed for this project, the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA), which gathers detailed information on alcoholism related symptoms along with other drugs and psychiatric symptoms. Many participants also came to the laboratories for electroencephalographic studies. Neurophysiological features that have been shown to be useful endophenotypes for which we have linkage and in some cases association results are included on a subset of the case-control sample: the beta power of the resting electroencephalogram (EEG), the P3(00) amplitude of the visual event-related potential (ERP), and the theta and delta event-related oscillations (EROs) underlying the P3.

  Study phs001208

• dbGaP Collection: Open Translational Science in Schizophrenia (OPTICS)

  Schizophrenia is a chronic, severe, disabling brain disorder that affects approximately 1% of the population worldwide. Epidemiologic studies have clearly demonstrated that genetics play a strong role in etiology, but the inheritance is very complex. Innovative analytic approaches and creative ways of combining disparate data sets will be necessary for making breakthroughs in identifying causal pathways and ultimately new drug targets. This dbGaP Collection consists of all genetic studies of schizophrenia available in dbGaP that have been consented for general research use. The goal is to facilitate identification of datasets with related scientific content in order to expedite the application process and ascertainment of datasets of interest for increased scientific discovery. The Open Translational Science in Schizophrenia (OPTICS) Project, was launched by Janssen Research & Development, LLC, part of the Janssen Pharmaceutical Companies of Johnson & Johnson, with a group of leading research organizations including the National Institutes of Health, Yale University School of Medicine, Rutgers University and the Harvard T.H. Chan School of Public Health, to create a new forum for collaborative analysis of Janssen's schizophrenia clinical trial data and other publicly available data about schizophrenia with the goal of creating new models for conducting research. The OPTICS project is one part of a larger effort at Janssen and other Johnson & Johnson research companies to share clinical trials data to enhance public health and advance science and medicine. Qualified investigators and physicians may apply for access to anonymized clinical trials data from Janssen, for more information please visit https://sites.google.com/site/opticsschizophrenia/.

  Study phs000887

• Organoid cultures of early-onset colorectal cancers reveal distinct and rare genetic profiles

  Sporadic early-onset colorectal cancer (EOCRC) has bad prognosis, yet is poorly represented by cell line models. We examine the key mutational and transcriptomic alterations in an organoid biobank enriched in EOCRCs. We established paired cancer (n=32) and normal organoids (n=18) from 20 patients enriched in microsatellite-stable EOCRC. Exome and transcriptome analysis was performed. We observed a striking diversity of molecular phenotypes, including PTPRK-RSPO3 fusions. Transcriptionally, RSPO fusion organoids resembled normal colon organoids and were distinct from APC mutant organoids, with high BMP2 and low PTK7 expression. Single cell transcriptome analysis confirmed the similarity between RSPO fusion organoids and normal organoids, with a propensity for maturation on Wnt withdrawal, whereas the APC mutant organoids were locked in progenitor stages. CRISPR/Cas9 engineered mutation of APC in normal human colon organoids led to upregulation of PTK7 protein and suppression of BMP2, but less so with an engineered RNF43 mutation. The frequent co-occurrence of RSPO fusions with SMAD4 or BMPR1A mutation was confirmed in TCGA database searches. RNF43 mutation was found in organoid from a leukaemia survivor with a novel mutational signature; and organoids with POLE proofreading mutation displayed ultramutation. The cancer organoid genomes were stable over long culture periods, while normal human colon organoids tended to be subject to clonal dominance over time. These organoid models enriched in EOCRCs with linked genomic data fill a gap in existing CRC models and reveal distinct genetic profiles and novel pathway cooperativity.

  Study EGAS00001004063

• Single cell RNA-seq mapping of nasal and tracheobronchial airways in human healthy volunteers

  The respiratory tract constitutes an elaborated line of defense based on a unique cellular ecosystem. Single-cell profiling methods enable the investigation of cell population distributions and transcriptional changes along the airways. We have explored cellular heterogeneity of the human airway epithelium in 10 healthy living volunteers by single-cell RNA profiling. 77,969 cells were collected by bronchoscopy at 35 distinct locations, from the nose to the 12th division of the airway tree. The resulting atlas is composed of a high percentage of epithelial cells (89.1%), but also immune (6.2%) and stromal (4.7%) cells with peculiar cellular proportions in different sites of the airways. It reveals differential gene expression between identical cell types (suprabasal, secretory, and multiciliated cells) from the nose (MUC4, PI3, SIX3) and tracheobronchial (SCGB1A1, TFF3) airways. By contrast, cell-type specific gene expression was stable across all tracheobronchial samples. Our atlas improves the description of ionocytes, pulmonary neuro-endocrine (PNEC) and brush cells, which are likely derived from a common population of precursor cells. We also report a population of KRT13 positive cells with a high percentage of dividing cells which are reminiscent of “hillock” cells previously described in mouse. Robust characterization of this unprecedented large single-cell cohort establishes an important resource for future investigations. The precise description of the continuum existing from nasal epithelium to successive divisions of lung airways and the stable gene expression profile of these regions better defines conditions under which relevant tracheobronchial proxies of human respiratory diseases can be developed.

  Study EGAS00001004082

• UK10K NEURO FSZNK

  In the UK10K project we propose a series of complementary genetic approaches to find new low frequency/rare variants contributing to disease phenotypes. These will be based on obtaining the genome wide sequence of 4000 samples from the TwinsUK and ALSPAC cohorts (at 6x sequence coverage), and the exome sequence (protein coding regions and related conserved sequence) of 6000 samples selected for extreme phenotypes. Our studies will focus primarily on cardiovascular-related quantitative traits, obesity and related metabolic traits, neurodevelopmental disorders and a limited number of extreme clinical phenotypes that will provide proof-of-concept for future familial trait sequencing. We will analyse directly quantitative traits in the cohorts and the selected traits in the extreme samples, and also use imputation down to 0.1% allele frequency to extend the analyses to further sample sets with genome wide genotype data. In each case we will investigate indels and larger structural variants as well as SNPs, and use statistical methods that combine rare variants in a locus or pathway as well as single-variant approaches. This Finnish schizophrenia sample set has been collected from a population cohort using national registers. The entire sample collection consists of 2756 individuals from 458 families of whom 931 are diagnosed with schizophrenia spectrum disorder. Families outside Kuusamo (n=288) all had at least two affected siblings. All diagnoses are based on DSM-IV and for a large fraction of cases there is cognitive data.For further details/descriptions with regard to this data set please contact Tiina Paunio (tiina.paunio@thl.fi)

  Study EGAS00001000119

• Neoantigen responses to Immunotherapy in Prostate Cancer

  To determine whether antigen-specific T cell responses can be elicited following treatment with ICT in cancers that have a low TMB, a clinical trial with ipilimumab (anti-CTLA-4) was conducted in 30 patients with metastatic castration-resistant prostate cancer (CRPC). We identified 2 distinct groups of patients divided by clinical outcomes, which consisted of a cohort with Favorable and Unfavorable outcomes. Compared to the Unfavorable cohort, the patients in the Favorable cohort were more likely to have higher intratumoral CD8 T cell density and/or IFN-γ response gene signature, including five patients who had antigen-specific T cell responses that were only detectable after ipilimumab therapy. Three patients had T cell responses against tumor-associated antigens (PSMA and PAP). Importantly, two patients with a relatively low TMB had T cell responses against unique neoantigens. Collectively, our data indicate that a subset of patients with metastatic prostate cancer benefit from ICTs, particularly those who have immunological biomarkers associated with effector T cell responses. Publication: Sumit K. Subudhi, Luis Vence, Hao Zhao, Jorge Blando, Shalini S. Yadav, Qing Xiong, Alexandre Reuben, Ana Aparicio, Paul G. Corn, Brian F. Chapin, Louis L. Pisters, Patricia Troncoso, Rebecca Slack Tidwell, Peter Thall, Chang-Jiun Wu, Jianhua Zhang, Christopher L. Logothetis, Andrew Futreal, James P. Allison and Padmanee Sharma, 2020, Neoantigen responses, immune correlates, and favorable outcomes after ipilimumab treatment of patients with prostate cancer. Science Translational Medicine, 01 Apr 2020:Vol. 12, Issue 537, eaaz3577DOI: 10.1126/scitranslmed.aaz3577. https://pubmed.ncbi.nlm.nih.gov/32238575/

  Study EGAS00001004050

• TRACERx 100: whole exome data of the first 100 TRACERx tumours

  BACKGROUNDTRACERx (TRAcking Cancer Evolution through therapy (Rx)) is a prospective cohort study designed to investigate intratumor heterogeneity (ITH) in relation to clinical outcome, and to determine the clonal nature of driver events and evolutionary processes in early stage non-small cell lung cancer (NSCLC). METHODSMultiregion high-depth whole-exome sequencing (M-seq) was performed on 100 early stage NSCLC tumors resected prior to systemic therapy. A total of 327 tumor regions were sequenced and analyzed to define evolutionary histories, obtain a census of clonal and subclonal events, and assess the relationship between ITH and recurrence-free survival (RFS). RESULTSWidespread ITH was observed for both somatic copy number alterations (median 48% [0.03-88%]) and mutations (median 30% [0.5-93%]). Driver mutations in EGFR, MET, BRAF and TP53 were almost always clonal. However, heterogeneous driver alterations occurring later in evolution were found in over 75% of tumors and were common in PIK3CA, NF1 and genes involved in chromatin modification and DNA response and repair. Genome doubling and ongoing dynamic chromosomal instability (CIN), illustrated by mirrored subclonal allelic imbalance, were identified as causes of ITH resulting in parallel evolution of driver copy number events, including amplifications of CDK4, FOXA1, and BCL11A. Elevated copy number heterogeneity was associated with shorter RFS (HR=4.9, P=0.00044), which remained significant in a multivariate analysis.CONCLUSIONSITH mediated through CIN, rather than point mutational heterogeneity, was associated with increased risk of relapse, supporting its value as a prognostic predictor, and the need to target this high-risk phenotype.

  Study EGAS00001002247

• A Single Complex Agpat2 Allele In A Patient With Partial Lipodystrophy

  Genetic lipodystrophies are a group of rare syndromes associated with major metabolic complications - including severe insulin resistance, type 2 diabetes mellitus, and hypertriglyceridemia - which are classified according to the distribution of adipose tissue. Lipodystrophies can be present at birth or develop during life and can range from local to partial and general. With at least 18 different genes implicated so far, definite diagnosis can be challenging due to clinical and genetic heterogeneity. In an adult female patient with clinical and metabolic features of partial lipodystrophy we identified via whole genome sequencing a single complex AGPAT2 allele [V67M;V167A], functionally equivalent to heterozygosity. AGPAT2 encodes for an acyltransferase implicated in the biosynthesis of triacylglycerol and glycerophospholipids. So far homozygous and compound heterozygous mutations in AGPAT2 have only been associated with generalized lipodystrophy. A SNP risk score analysis indicated that the index patient is not predisposed to lipodystrophy based on her genetic background. The partial phenotype in our patient is therefore more likely associated to the genetic variants in AGPAT2. To test whether the resulting double-mutant AGPAT2 protein is functional we analysed its in vitro enzymatic activity via mass spectrometry. The resulting AGPAT2 double mutant is enzymatically inactive. Our data support the view that the current classification of lipodystrophies as strictly local, partial or generalized may have to be re-evaluated and viewed more as a continuum, both in terms of clinical presentation and underlying genetic causes. Better molecular understanding of lipodystrophies may lead to new therapies to treat adipose tissue dysfunction in common and rare diseases.

  Study EGAS00001003177

• Longitudinal_profiling_of_the_immune_response_to_Plasmodium_vivax_in_naive_hosts_by_RNA_sequencing

  Plasmodium vivax offers unique challenges for control and elimination, and may prove a tougher hurdle to overcome than Plasmodium falciparum. And yet compared to P. falciparum we know very little about the innate and adaptive immune responses that need to be harnessed to reduce disease and transmission. We recently generated a blood bank of a new clonal field isolate of P. vivax (PvW1) for human challenge studies and used systems immunology tools to track the host response throughout infection and convalescence. As part of this study, RNA-sequencing was used to resolve changes in whole blood gene expression through time in 6 volunteers (7-9 time-points per volunteer). In summary, these data show that P. vivax induces two distinct transcriptional programmes in whole blood during and after infection. During infection, transcriptional profiling reveals the rapid mobilisation of an emergency myeloid response, which leads to systemic inflammation and the recruitment of all major T cell subsets into lymphoid tissues. Six days after infection, this innate response subsides and a transcriptional signature of proliferation is revealed. This most likely represents widespread activation of lymphocytes, which return to the circulation after parasite clearance - transcriptional profiling of T cells at this time-point could therefore reveal the outcomes of critical cell-cell interactions that take place within the spleen during infection. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001003847

• Nanopore sequencing of blood, saliva, buccal mucosa samples of patients with inherited retinal disorders

  X-linked genetic disorders typically affect females less severely than males due to the presence of a second X chromosome not carrying the deleterious variant. However, the phenotypic expression in females is highly variable, which may be explained by an allelic skew in X chromosome inactivation. Accurate measurement of X inactivation skew is crucial to understand and predict disease phenotype in carrier females, with prediction especially relevant for degenerative conditions. We propose a novel approach using nanopore sequencing to quantify skewed X inactivation accurately. By phasing sequence variants and methylation patterns, this single assay reveals the disease variant, X inactivation skew, its directionality, and is applicable to all patients and X-linked variants. Enrichment of X-chromosome reads through adaptive sampling enhances cost-efficiency. Our study includes a cohort of 16 X-linked variant carrier females affected by two X-linked inherited retinal diseases: choroideremia and RPGR-associated retinitis pigmentosa. As retinal DNA cannot be readily obtained, we instead determine the skew from peripheral samples (blood, saliva and buccal mucosa), and correlate it to phenotypic outcomes. This revealed a strong correlation between X inactivation skew and disease presentation, confirming the value in performing this assay and its potential as a way to prioritise patients for early intervention, such as gene therapy currently in clinical trials for these conditions. Our method of assessing skewed X inactivation is applicable to all long-read genomic datasets, providing insights into disease risk and severity and aiding in the development of individualised strategies for X-linked variant carrier females.

  Study EGAS50000000440

• Dilgom_Exome

  The Finrisk sample sets are part of the National FINRISK Study. It is a large population survey on risk factors of chronic, noncommunicable diseases. The survey is carried out since 1972 every five years using independent, random and representative population samples from different parts of Finland. The main results from the previous FINRISK 2007 survey are published.The National FINRISK Study Survey was carried out in 5 areas in Finland and 2000 inhabitants aged 25-75 years were invited to participate in each year. Among findings were that Finns continue to gain weight.Data from FINRISK surveys are used for many different research projects and for national health monitoring needs. The recent research activities deal, in addition to cardiovascular diseases and the classical risk factors, also with e.g. asthma and allergy, alcohol, socioeconomic factors and genetic epidemiology.The FINRISK study is part of the MORGAM Project (MONICA Risk, Genetics, Archiving and Monigraph), sponsored by the EU and MDECODE (Molecular Diversity and Epidemiology of Common Disease) program coordinated by the University of Michigan.The exome sequencing study will be part of the Dilgom study, which is a part of the larger Finrisk population based health study performed in Finland. It consists of 5000 individuals with a prospective aspect of metabolic traits. The cohort has been extensively phenotyped for their cardiovascular and metabolic status. So far, we have performed a 660K Illumina GWAS and a full genome wide expression study from peripheral blood cells of 500 individuals. The cohort has also been in total genotyped by the cardiometabochip

  Study EGAS00001000086

• Quantification of chromosomal copy number aberrations by shallow whole-genome sequencing

  Detection of DNA copy number aberrations by shallow whole-genome sequencing (WGS) faces many challenges including lack of completion and errors in the human reference genome, repetitive sequences, polymorphisms, variable sample quality, and biases in the sequencing procedures.Formalin-fixed paraffin-embedded (FFPE) archival material, the analysis of which is important for studies of cancer, presents particular analytical difficulties due to degradation of the DNA and frequent lack of matched reference samples. We present a robust, cost-effective WGS method for DNA copy number analysis that addresses these challenges more successfully than currently available procedures. In practice very useful profiles can be obtained with 0.1 fold genome coverage. We improve on previous methods by; first, implementing a combined correction for sequence mappability and GC content, and second, applying this procedure to sequence data from the 1000 Genomes Project in order to develop a blacklist of problematic genome regions. A small subset of these blacklisted regions were previously identified by ENCODE, but the vast majority are novel unappreciated problematic regions. Our procedures are implemented in a pipeline called QDNAseq. We have analyzed over 1,000 samples, most of which were obtained from the fixed tissue archives of over 25 institutions.We demonstrate that for most samples our sequencing and analysis procedures yield genome profiles with noise levels near the statistical limit imposed by read counting. The described procedures also provide better correction of artifacts introduced by low DNA quality than prior approaches, and better copy number data than high-resolution microarrays at substantially lower cost.

  Study EGAS00001000642

• Prediction and quantification of splice events from RNA-seq data

  Analysis of splice variants from short read RNA-seq data remains a challenging problem. Here we present a novel method for the genome-guided prediction and quantification of splice events from RNA-seq data, which enables the analysis of unannotated and complex splice events. Splice junctions and exons are predicted from reads mapped to a reference genome and are assembled into a genome-wide splice graph. Splice events are identified recursively from the graph and are quantified locally based on reads extending across the start or end of each splice variant. We assess prediction accuracy based on simulated and real RNA-seq data, and illustrate how different read aligners (GSNAP, HISAT2, STAR, TopHat2) affect prediction results. We validate our approach for quantification based on simulated data, and compare local estimates of relative splice variant usage with those from other methods (MISO, Cufflinks) based on simulated and real RNA-seq data. In a proof-of-concept study of splice variants in 16 normal human tissues (Illumina Body Map 2.0) we identify 249 internal exons that belong to known genes but are not related to annotated exons. Using independent RNA samples from 14 matched normal human tissues, we validate 9/9 of these exons by RT-PCR and 216/249 by paired-end RNA-seq (2 x 250 bp). These results indicate that de novo prediction of splice variants remains beneficial even in well-studied systems. An implementation of our method is freely available as an R/Bioconductor package SGSeq.

  Study EGAS00001001026

• Expanding the neurodevelopmental phenotypes of individuals with de novo KMT2A variants

  De novo loss-of-function (LoF) variants in the KMT2A gene are associated with Wiedemann-Steiner Syndrome (WSS). Recently, de novo KMT2A variants have been identified in sequencing studies of cohorts of individuals with neurodevelopmental disorders (NDDs). However, most of these studies lack the detailed clinical information required to determine whether those individuals have isolated NDDs or WSS (i.e. syndromic NDDs). We performed thorough clinical and neurodevelopmental phenotyping on six individuals with de novo KMT2A variants. From these data, we found that all six patients met clinical criteria for WSS and we further define the neurodevelopmental phenotypes associated with KMT2A variants and WSS. In particular, we identified a subtype of Autism Spectrum Disorder (ASD) in five individuals, characterized by marked rigid, repetitive and inflexible behaviours, emotional dysregulation, externalizing behaviours, but relative social motivation. To further explore the clinical spectrum associated with KMT2A variants, we also conducted a meta-analysis of individuals with KMT2A variants reported in the published literature. We found that de novo LoF or missense variants in KMT2A were significantly more prevalent than predicted by a previously established statistical model of de novo mutation rate for KMT2A. Our genotype-phenotype findings better define the clinical spectrum associated with KMT2A variants and suggest that individuals with de novo LoF and missense variants likely have a clinically unrecognized diagnosis of WSS, rather than isolated NDD or ASD alone. This highlights the importance of a clinical genetic and neurodevelopmental assessment for individuals with such variants in KMT2A.

  Study EGAS00001003521

• UK10K_RARE_THYROID

  In the UK10K project we propose a series of complementary genetic approaches to find new low frequency/rare variants contributing to disease phenotypes. These will be based on obtaining the genome wide sequence of 4000 samples from the TwinsUK and ALSPAC cohorts (at 6x sequence coverage), and the exome sequence (protein coding regions and related conserved sequence) of 6000 samples selected for extreme phenotypes. Our studies will focus primarily on cardiovascular-related quantitative traits, obesity and related metabolic traits, neurodevelopmental disorders and a limited number of extreme clinical phenotypes that will provide proof-of-concept for future familial trait sequencing. We will analyse directly quantitative traits in the cohorts and the selected traits in the extreme samples, and also use imputation down to 0.1% allele frequency to extend the analyses to further sample sets with genome wide genotype data. In each case we will investigate indels and larger structural variants as well as SNPs, and use statistical methods that combine rare variants in a locus or pathway as well as single-variant approaches.Two cohorts of subjects are being analysed: Individuals with Congenital Hypothyroidism (CH) due either to dysgenesis or dyshormonogenesis; Patients with Resistance to Thyroid hormone (RTH), a disorder characterized by elevated thyroid hormones and variable tissue refractoriness to hormone action. The CH cohort has been enriched for genetic aetiologies by recruiting cases that are familial, on a consanguineous background or syndromic. The RTH cohort consists of cases in which candidate gene analyses have been negative.For further information with regard to this cohort please contact Krishna Chatterjee (kkc1@medschl.cam.ac.uk).

  Study EGAS00001000131

• Detection of ctDNA in Plasma of Patients with Clinically Localised Prostate Cancer is Associated with Rapid Disease Progression

  Purpose: DNA originating from degenerate tumour cells can be detected in the circulation in many tumour types, where it can be used as a marker of disease burden as well as to monitor treatment response. Although circulating tumour DNA (ctDNA) measurement has prognostic/predictive value in metastatic prostate cancer, its utility in localised disease is unknown. Patients and Methods: We performed whole genome sequencing of tumour-normal pairs in eight patients with clinically localised disease undergoing prostatectomy, identifying high confidence genomic aberrations. A bespoke DNA capture and amplification panel against the highest prevalence, highest confidence aberrations for each individual was designed and used to interrogate ctDNA isolated from plasma prospectively obtained pre- and post- (24 hours and 6 weeks) surgery. In a separate cohort (n=189) we identified the presence of ctDNA TP53 mutations in pre-operative plasma in a retrospective cohort, and determined its association with biochemical- and metastasis-free survival. Results: Tumour variants in ctDNA were positively identified pre-treatment in two of eight patients, which in both cases remained detectable postoperatively. Patients with tumour variants in ctDNA had extremely rapid disease recurrence and progression compared to those where variants could not be detected. In terms of aberrations targeted, single nucleotide and structural variants outperformed indels and copy number aberrations. Detection of ctDNA TP53 mutations was associated with a significantly shorter metastasis-free survival (6.2 vs. 9.5 years (HR 2.4; 95% CIs 1.2-4.8, p = 0.014)). Conclusions: CtDNA is uncommonly detected in localised prostate cancer but its presence portends more rapidly progressive disease.

  Study EGAS00001004636

• Dynamics of genome architecture and chromatin function during human B cell differentiation and neoplastic transformation

  Despite recent advances, the dynamics of genome architecture and chromatin function during human cell differentiation and its potential reorganization upon neoplastic transformation remains poorly characterized. Here, we integrate in situ Hi-C and nine additional omic layers to define and biologically characterize the dynamic changes in three-dimensional (3D) genome architecture across normal B cell differentiation and in neoplastic cells from different subtypes of chronic lymphocytic leukemia (CLL) and mantle cell lymphoma (MCL) patients. Beyond conventional active (A) and inactive (B) compartments, an integrative analysis of Hi-C data uncovers a highly-dynamic intermediate compartment enriched in poised and polycomb-repressed chromatin. During B cell development, we detect that 28% of the compartments change at defined maturation stages and mostly involve the intermediate compartment. The transition from naive to germinal center B cells is associated with widespread chromatin activation, which mostly reverts into the naive state upon further maturation of germinal center cells into memory B cells. The analysis of CLL and MCL neoplastic cells points both to entity and subtype-specific alterations in chromosome organization. Remarkably, we observe that large chromatin blocks containing key disease-specific genes alter their 3D genome organization. These include the inactivation of a 2Mb region containing the EBF1 gene in CLL and the activation of a 6.1Mb region containing the SOX11 gene in clinically aggressive MCL. This study indicates that 3D genome interactions are extensively modulated during normal B cell differentiation and that the genome of B cell neoplasias acquires a tumor-specific 3D genome architecture.

  Study EGAS00001004763

• Exome-wide mutation analysis of cell-free DNA to simultaneously monitor the full spectrum of cancer treatment outcomes

  Purpose: Cell-free DNA (cfDNA) offers a non-invasive approach to monitor cancer. Here we develop a method using whole-exome sequencing (WES) of cfDNA for simultaneously monitoring the full spectrum of cancer treatment outcomes, including MRD, recurrence, evolution, and second primary cancers. Experimental Design: Three simulation datasets were generated from 26 cancer patients to benchmark the detection performance of MRD/recurrence and second primary cancers. For further validation, cfDNA samples (n=76) from cancer patients (n=35) with six different cancer types were used for performance validation during various treatments.Results: We present a cfDNA-based cancer monitoring method, named cfTrack. Taking advantage of the broad genome coverage of WES data, cfTrack can sensitively detect MRD and cancer recurrence by integrating signals across known clonal tumor mutations of a patient. In addition, cfTrack detects tumor evolution and second primary cancers by de novo identifying emerging tumor mutations. A series of machine learning and statistical denoising techniques are applied to enhance the detection power. On the simulation data, cfTrack achieved an average AUC of 99% on the validation dataset and 100% on the independent dataset in detecting recurrence in samples with tumor fraction ≥0.05%. In addition, cfTrack yielded an average AUC of 88% in detecting second primary cancers in samples with tumor fraction ≥0.2%. On real data, cfTrack accurately monitors tumor evolution during treatment, which cannot be accomplished by previous methods.Conclusion: Our results demonstrated that cfTrack can sensitively and specifically monitor the full spectrum of cancer treatment outcomes using exome-wide mutation analysis of cfDNA.

  Study EGAS00001005906

• Butyrate producers as potential next-generation probiotics: safety assessment of the administration of Butyricicoccus pullicaecorum to healthy volunteers

  Advances in gut microbiota research have triggered interest in developing colon butyrate producers as niche-specific next-generation probiotics, targeted at increasing colon butyrate production and countering disease-associated microbiota alterations. Crucial steps in the development of next-generation probiotics are the design of formulations with a reasonable shelf life as well as the safety demonstration of an intervention in healthy volunteers. One such potential next-generation butyrate-producing probiotic is Butyricicoccus pullicaecorum 25-3T, with demonstrated safety in in vitro as well as in animal models. Here, we examined the strain's safety, tolerability, and impact on microbiota composition and metabolic activity in healthy volunteers in a randomized, double blind, placebo-controlled, crossover study in 30 healthy volunteers. Study design consisted of two four-week intervention periods (108 CFU B. pullicaecorum [treatment] or maltodextrin [placebo] per day) with a three-week washout in between. We assessed adverse events, blood parameters (primary endpoints), and fecal microbiota composition and metabolite profiles (secondary endpoints).The number of reported adverse events during the B. pullicaecorum treatment was similar to placebo intervention, as were observed changes in blood chemistry parameters, bowel habits, and fecal calprotectin concentrations. Administration of the strain did not induce any disruptive effect in microbiota composition or metabolic activity. In this first human intervention trial with a butyrate-producing Clostridium cluster IV isolate, we demonstrated B. pullicaecorum 25-3T administration to be both safe and well tolerated by healthy participants. This safety study paves the way for the further development of the strain as a next-generation probiotic.

  Study EGAS00001003276

• RaScALL: Rapid screening of RNA-seq in acute lymphoblastic leukaemia

  RNA-sequencing (RNA-seq) efforts in acute lymphoblastic leukaemia (ALL) have identified numerous prognostically significant genomic alterations which can guide diagnostic risk stratification and treatment choices when detected early. However, a full RNA-seq Bioinformatics workflow is time-consuming and costly in a clinical setting where rapid detection and accurate reporting of clinically relevant alterations are essential. To accelerate the identification of ALL-specific alterations (including gene fusions, single nucleotide variants and focal gene deletions), we developed the rapid screening tool RaScALL, capable of identifying more than 100 prognostically significant lesions directly from raw sequencing reads. RaScALL uses the k-mer based targeted detection tool km and known ALL variant information to achieve a high degree of accuracy for reporting subtype defining genomic alterations compared to standard alignment-based pipelines. Gene fusions, including difficult to detect fusions involving EPOR and DUX4, were accurately identified in 98% (164 samples) of reported cases in a 180-patient Australian study cohort and 95% (n=63) of samples in a North American validation cohort. Pathogenic sequence variants were correctly identified in 75% of tested samples, including all cases involving subtype defining variants PAX5 p.P80R (n=12) and IKZF1 p.N159Y (n=4). Accurate detection of intragenic IKZF1 deletions resulting in aberrant transcript isoforms was also detectable with 98% accuracy. Importantly, the median analysis time for detection of all targeted alterations averaged 22 minutes per sample, significantly shorter than standard alignment-based approaches, ensuring accerelated risk-stratification and therapeutic triage.

  Study EGAS00001006460

• Transcriptional_reprogramming_from_innate_immune_functions_to_a_pro_thrombotic_signature_upon_SARS_CoV_2_sensing_by_monocytes_in_COVID_19

  Alterations in the myeloid immune compartment have been observed in COVID-19, but the specific mechanisms underlying these impairments are not completely understood. Here we examined the functionality of classical CD14+ monocytes as a main myeloid cell component in well-defined cohorts of patients with mild and moderate COVID-19 during the acute phase of infection and compared them to that of healthy individuals. We found that ex vivo isolated CD14+ monocytes from mild and moderate COVID-19 patients display specific expression patterns of costimulatory and inhibitory receptors that clearly distinguish them from healthy monocytes, as well as an altered metabolic profile. In addition, decreased NFB activation in COVID-19 monocytes ex vivo is accompanied by an intact type I IFN antiviral response. Secondary pathogen sensing ex vivo led to a state of functional unresponsiveness characterized by a defect in pro-inflammatory cytokine expression, NFB-driven cytokine responses and defective type I IFN response in moderate COVID-19 monocytes, together with defects in the metabolic reprogramming that innate immune cells usually undergo upon pathogen sensing. Transcriptionally and functionally, COVID-19 monocytes switched their gene expression signature from canonical innate immune functions to a pro-thrombotic phenotype characterized by enrichment of pathways involved in hemostasis, immunothrombosis, platelet aggregation and other accessory pathways to platelet activation, accumulation and clot formation, including extracellular matrix reorganization, integrin cell surface interactions and signaling by PDGF. These results provide a potential mechanism by which innate immune dysfunction in COVID-19 may contribute to disease pathology

  Study EGAS00001006788

• Non-viral precision T cell receptor replacement for personalized cell therapy

  The T cell receptor (TCR) provides the fine specificity of T cells to recognize mutations in cancer cells 1-3. We developed a clinical-grade approach based on CRISPR/Cas9 non-viral precision genome editing to simultaneously knock-out the two endogenous TCR genes, TCRα (TRAC) and TCRβ (TRBC), and insert in the TRAC locus the two chains of a neoantigen-specific TCR (neoTCR), isolated from the patient’s own circulating T cells using a personalized library of soluble predicted neoantigen-HLA capture reagents. Sixteen patients with refractory solid cancers received up to three distinct neoTCR-transgenic cell products, each expressing a patient-specific neoTCR, in a cell dose-escalation, first-in-human phase 1 clinical trial (NCT03970382). One patient had grade 1 cytokine release syndrome, and one grade 3 encephalitis. All had the expected side effects from the lymphodepleting chemotherapy. Five patients had stable disease, and the other 11 had disease progression as best response on therapy. NeoTCR-transgenic T cells were detected in tumour biopsies post-infusion at frequencies higher than the native TCRs pre-infusion. This study demonstrates the feasibility of isolating and cloning multiple TCRs recognizing mutational neoantigens, the simultaneous knock-out of the endogenous TCR and knock-in of the neoTCRs using single-step, non-viral precision genome editing, the manufacturing of neoTCR engineered T cells at clinical grade, the safety of infusing up to three gene edited neoTCR T cell products, and the ability of the transgenic T cells to traffic to the patients’ tumours.

  Study EGAS00001006898

• Genome-Wide Association Study of Breast Cancer in the African Diaspora - the ROOT study

  The paucity of data on the genetic epidemiology of breast cancer for racial/ethnic groups other than those of European ancestry hinders the development of innovative interventions to reduce health disparities. Women in the African Diaspora experience a disproportionate burden of pre-menopausal breast cancer in comparison to all other races for reasons that remain unknown and understudied. This higher proportion of early-onset breast cancer might suggest a stronger genetic component in these populations. Genome-wide association studies (GWAS) have revealed several genetic loci that confer risk of breast cancer. Because all GWAS started the discovery stage in women of European ancestry and replicated mainly in women of European ancestry, we propose a novel approach for a GWAS in indigenous African women to identify alleles associated with breast cancer risk which will then be replicated in other populations. This innovative design builds on our current understanding of the etiologic heterogeneity in breast cancer and the distribution of breast cancer molecular subtypes which differ between women of African ancestry and women of European ancestry. The major objective of the proposed studies is to get to the "root" causes of breast cancer by identifying breast cancer risk alleles in a pooled sample of women of African ancestry and to replicate our findings in other populations. To achieve this objective, we conducted a case control study of breast cancer in women of African ancestry, including Africans living in Nigeria, African Americans and African Barbadians. We will genotype ~3800 individuals using the Illumina HumanOmni2.5-Quad platform. We will conduct both standard and novel genetic analyses of the data to map genes associated with breast cancer susceptibility, verify genotyping and carry out fine-mapping studies in genes or regions showing association with breast cancer risk, and replicate in other African American and non-African American populations. By pooling unique resources from studies throughout the African Diaspora, this study has the potential to identify risk alleles in several genes that contribute to increased breast cancer risk and may have implications for early detection, prognosis and treatment of breast cancer in ALL women. This should ultimately lead to improved outcomes for those who suffer a disproportionate burden of early-onset breast cancer.

  Study phs000383

• Foregut Microbiome in Development of Esophageal Adenocarcinoma

  The distal esophagus is an important anatomical area where gastric acid reflux can cause reflux esophagitis (RE), Barrett's esophagus (BE) (intestinal metaplasia), and esophageal adenocarcinoma (EA). The incidence of EA has increased 6-fold in the U.S. since the 1970s, parallel to a significant increase in the prevalence of gastroesophageal reflux diseases (GERD). Although specific host factors might predispose one to disease risk, such a rapid increase in incidence must be predominantly environmental. The cause remains unknown. Our hypothesis is that changes in the foregut microbiome are associated with EA and its precursors, RE and BE in the GERD sequence. We will conduct a case control study to characterize the microbiome in every stage of the GERD sequence as well as analyze the trend in changes in the microbiome along disease progression toward EA. Specific Aim 1. To conduct a comprehensive population survey of the foregut microbiome and demonstrate its association with GERD sequence, by a 16S rRNA gene survey. We will analyze samples of the foregut microbiome at three anatomic loci: mouth, distal esophagus, and gastric corpus. Changes of the microbiota in the distal esophagus will be correlated with the phenotypes. Spatial relationship between the esophageal microbiota and upstream (mouth) and downstream (stomach) foregut microbiotas as well as temporal stability of the microbiome-disease association will also be examined. Specific Aim 2. To define distal esophageal metagenome and demonstrate its association with GERD sequence, by shotgun metagenomic analysis. We will first classify samples of the metagenome into metagenotypes by between-sample k-mer distance and correlate the metagenotypes with the four phenotypes. Subsequent detailed analyses will include pathway-disease and gene-disease associations. DNA viruses and fungi, if identified, also will be correlated with the phenotypes. A significant association between the foregut microbiome composition and GERD sequence, if demonstrated, will be the first step for eventually testing the causal hypothesis that an abnormal microbiome is required for the development of the sequence of phenotypic changes toward EA. If EA and its precursors represent a microbial ecological disease, treating the cause of GERD might become possible, for example, by normalizing the microbiome through use of antibiotics, probiotics, or prebiotics. Causative therapy for GERD could prevent its progression and reverse the current trend of increasing incidence of EA.

  Study phs000260

• Kids First: The Genomic Basis of Structural Birth Defects Associated with Chromosome 18 Copy Number Changes

  Chromosome abnormalities are a common cause of structural birth defects. Both childhood cancers and structural birth defects are critical and costly conditions associated with substantial morbidity and mortality. Elucidating the underlying genetic etiology of these diseases has the potential to profoundly improve preventative measures, diagnostics, and therapeutic interventions.However, because these genomic copy number changes involve multiple genes and because most of these conditions are individually rare, defining the specific causative genes behind specific phenotypes has been a challenge. We met that challenge by spending the last 28 years enrolling and evaluating anyone with a chromosome 18 abnormality. The cohort now includes over 700 individuals with a wide variety of chromosome 18 copy number changes (CNV), as well as their parents. Because the vast majority of these participants have individually unique CNVs, we have been able to perform extensive genotype-phenotype correlations resulting in 58 publications. Of the 263 genes on chromosome 18, 28 are linked to specific hemizygous phenotypes. However, most have low penetrance. Genomic sequence data could identify variants in the extant allele that are hypermorphic and compensate for hemizygosity, or are hypomorphic and exacerbate hemizygosity. Additionally, there are phenotypes within this cohort that are rare, or an extreme version of one of the more common phenotypes. Genomic sequence data could help discover new biallelic conditions by revealing functional sequence variants of the extant allele. In both of these cases, there could also be variants in other genes on other chromosomes that may be associated with the phenotype that confer susceptibility or resilience. Inclusion of this unique cohort in the Gabriella Miller Kids First Pediatric Research Program can advance the goals of the program in several ways. First, by adding known susceptibility loci to the existing Kids First cohorts for the structural birth defects that are also found in our cohort. Second, for those structural birth defects known to be polygenetic, this cohort has a single defined risk factor which can simplify the search for secondary factors. Third, these studies can also bring clarity to people with chromosome 18 conditions and help to make the genotype more accurately predict phenotype. This approach could be a model for understanding the many other rare chromosome abnormalities which collectively are a common cause of structural birth defects.

  Study phs002627

• Immune-Related Adverse Events after Immune Checkpoint Blockade-Based Therapy are Associated with Improved Survival in Advanced Sarcoma

  Immune activation after immune checkpoint blockade (ICB) can lead to a unique group of adverse events (AEs), which have been associated with improved outcome in many carcinomas. The association between immune-related AEs (irAEs) and outcome in patients with sarcoma is not well studied. This study has two components: (1) a retrospective clinical study of irAEs among 131 patients treated with ICB at Memorial Sloan Kettering Cancer Center and (2) an analysis of a subset of these patients who have whole transcriptome sequencing available for analysis. In the clinical study portion, we reviewed a cohort of patients with advanced sarcoma treated on prospective clinical trials utilizing ICB-based therapy between April 2017 and January 2020. The objectives were to pool the safety data from each trial, identify irAEs, and correlate them with best overall response by RECIST 1.1, progression-free survival (PFS) and overall survival (OS). Association of irAEs with response and survival was assessed using a Cox regression model. A total of 131 patients were included. Forty-two (32%) had at least one irAE of any grade and 16 (12%) had at least one Grade ≥ 3 irAE. On Cox analysis adjusting for clinical covariates that were significant in the univariate setting, the hazard ratio (HR) for an irAE (HR 0.662, 95% CI 0.421 - 1.041) approached, but did not reach statistical significance for PFS (P = 0.074), while patients had a significantly lower HR for OS (HR 0.443, 95% CI 0.246 – 0.798; P = 0.007) compared to those without or before an irAE. Tumor samples with available RNA sequencing data were stratified by presence of an irAE to identify patterns of differential gene expression. In total, 71 unique patients had RNA sequencing available for analysis. The transcriptomes of 31 of these patients have been previously uploaded to dbGaP (phs002852), leaving 36 unique transcriptomes that have not been previously publicly shared. Three patients did not agree for their sequencing to be publicly shared. Therefore, 33 unique patient samples will be uploaded to this dbGaP study. Overall, this study found that gene expression profiling on baseline tumor samples from patients who had an irAE had higher numbers of tumor-infiltrating dendritic cells, CD8+ T cells, and regulatory T cells as well as upregulation of immune and inflammatory pathways.

  Study phs003284

• Whole Blood Transcriptomics of Patients With Melioidosis

  Melioidosis is a neglected tropical infection caused by the Gram negative bacterium Burkholderia pseudomallei that is associated with high mortality rates in southeast Asia. The goal of this study was to a) identify human blood leukocyte transcriptomic features and pathways specific to melioidosis (vs other etiologies of infection), b) identify transcriptomic features and pathways specific to fatal melioidosis, and c) identify transcriptomic predictors of death in patients with melioidosis. This study used clinical data and whole blood leukocyte samples from a subset of participants in the Ubon Sepsis Study, a prospective single-center cohort study conducted at Sunpasitthiprasong Hospital, Ubon Ratchathani, Thailand between 2013 and 2017. Participants in the Ubon Sepsis Study had suspected or documented infection with accompanying systemic manifestations of infection and were enrolled, with blood sampling, within 24 hours of admission to the study hospital. Enrolled patients were followed over time and vital status was determined at 28 days after enrollment. The subset of participants from the parent Ubon Sepsis Study cohort selected for this study was comprised of 164 patients with melioidosis (defined as having a culture of clinical sample positive for B. pseudomallei), 35 patients with Gram negative bacteremia due to either Escherichia coli or Klebsiella pneumoniae, 16 patients with Gram positive bacteremia due to Staphylococcus aureus, and 19 patients who had negative blood cultures and no clinical sample culture-positive for B. pseudomallei. Fifty uninfected control patients with or without diabetes were recruited from the outpatient department and blood donation center at Udon Thani hospital, Udon Thani, Thailand from 2018 to 2019. Blood was collected at the time of enrollment in Tempus Blood RNA tubes. RNA was extracted using the Tempus Spin RNA Isolation kit. RNA sequencing (RNA-Seq) was performed at the University of Washington Northwest Genomics Center. Analysis was performed using a variety of statistical methods. The main finding of the study was that the transcriptomes of melioidosis patients, compared to patients with other infections, were characterized by upregulation of interferon signaling. The transcriptomes of patients with fatal melioidosis were notable for upregulation of inflammatory and type 2 immune responses and downregulation of genes related to T-cell function. A five-gene (EPHB1, SYCP2L, MERTK, IL5RA, and SPOCK1) predictive signature for death in melioidosis was developed.

  Study phs003724

• Kids First: Genetics of Pediatric Germ Cell Tumors

  The Gabriella Miller Kids First Pediatric Research Program (Kids First) is a trans-NIH effort initiated in response to the 2014 Gabriella Miller Kids First Research Act and supported by the NIH Common Fund. This program focuses on gene discovery in pediatric cancers and structural birth defects and the development of the Gabriella Miller Kids First Pediatric Data Resource (Kids First Data Resource). All of the genomic and phenotypic data from this study are accessible through dbGaP. The data is also available at the Kids First Portal, where other Kids First datasets can also be accessed in the cloud for data analysis, data visualization, collaboration and interoperability, open to all researchers and developers.Pediatric malignant germ cell tumors (GCTs) represent approximately 6% of childhood cancers, including 3% of tumors in children aged 0-14 years and 15% of tumors in adolescents. GCTs are heterogeneous and grouped together due to the presumed common cell of origin, the primordial germ cell (PGC). GCTs typically occur in the testes or ovaries; however, extragonadal GCTs can occur and are likely a result of abnormal germ cell migration during development. Evidence suggests that GCTs, including those diagnosed in adults, are initiated in utero. Thus, alterations in normal embryonic development are likely to be especially relevant to GCT etiology. Germline susceptibility has not been evaluated in an agnostic fashion in pediatric GCT, mainly due to a lack of an adequate number of samples; however, emerging evidence supports a genetic etiology.In the two Kids First GCT projects, we will evaluate genetic susceptibility to intracranial and extracranial GCT by sequencing probands and their unaffected parents. The goals of the project are to: 1) evaluate the contribution of rare genetic variants in GCT through the use of aggregate burden tests, focusing on genes and established regulatory regions; 2) identify de novo SNVs and CNVs in pediatric GCT using a case-parent triad design; and 3) identify molecular signatures in GCT tumor specimens, overall and by age group and tumor characteristics. Whole Genome Sequencing (WGS) data generated through the Gabriella Miller Kids First Pediatric Research Program will provide an opportunity to investigate the genetic origins of GCT in a diverse set of samples. Given the limited knowledge of GCT etiology and biology, the results of the proposed analyses are likely to have a big impact on the field.

  Study phs002322

• Sensitive and robust liquid biopsy-based detection of PIK3CA mutations

  Over the last years, the treatment of hormone receptor-positive metastatic breast cancer patients has dramatically changed. Combination strategies attempting to overcome resistance to endocrine therapy such as targeting the PI3 kinase pathway are gaining importance. The phase III SOLAR-1 trial demonstrated the benefit of the addition of alpelisib to fulvestrant, thereby providing further clinical evidence of the increasing importance of PIK3CA testing. Here, we performed a comparison of liquid biopsy and tissue-based detection of PIK3CA mutations in HR-positive metastatic breast cancer patients. Plasma samples and the latest available tumor tissue from 69 patients with metastatic hormone-receptor positive breast cancer were analyzed for PIK3CA hotspot mutations. A high-resolution NGS assay (SiMSen-Seq) was used for plasma samples covering 11 recurrent PIK3CA mutations, used for stratification in SOLAR-1. Additionally, mFAST-SeqS was used to estimate the tumor fractions in the plasma samples. For tumor tissue samples, targeted Ion Torrent NGS was employed. Matched tissue and plasma samples were available from 63 patients. PIK3CA mutations were detected in 46.1% of the tissue samples and in 50.7% of the plasma samples. The variant allele frequency (VAF) ranged from 4.36% to 72.93% with a median of 28.60% in tissue samples, and from 0.28% to 49.85% with a median of 1.17% in plasma samples. The most frequent variants in tissue and plasma were H1047R, E545K, and E542K. We detected at least one of 11 PIK3CA mutations from the SOLAR-1 trial in 51/63 patients, both in tissue and plasma. In 7 patients, such mutations were found only in plasma. In 5 patients, PIK3CA mutations found in tissue were not detectable in ctDNA, 2 of which had a low tumor fraction.Together, in 33/67 plasma samples without detectable PIK3CA mutations, 18 samples had elevated tumor fraction, implicating true negative results. In the remaining 15 patients with low tumor fraction, additional tissue analysis was needed. SiMSen-Seq-based detection of PIK3CA mutations in plasma shows advantageous concordance with the tissue analyses. A combination with an untargeted, mutation-independent approach for detecting ctDNA fractions may confirm a negative PIK3CA result and thereby enhance the performance of the SiMSen-Seq test. This combinatory approach for selecting suitable patients for alpelisib treatment should be validated in larger patient cohorts.

  Study EGAS00001004940

• Molecular_characterization_of_invasive_lobular_carcinoma

  Invasive lobular carcinoma (ILC) is the second most common histological subtype of breast cancer accounting for 10-15% of cases. ILC differs from invasive ductal carcinoma (IDC)with respect to epidemiology, histology, and clinical presentation. Moreover, ILC is lesssensitive to chemotherapy, more frequently bilateral, and more prone to form gastrointestinal, peritoneal, and ovarian metastases than IDCs. In contrast to IDC, the prognostic value ofhistological grade (HG) in ILC is controversial. One of the three major components of histological grading (tubule formation) is missing in ILC which hinders the process of gradingin this histological subtype and results in the classification of approximately two thirds of ILC as HG 2.Over the last decade, a number of gene expression signatures have shed light onto breast cancer classification, allowing breast cancer care to become more personalized. Withrespect to the management of estrogen receptor (ER)-positive breast cancer, several gene expression signatures provide prognostic and/or predictive information beyond what is possible with current classical clinico-pathological parameters alone. Nevertheless, most studies using gene expression signature have not considered different histologic subtypesseparately. Recently, a comprehensive research program has elucidated some of the biological underpinnings of invasive lobular carcinoma. Genetic material extracted from 200 ILC tumor samples were studied using gene expression profiling and identified ILCmolecular subtypes. These proliferation-driven gene signatures of ILC appear to have prognostic significance. In particular, the Genomic Grade (GG) gene signature improved upon HG in ILC and added prognostic value to classic clinico-pathologic factors. In addition this study demonstrated that most ILC are molecularly characterized as luminal-A (~75%)followed by luminal-B (~20%) and HER2-positve tumors (~5%). Moreover, we investigated the prognostic value of known gene signatures/ gene modules in the same cohort of ILC. As a second step within the scope of this project, we aim to investigate the interactionsbetween somatic ILC tumor mutations to observed transcriptome findings. To this end, we aim to perform somatic mutation analysis for the ILC tumors for which Affymetrix gene expression profiling is available. To this end, we will use a gene screen assay, which specifically interrogates the mutational status of a few hundreds of cancer genes. We believe that this pioneering effort will be fundamental for a tailored treatment of ILC withimprovement in patients' outcome.

  Study EGAS00001000292

• Multi-omics data of 1000 Inflammatory Bowel Disease patients

  Portal available at https://1000ibd.org Inflammatory bowel disease (IBD) is a chronic complex disease of the gastrointestinal (GI) tract. Patients with IBD can experience a wide range of symptoms, but the pathophysiological mechanisms that cause these individual differences in clinical presentation remain largely unknown. In consequence, IBD is currently classified into subtypes using clinical characteristics. If we are to develop a more targeted treatment approach, molecular subtypes of IBD need to be discovered that can be used as new drug targets. To achieve this, we need multiple layers of molecular data are generated from the same IBD patients.We initiated the 1000IBD project to prospectively follow more than 1000 IBD patients from the Northern provinces of the Netherlands. For these patients, we have collected a uniquely large number of phenotypes and generated multi-omics profiles. To date, 1,215 participants have been enrolled in the project and enrolment is on-going, with 609 patients being present in the first data release. Phenotype data collected for these participants includes information on dietary and environmental factors, drug responses, and adverse drug events. Genome information has been generated using genotyping (ImmunoChip, Global Screening Array and HumanExomeChip) and sequencing (whole exome sequencing and targeted resequencing of IBD susceptibility loci), transcriptome information generated using RNA-sequencing of intestinal biopsies and microbiome information generated using both sequencing of the 16S rRNA gene and whole genome shotgun metagenomic sequencing.All molecular data generated within the 1000IBD project will be shared in multiple data on the European Genome-Phenome Archive (www.ega-archive.org). The first data release, will contain basic phenotypes for 609 participants, genotypes of 314 participants, gut microbiome data generated by tag sequencing the 16S gene of feces from 315 participants and intestinal biopsies from 107 participants, and gut microbiome metagenomic sequencing of feces of 355 participants . Future releases will comprise many more additional phenotypes and -omics data layers. 1000IBD data can be used by other researchers as a replication cohort, a dataset to test new software tools, or a dataset for applying new statistical models.

  Study EGAS00001002702

• Defective Homologous Recombination DNA Repair as Therapeutic Target in Advanced-Stage Chordoma (HIPO_021)

  HIPO project: HIPO_021 Importance: Chordomas are rare tumors of the axial skeleton and skull base with few therapeutic options and no clinically validated molecular drug targets. The value of comprehensive genomic analyses for guiding medical therapy of patients with advanced-stage chordoma is unknown.Objective: To identify therapeutically tractable genetic lesions in a cohort of chordoma patients within a genomics-guided precision oncology program and to document the outcome of individualized, molecularly targeted chordoma therapy.Design, Setting, and Participants: We performed whole-exome sequencing of tumor and matched germline control samples from seven patients with locally advanced or metastatic chordoma who were enrolled in a cross-institutional molecular stratification registry trial for younger adults with advanced-stage cancer across all histologies and patients with rare tumors. All patients were heavily pretreated and had progressive disease prior to molecular analysis.Interventions: Individualized medical therapy was administered according to the patients’ molecular profiles.Main Outcomes and Measures: Candidate therapeutic targets identified by whole-exome sequencing and response to genotype-directed therapy.Results: All patients harbored alterations of two or more genes known to be involved in DNA repair via homologous recombination (HR), including heterozygous deletions of ERCC6, FANC family members, RAD51L (n = 6), BRCA2 (n = 5), ATR, CHEK2, RAD18, RAD51B, and XRCC3 (n = 4); inactivating PTEN mutations coupled with loss of heterozygosity (n = 2); and pathogenic germline variants in BRCA2 (n = 1), NBN (n = 1), and CHEK2 (n = 1) that were accompanied by somatic deletion of the corresponding wild-type alleles. Consistently, a mutational signature associated with defective HR was enriched in all samples and co-occurred with extensive genomic instability, as evidenced by HR deficiency scores and high numbers of large-scale state transitions. These results prompted off-label treatment with the poly(ADP-ribose) polymerase (PARP) inhibitor olaparib in a patient whose tumor was refractory to irradiation and systemic treatment with imatinib, which led to a prolonged response and substantial clinical improvement.Conclusions and Relevance: Advanced-stage chordomas are frequently characterized by genomic imprints of defective HR DNA repair. HR deficiency represents a new therapeutic opportunity in this intractable disease through repositioning of PARP inhibitors that warrants further exploration in clinical trials.

  Study EGAS00001002720

• CRCbiome: Gut metagenome of Norwegian screening participants using FIT sampling

  The study aims to characterize the gut metagenome of Norwegian screening participants and assess the ability of the gut metagenome to identify those at need for colonoscopy. Background: Colorectal cancer (CRC) screening reduces CRC incidence and mortality. However, current screening methods are either hampered by invasiveness or suboptimal performance, limiting their effectiveness as primary screening methods. To aid in the development of a non-invasive screening test with improved sensitivity and specificity, we have initiated a prospective biomarker study (CRCbiome), nested within a large randomized CRC screening trial in Norway. We aim to develop a microbiome-based classification algorithm to identify advanced colorectal lesions in screening participants testing positive for an immunochemical fecal occult blood test (FIT). We will also examine interactions with host factors, diet, lifestyle and prescription drugs. The prospective nature of the study also enables the analysis of changes in the gut microbiome following the removal of precancerous lesions. Methods: The CRCbiome study recruits participants enrolled in the Bowel Cancer Screening in Norway (BCSN) study, a randomized trial initiated in 2012 comparing once-only sigmoidoscopy to repeated biennial FIT, where women and men aged 50–74 years at study entry are invited to participate. Since 2017, participants randomized to FIT screening with a positive test result have been invited to join the CRCbiome study. Self-reported diet, lifestyle and demographic data are collected prior to colonoscopy after the positive FIT-test (baseline). Screening data, including colonoscopy findings are obtained from the BCSN database. Fecal samples for gut microbiome analyses are collected both before and 2 and 12 months after colonoscopy. Samples are analyzed using metagenome sequencing, with taxonomy profiles, and gene and pathway content as primary measures. CRCbiome data will also be linked to national registries to obtain information on prescription histories and cancer relevant outcomes occurring during the 10 year follow-up period. Discussion: The CRCbiome study will increase our understanding of how the gut microbiome, in combination with lifestyle and environmental factors, influences the early stages of colorectal carcinogenesis. This knowledge will be crucial to develop microbiome-based screening tools for CRC. By evaluating biomarker performance in a screening setting, using samples from the target population, the generalizability of the findings to future screening cohorts is likely to be high.

  Study EGAS50000000170

• Center for Craniofacial and Dental Genetics (CCDG): Genetics of Orofacial Clefts and Related Phenotypes

  The purpose of this study is to investigate the genetics of orofacial clefts (OFCs) in a large study population, and importantly, to incorporate subclinical phenotypic features into these studies. Orofacial clefts (OFCs) comprise a significant fraction of human birth defects (about 1/700 live births (Rahimov et al. 2012) and represent a major public health challenge, as individuals with these anomalies require surgical, nutritional, dental, speech, medical and behavioral interventions, thus imposing a substantial economic and personal burden (Berk and Marazita 2002*). The most common forms include OFCs of the lip alone (CL, Figure 1A), CL plus cleft palate (CL+CP, Figure 1B) or of the palate only (CP, Figure 1C). Individuals born with OFC may have their first surgical repair at age 3 months, but this initial surgery is just the beginning of a lifetime of health burdens. An individual born with an OFC has a hospital use rate increased for most ages (up to 233% increase for children ages 0-10 years and 16% for middle aged adults (Wehby et al. 2012). Healthcare costs for children with OFCs are estimated to be 800% greater compared with their unaffected peers (Boulet et al. 2009). Data from Denmark show that people born with CL with or without CP (CL/P) have an increased mortality up to age 55, which may be attributed to an increased risk of suicide and/or certain cancers (Christensen et al. 2004). The focus of most OFC genetic research has been CL and/or CP. Furthermore, the majority of OFC, i.e. about 70% of CL/P and 50% of CP is considered "nonsyndromic" (Jones 1988), i.e. isolated anomalies with no other apparent cognitive or structural abnormalities. Figure 1 Sample OFC Types A: Bilateral Cleft Lip; B:Cleft Lip plus Cleft Palate; C:Cleft Palate Alone The factors leading to the majority of nonsyndromic OFCs are still unclear, particularly at an individual family level. As is true for many complex traits, substantial progress in gene identification has occurred in the OFC field in the last two years (Dixon et al. 2011; Marazita 2012). Genome Wide Association Studies (GWAS) and sequencing studies to date by our research team and others have focused on genetic risk factors for overt CL/P and CPO-and have been very successful. A major finding from this work is that OFCs exhibit significant genetic heterogeneity, i.e., multiple genetic regions have been implicated (Beaty et al. 2010; Ludwig et al. 2012). Thus, approaches are needed to understand this genetic heterogeneity. Are there GxG interactions at work? Are there subsets of families, each due to a different gene? Our research group has shown that a promising approach to dissect the etiology of OFC is to focus on subclinical phenotypic features within entire cleft families (not just in affected cases, but also in their non-cleft relatives). These subtle features are believed to represent mild manifestations of the same underlying genetic susceptibility responsible for OFCs; as such, their inclusion in case-control and family-based genetic studies can help to clarify and refine the relationship between genotype and phenotype. The study population comprises a large number of families and individuals (~12,000 individuals) from multiple populations worldwide (Caucasians from the US and Europe, Asians from China and the Philippines, Mixed Native American/Caucasians from South America, and Africans from Nigeria and Ethiopia). There are cases, case families (nuclear families and extended kindreds), as well as controls with no history of OFC nor other developmental defects. *Berk NW, Marazita ML (2002) Costs of Cleft lip and Palate: Personal and Societal Implications. In: Wyszynski DF (ed) Cleft Lip and Palate: From Origin to Treatment. Oxford University Press, Inc., New York, pp 458-467.

  Study phs000774

• Study of Melanoma Risk in Australia and the United Kingdom

  The results from a small number of melanoma GWAS have been published. Initial studies identified several pigmentation- and nevus-associated loci that mediate an effect on melanoma risk, however, these studies were somewhat limited in that sample number (hence power) was low, they used first-generation low density SNP arrays, or used pools of DNA samples. Subsequently, additional melanoma GWAS have been completed, including a "Phase 2" study by the International Melanoma Genetics Consortium (GenoMEL), a full GWAS of the Australian sample resource previously used in a pooled-DNA GWAS, and study conducted through the MD Anderson Cancer Center and the Brigham and Women's Hospital. The groups who performed these studies have recently shared data and replicated a number of new melanoma susceptibility loci. Aside from the identification of novel loci, there are two additional notable outcomes of these studies. Firstly, an examination of the observed versus expected test statistics (Q-Q plot) from the Australian study, even after removing data from SNPs within known replicated susceptibility loci, reveals that there remains an excess of positive results. Similarly, the latest GenoMEL study finds almost three times as many SNPs reaching p-values between 10-4 and 10-5 as would be expected by chance. In the light of other studies of complex traits [1], these data suggest that studies based on additional melanoma samples from the same population are likely to identify an even larger "polygenic tail" and should prove invaluable in identifying and characterizing the underlying loci. A second observation, is that the effect size for replicated associations differs very little between GWAS. Given the strong effect of ultraviolet radiation (UVR) on risk of melanoma this might be expected to affect penetrance, particularly in the Australian and English samples, which are ethnically similar, but have very different sun exposures. We hypothesize that those SNPs whose effects are strongly mediated by UVR exposure may have smaller marginal effects on risk and are therefore harder to detect initially, suggesting a whole category of genetic effects that are unexplored.Indeed, most melanoma GWAS performed to date used samples from both European and Australian populations in discovery and or replication, and thus, existing studies have been poorly powered to detect associations with a wide difference in effect between these low- and high-UVR populations. Here, we wish to pursue this hypothesis further and plan to genotype additional cases drawn from the English and Australian populations. This will serve two complementary objectives: firstly, it will greatly increase our collective power to detect additional new melanoma risk alleles; secondly, it will highlight associations that are stronger specifically within the context of either low-UVR or high-UVR exposure environments. We posit that these data will be invaluable, not just for identifying novel melanoma-associated loci, but also for addressing gene-environment interactions. We have available a collection of valuable resources to help fulfill our aims. These include a considerable number of well-characterized and ungenotyped Australian and UK melanoma cases, as well as existing genotype data from sets of Australian and UK cases and population-based controls. We propose the following Specific Aims: To extend our current collective melanoma GWAS by genotyping a large number of additional UK and Australian cases. To jointly analyze these data and identify new melanoma risk loci. To determine whether pre-existing and new melanoma risk alleles show different degrees of association between the English and Australian populations, and assess whether these differences might be due to differences in sunlight exposure.

  Study phs000519

• A Genomic Atlas of Systemic Interindividual Epigenetic Variation in Humans (GTEx)

  Methylation of cytosines in CpG dinucleotides is an epigenetic mechanism with essential roles in mammalian development. To explore its functions in cellular differentiation, unbiased analysis of CpG methylation by whole genome bisulfite sequencing (WGBS) has been used to characterize epigenetic differences among different human tissues and cell types. Meanwhile, human interindividual variation in DNA methylation that is not cell-type specific has attracted relatively little attention. Systemic interindividual epigenetic variation is important, however, because like genetic variation it is a potential determinant of phenotypic variation and can be assessed in any easily obtainable DNA sample. Since systemic epigenetic variants originate in the preimplantation embryo, their establishment can be influenced by periconceptional environment, and potentially provide information about lifetime risks relevant to global health, obesity, and cancer. We elucidated systemic interindividual variation in CpG methylation in the human genome. We studied brain, heart, and thyroid tissues (representing all three germ layer lineages) from each of 10 donors in the NIH Gene-Tissue Expression (GTEx) project. We performed deep whole genome bisulfite sequencing for these 30 samples, achieving a sequencing depth of over 50x coverage per sample. We identified 9,926 correlated regions of systemic interindividual variation (CoRSIVs). These regions, comprising just 0.1% of the human genome, often correlate with one another over long genomic distances, are associated with transposable elements and subtelomeric regions, conserved across various human ethnic groups, and particularly sensitive to periconceptional environment. While genetic variation appears to influence methylation at most CoRSIVs, many show no evidence of genetic influence, suggestive of 'pure' epigenetic variation. At CoRSIVs, interindividual variation in DNA methylation in an easily biopsied tissue predicts expression in other tissues, and genes associated with these loci are implicated in a range of human disorders. In addition to charting a previously unrecognized molecular level of human individuality, this atlas of human CoRSIVs provides a resource for future population-based investigations into how interindividual epigenetic variation modulates risk of disease.Version 2 now also includes Target Capture Sequencing of CoRSIVs in 808 tissues (188 GTEx Donors). Focusing on the CoRSIVs identified by analyzing WGBS data, a Target Capture Bisulfite sequencing assay was developed. Using the genotype data of 188 GTEx donors, we assessed mQTL by capturing a 1MB region at each CoRSIV and quantifying methylation by Bisulfite-seq. The Target Capture Bisulfite sequencing data will be available to download via the AnVIL project.

  Study phs001746

• All you need to know about our new DAC Portal v2

  An updated version to boost the management of DACs (Data Access Committees), policies, and data access requests. In September of 2023, we launched new services for all EGA users, including a DAC Portal. Since then, our team has been working to refine it and improve the user experience. The version 2 of our DAC Portal is now ready, with a range of new features aimed at streamlining your workflow and boosting productivity. If you are interested in learning more about the latest version of our DAC Portal, then you are in the right place! In this post, you will find information about the implemented features and more. The full documentation is available on our website. Moreover, we highly recommend exploring the DAC Portal through the Take the Tour. This said, let's get cracking! Customise your data access requests table This table offers the possibility to tailor information about the data access requests by making visible or hiding different columns regarding the Dataset Persistent Identifier, the Organisation or the requestor's name s, among others. You can choose which columns to see, depending on your needs and interests. Additionally, we have implemented two new features columns with two new functionalities, DAC Comment and Expiration Date. You can find more details in the following sections! In this table, all data access requests are displayed by default. With the latest version of the Portal, you can now apply filters, combine them, and save them for future use. Leave internal comments on pending requests and visible to all the DAC Members We understand that many Data Access Committees (DACs) cannot instantly approve or deny data access requests. Often, there's an intermediary phase where discussions and the signing of legal documents are necessary. To facilitate this process, we've introduced the DAC comment feature! When you navigate to the DAC column, you'll find two tabs: "User" and "DAC". Under "User", you'll see the message provided by the requester at the time of requesting access to the data. As a DAC member/admin, you can then add an internal comment in the "DAC" tab. These comments are visible only to DAC members/admins, ensuring confidentiality. Requesters won't have access to DAC comments. By adding a DAC comment to a pending request, we'll know that you've begun reviewing it. This allows you to filter pending requests without DAC comments to focus on genuinely new requests, and it prevents you from receiving email notifications about ongoing data requests. Set expiration dates for permissions and revoke them automatically The latest update to the DAC Portal introduces a new feature allowing you to set expiration dates for new access requests. For instance, if you anticipate approving a data access request but only wish to grant access for a limited time, you can now specify an expiration date for the granted permissions. Once this date is reached, the permissions will automatically be revoked. By default, permissions are granted indefinitely without an expiration date. However, if you ever need to revoke permissions, you can easily do so from the History page. Audit your metadata objects Managing and auditing your metadata objects will be easier from now on as the new DAC Portal enhances and facilitates your role as a Data Controller. This is possible thanks to the tables available in each of the primary tabs visible on the homepage: DACs, Policies and Datasets. Starting with DACs, this section allows to check the policies linked to a specific DAC. In Policies, you can obtain a list of the datasets connected to a particular policy. In the Dataset tab, it is possible to group datasets by either DAC or Policy, as well as the release status. Now you have the option of deprecating metadata objects that you don’t want to use anymore, or that were created by mistake. You will find the deprecate button on the EDIT page of the DAC, as well as for registered policies. You can find more information here. What's neat about this feature is that once a DAC or policy is deprecated, it becomes hidden within the DAC Portal. This ensures that you only see information that is consistently up to date! Define your preferences regarding email notifications For pending requests, you will be able to decide how often you want to get the notifications: daily, weekly or fortnightly. Remember, you will not receive email notifications for pending requests with a DAC comment! Furthermore, you have the flexibility to decide which notifications you wish to receive, such as invitations to join a new DAC or notifications regarding DAC acceptance by the Helpdesk, among other options. Check the User preference to see the complete list of available notification settings! What’s next: incoming DAC Portal API In addition to the new DAC Portal, we are excited to announce the release of the DAC API! This enables users to programmatically manage permissions. If you are interested in learning more about the technical specifications, you can consult the DAC API specification. This post was written by Aina Jené and Ana T. Alonso.

  Blog new-dac-portal-v2

• MediMer: A versatile do-it-yourself peptide-receptive MHC class I multimer platform for tumor neoantigen-specific T cell detection

  Peptide-loaded MHC class I (pMHC-I) multimers have revolutionized our capabilities to monitor disease-associated T cell responses with high sensitivity and specificity. To improve the discovery of T cell receptors (TCR) targeting neoantigens of individual tumor patients with recombinant MHC molecules, we developed a peptide-loadable MHC class I platform termed MediMer. MediMers are based on soluble disulfide-stabilized β2-microglobulin/heavy chain ectodomain single-chain dimers (dsSCD) that can be easily produced in large quantities in eukaryotic cells and tailored to individual patients’ HLA allotypes with only little hands-on time. Upon transient expression in CHO-S cells together with ER-targeted BirA biotin ligase, biotinylated dsSCD are purified from the cell supernatant and are ready to use. We show that CHO-produced dsSCD are free of endogenous peptide ligands. Empty dsSCD from more than 30 different HLA-A,B,C allotypes, that were produced and validated so far, can be loaded with synthetic peptides matching the known binding criteria of the respective allotypes, and stored at low temperature without loss of binding activity. We demonstrate the usability of peptide-loaded dsSCD multimers for the detection of human antigen-specific T cells with comparable sensitivities as multimers generated with peptide-tethered β2m-HLA heavy chain single-chain trimers (SCT) and wild-type peptide-MHC-I complexes prior formed in small-scale refolding reactions. Using allotype-specific, fluorophore-labeled competitor peptides, we present a novel dsSCD-based peptide binding assay capable of interrogating large libraries of in silico predicted neoepitope peptides by flow cytometry in a high-throughput and rapid format. We discovered rare T cell populations with specificity for tumor neoepitopes and epitopes from shared tumor-associated antigens in peripheral blood of a melanoma patient including a so far unreported HLA-C*08:02-restricted NY-ESO-1-specific CD8+ T cell population. Two representative TCR of this T cell population, which could be of potential value for a broader spectrum of patients, were identified by dsSCD-guided single-cell sequencing and were validated by cognate pMHC-I multimer staining and functional responses to autologous peptide-pulsed antigen presenting cells. By deploying the novel CHO producer cell-based dsSCD MHC-I MediMer platform, we hope to significantly improve success rates for the discovery of personalized neoepitope- specific TCR in the future by being able to also cover rare HLA allotypes.

  Study EGAS50000000065

• Prevention and Early Treatment of Acute Lung Injury (PETAL) - Low Tidal Volume Universal Support Feasibility of Recruitment for Interventional Trial (LOTUS FRUIT) (PETAL-LOTUS FRUIT-BioLINCC)

  Data Access NOTE: Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives: The two main goals of PETAL-LOTUS FRUIT were to conduct a prospective, observational study within all PETAL Network sites to determine the frequency of and outcomes from acute respiratory failure and the current usual care for tidal volume ventilation in patients with and without acute respiratory distress syndrome (ARDS), and to simulate the design and power of the proposed LOTUS trial. Background: A previous study demonstrated improved survival among patients with ARDS receiving tidal volume (Vt) targeted to 6 ml/kg of predicted body weight (PBW). As a result, low–tidal volume ventilation (LTVV) is now recommended for all patients with ARDS, although penetration of this evidence-based practice has been limited, especially early in mechanical ventilation. LTVV may also benefit patients without ARDS. Consequently, there has been increasing call to apply LTVV for all patients with acute respiratory failure upon initiation of mechanical ventilation. The PETAL Network considered performing a pragmatic stepped-wedge, cluster-randomized, controlled, hybrid implementation trial to examine systematic implementation of a default 6 ml/kg PBW LTVV strategy in patients with acute respiratory failure requiring intubation to improve adherence to LTVV and decrease mortality in acute respiratory failure. Trial planning may be better estimated by simulation than routine, simplistic calculations, but such simulations require detailed data of initial parameters. Participants: 2848 patients from 49 hospitals were enrolled. Enrollment varied by hospital, ranging from 4 to 100 patients, the maximum enrollment allowed per site. Design: PETAL-LOTUS FRUIT was a multicenter, prospective, observational cohort study of patients with acute respiratory failure on mechanical ventilation in the PETAL Network hospitals. For all patients, baseline demographic data, the hospital location, indication for intubation (hypoxemic or hypercapnic respiratory failure or both, altered level of consciousness, or surgery), type of intensive care unit (ICU), and Sequential Organ Failure Assessment score in the first 24 hours after intubation were collected. Baseline ventilator data immediately after intubation, arterial blood gas results and oxygen saturation as measured by pulse oximetry, and presence of ARDS was also collected for all patients. ARDS was defined as a ratio of arterial oxygen tension to fraction of inspired oxygen (FiO2) less than or equal to 300 with a chest radiograph within 24 hours of the qualifying ratio of arterial oxygen tension to FiO2 that had bilateral infiltrates unexplained by mass, collapse, or effusion. For the first 50 patients enrolled at each hospital, daily data on ventilator mode, Vt, and presence of ARDS for the first 3 days after intubation was collected. Vt indexed to PBW was calculated from the set Vt for patients on ventilator mode with volume settings. For patients on pressure ventilation modes, Vt was calculated from the ratio of minute ventilation (in ml/min) to the respiratory rate. Enrolled patients were followed until hospital discharge or 28 days for clinical outcomes including mortality, ventilator-free days, and length of stay. To determine the possible improvement in mortality that could be observed with a reduction in Vt from current usual care in the PETAL-LOTUS FRUIT cohort to 6 ml/kg PBW, mortality was estimated as a function of initial Vt. Five models based on data from three distinct patient populations were used. 500 simulations of a stepped-wedge, cluster-randomized clinical trial using the model with greatest predicted benefit for lowering the Vt to 6 ml/kg PBW in PETAL-LOTUS FRUIT sites were performed. Conclusions: Use of initial tidal volumes less than 8 ml/kg predicted body weight was common at hospitals participating in the PETAL Network. After considering the size and budgetary requirement for a cluster-randomized trial of LTVV versus usual care in acute respiratory failure, the PETAL Network deemed the proposed trial infeasible (PMID: 30407869).

  Study phs003791

• Idiopathic Pulmonary Fibrosis Network AntiCoagulant Effectiveness in Idiopathic Pulmonary Fibrosis (IPFNet-ACE-IPF-BioLINCC)

  Data Access NOTE: Please refer to the "Authorized Access" section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives: The ACE-IPF trial tested the hypothesis that treatment with warfarin at recognized therapeutic doses would reduce rates of mortality, hospitalization, and declines in Forced Vital Capacity (FVC) in subjects with Idiopathic pulmonary fibrosis (IPF).Background: IPF is a chronic, progressive lung disease of unknown cause characterized by the histopathologic pattern of usual interstitial pneumonia. The median survival of patients with IPF after the onset of symptoms is 2 to 5 years. Prior animal and human studies in pulmonary fibrosis provide a compelling rationale to examine anticoagulation as a therapeutic approach in IPF. Large epidemiologic studies link IPF with thrombosis-related clinical events, such as an increased risk of acute coronary syndrome and deep vein thrombosis. The suspected causal relationship may extend beyond simple coagulation cascade-induced thrombus formation, as procoagulant enzymes may directly stimulate fibrosis via cell surface receptor - mediated responses.Participants: Patients aged 35 to 80 years with progressive IPF were potentially eligible. Progressive IPF was defined as a history of (1) worsening of dyspnea, or (2) physiologic deterioration defined as an absolute decline of either FVC greater than or equal to 10% or DlCO greater than or equal to 15%, a reduction in arterial oxygen saturation of greater than or equal to 5%, or progression of radiographic findings. Between December 14, 2009 and April 1, 2011, 145 subjects were enrolled: 72 in the warfarin group and 73 in the placebo group. The mean age for the population was 67 years. 27% of the subjects were women and 92% were white.Participants were excluded if they met any of the following criteria: current indication for, or treatment with, warfarin, prasugrel, or clopidogrel combined with aspirin; the presence of an increased risk of bleeding; a recent cerebral vascular accident or gastrointestinal bleeding; any current signs or symptoms of severe, progressive, or uncontrolled comorbid illness; and their presence on the active list for lung transplantation. Design: ACE-IPF was a double-blind, randomized, placebo-controlled trial of warfarin targeting an international normalized ratio (INR) of 2.0 to 3.0 in patients with IPF. Subjects were randomized in a 1:1 ratio to warfarin or matching placebo for a planned treatment period of 48 weeks. Study subjects were provided two strengths of warfarin tablets (1 mg and 2.5 mg) or matching placebos. Subjects measured their INR with encrypted meters at least weekly. Participants were seen at screening, baseline, and at 16, 32, and 48 weeks after enrollment. Home monitoring was validated by plasma INR measurement at the week 1 and 16 visits.The primary outcome was a composite endpoint based on the time to all-cause mortality; nonelective, nonbleeding hospitalization; or a decrease in the absolute FVC greater than or equal to 10% from baseline value. Secondary outcome measures included rates of mortality, hospitalization, respiratory-related hospitalization, acute exacerbation, bleeding, cardiovascular events, and changes over time in FVC, 6-minute walk test distance, DlCO, plasma fibrin D-dimer levels, and quality of life (QOL).Conclusions: The study did not show a benefit for warfarin in the treatment of patients with progressive IPF and was terminated due to excess mortality in the warfarin treatment group. Treatment with warfarin was associated with an increased risk of mortality in an IPF population who lacked other indications for anticoagulation.Reported causes of death indicated 11 of the 14 were respiratory-related in the warfarin group versus three of the three in the placebo group. There were also three cardiovascular deaths in the warfarin group versus none in the placebo group. No deaths were attributed to bleeding. The warfarin group also demonstrated an increased rate of combined all-cause hospitalization and all-cause mortality. (Am J Respir Crit Care Med. 2012 Jul 1;186(1):88-95.)

  Study phs004070

• Sickle Cell Disease Implementation Consortium Registry (SCDIC Registry-BioLINCC)

  Data Access NOTE: Please refer to the "Authorized Access" section below for information about how access to the data from this accession differs from many other dbGaP accessions.Objectives: To understand the barriers to care and other factors related to reduced healthcare utilization after the transition from pediatric to adult SCD care which may contribute to increased morbidity and mortality.Background: Fifty years ago, it was rare for individuals with SCD to live beyond childhood. Advances in care delivery and treatment have more than doubled the life expectancy of individuals with sickle cell disease (SCD) since 1972. Beginning in the 1970s, measures such as newborn screening, prophylactic administration of penicillin, and immunization against bacterial infections decreased complications and morbidity, increasing the length and quality of life of children with SCD. Blood transfusions are currently the only proven way to prevent some of the major complications of SCD, especially recurrent stroke. They are also used frequently to help manage some of the acute complications of SCD. More recently, the use of hydroxyurea (HU) as a therapeutic agent to increase fetal hemoglobin has been shown to further reduce the debilitating symptoms of and improve survival in SCD. L-glutamine and crizanlizumab are additional treatments to reduce pain crises and voxelotor is approved to lower the risk of anemia and improve blood flow. In the absence of a widely accessible cure, treatment for SCD is usually aimed at avoiding crises, relieving symptoms, and preventing complications. Many of the advances in treatment have not translated into an increase in longevity or quality of life for adolescents and adults because of disparities in access to routine primary health care.Individuals with SCD experience a markedly increased mortality beginning in the second decade of life. The third and later decades of life are frequently associated with severe chronic pain progressive organ damage and frequent hospitalizations. The provision of evidence-based and expert opinion-based care in SCD is complicated by the difficulties that many patients experience in obtaining access to the health care system and in receiving long-term care from knowledgeable providers. A registry of 2,400 people with SCD was established to provide a rich resource to study the natural history of SCD and to understand barriers to care during the transition from pediatric to adult care. Participants: 2,438 participants with a confirmed diagnosis of SCD were enrolled into the registry over an 18-month period. At the time of enrollment, all participants were 15-45 years of age, English speaking, and without a bone marrow transplant.Design: The SCDIC Registry is a longitudinal observational cohort study. At enrollment, data collection included a medical record abstraction of clinical history, the most recent lab results, and a participant survey which included several patient reported outcomes from PROMIS, ASCQ-Me and NeuroQoL. Similar surveys were administered at annual follow-up. Four to five years after enrollment, a second record abstraction was completed with all clinical events that occurred since enrollment and another set of recent labs. There were many research questions proposed to be answered with the study data thus there was no primary outcome.Conclusions: As noted previously, there were no primary outcomes determined at the start of the study. Research questions included examination of co-morbidities, healthcare utilization, and patient reported outcomes. Key findings from the Registry include:Executive dysfunction, learning difficulties, and poor comprehension significantly associated with poor activities of daily living skills. Executive dysfunction also associated with HU non-adherence. Continuing HU after conception increased odds of miscarriage or stillbirth compared to women who were not using HU. Continuing HU after conception increased odds of low birth weight in infants. Compared to adolescents, young adults had significantly more severe pain, organ dysfunction, mental health disorders, sleep problems, and barriers to medical care. Young adults were significantly less likely to see a sickle cell specialist in the past 2 years. Females had higher pain frequency and severity, more pain episodes, anxiety, depression, hospitalizations, and higher fetal hemoglobin levels. Males had more respiratory, musculoskeletal, genitourinary, and cardiovascular complications, more skin ulcers, and more use of HU. Among 128 subjects that died during the study period, iron overload, pulmonary hypertension, and depression, were significant predictors of the risk of death in multivariate analyses.

  Study phs004203

• DHODH is a synthetic-lethal vulnerability in BCOR-deficient acute myeloid leukemia

  Acute Myeloid Leukemia (AML) remains challenging to treat, especially in cases with mutations in the BCL-6 co- repressor (BCOR), which are associated with poor prognosis and chemo-resistance. In this study, we reveal a synthetic lethal interaction between BCOR and dihydroorotate dehydrogenase (DHODH). We demonstrate that BCOR-deficient cells have a heightened sensitivity to DHODH inhibitors such as brequinar and leflunomide, that are already in clinical use. We confirm that DHODH inhibition selectively induces cell death in BCOR-mutant cells in multiple cellular models, in malignant and non-malignant cells, through chemical and genetic manipulation. Interestingly, we find that the dependency on DHODH does not stem from its role in de novo pyrimidine biosynthesis disruption. Rather, DHODH’s role in the electron transport chain, essential for mitigating reactive oxygen species, may be the physiological vulnerability that pushes BCOR-mutant cells toward cell death when DHODH is inhibited. DHODH inhibitors could be repurposed as targeted therapies for BCOR-mutant tumors, offering a promising strategy for precision medicine in AML and other cancers.

  Study EGAS50000001060

• DHODH is a synthetic-lethal vulnerability in BCOR-deficient acute myeloid leukemia

  Acute Myeloid Leukemia (AML) remains challenging to treat, especially in cases with mutations in the BCL-6 co- repressor (BCOR), which are associated with poor prognosis and chemo-resistance. In this study, we reveal a synthetic lethal interaction between BCOR and dihydroorotate dehydrogenase (DHODH). We demonstrate that BCOR-deficient cells have a heightened sensitivity to DHODH inhibitors such as brequinar and leflunomide, that are already in clinical use. We confirm that DHODH inhibition selectively induces cell death in BCOR-mutant cells in multiple cellular models, in malignant and non-malignant cells, through chemical and genetic manipulation. Interestingly, we find that the dependency on DHODH does not stem from its role in de novo pyrimidine biosynthesis disruption. Rather, DHODH’s role in the electron transport chain, essential for mitigating reactive oxygen species, may be the physiological vulnerability that pushes BCOR-mutant cells toward cell death when DHODH is inhibited. DHODH inhibitors could be repurposed as targeted therapies for BCOR-mutant tumors, offering a promising strategy for precision medicine in AML and other cancers.

  Study EGAS50000001108

• Somatic mutation and selection at epidemiological scale - Sanger_NanoSeq_RandD

  Bottleneck sequencing of human tissue including neurons, cord blood, sperm This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/. As we age, many tissues become colonised by microscopic clones carrying somatic driver mutations. Some of these clones represent a first step towards cancer whereas others may contribute to ageing and other diseases. However, our understanding of the clonal landscapes of human tissues, and their impact on cancer risk, ageing and disease, remains limited due to the challenge of detecting somatic mutations present in small numbers of cells. Here, we introduce a new version of nanorate sequencing (NanoSeq), a duplex sequencing method with error rates of less than 5 per billion base pairs, which is compatible with whole-exome and targeted gene sequencing. Deep sequencing of polyclonal samples with single-molecule sensitivity enables the simultaneous detection of mutations in large numbers of clones, yielding accurate somatic mutation rates, mutational signatures and driver mutation frequencies in any tissue. Applying targeted NanoSeq to 1,042 non-invasive samples of oral epithelium and 371 samples of blood from a twin cohort, we found an unprecedentedly rich landscape of selection, with 46 genes under positive selection driving clonal expansions in the oral epithelium, over 62,000 driver mutations, and evidence of negative selection in some genes. The high number of positively selected mutations in multiple genes provides high-resolution maps of selection across coding and non-coding sites, a form of in vivo saturation mutagenesis. Multivariate regression models enable mutational epidemiology studies on how carcinogenic exposures and cancer risk factors, such as age, tobacco or alcohol, alter the acquisition and selection of somatic mutations. Accurate single-molecule sequencing has the potential to unveil the polyclonal landscape of any tissue, providing a powerful tool to study early carcinogenesis, cancer prevention and the role of somatic mutations in ageing and disease.

  Dataset EGAD00001015624

• National Eye Institute (NEI) Age-Related Eye Disease Study (AREDS)

  The Age-Related Eye Disease Study (AREDS) was initially designed as a long-term multi-center, prospective study of the clinical course of age-related macular degeneration (AMD) and age-related cataract. In addition to collecting natural history data, AREDS included a clinical trial of high-dose vitamin and mineral supplements for AMD and a clinical trial of high-dose vitamin supplements for cataract. AREDS participants were 55 to 80 years of age at enrollment and had to be free of any illness or condition that would make long-term follow-up or compliance with study medications unlikely or difficult. On the basis of fundus photographs graded by a central reading center, best-corrected visual acuity and ophthalmologic evaluations, 4,757 participants were enrolled in one of several AMD categories, including persons with no AMD. The clinical trials for AMD and cataract were conducted concurrently. AREDS participants were followed on the clinical trials for a median time of 6.5 years. Subsequent to the conclusion of the clinical trials, participants were followed for an additional 5 years and natural history data were collected. The AREDS research design is detailed in AREDS Report 1. AREDS Report 8 contains the mainline results from the AMD trial; AREDS Report 9 contains the results of the cataract trial. Blood samples were also collected from 3,700+ AREDS participants for genetic research. Genetic samples from 600 AREDS participants (200 controls, 200 Neovascular AMD cases, and 200 Geographic Atrophy cases) were selected using data available in March 2005 and then were evaluated with a genome-wide scan. These data, as well as selected phenotypic data, were made available in the dbGaP. DNA from AREDS participants, which is currently being stored in the AREDS Genetic Repository, is available for research purposes. However, not all of the 3,700+ AREDS participants who submitted a blood sample currently have DNA available. In addition to including the data from the genome-wide scan on the 600 original samples, this second version of the AREDS dbGaP database provides a comprehensive set of data tables with extensive clinical information collected for the 4,757 participants who participated in AREDS. The tables include information collected at enrollment/baseline, during study follow-up, fundus and lens pathology, nutritional estimates, quality of life measures and measures of morbidity and mortality. In November 2010, over 72,000 high quality fundus and lens photographs of 595 AREDS participants (of the original 600 selected for the genome-wide scan) were made available in the AREDS dbGaP. In addition to the genome-wide scan data, the fundus and lens grading data for these participants are also available through the AREDS dbGaP. Details about the ocular photographs that are available may be found in the document "Age-Related Eye Disease Study (AREDS) Ocular Photographs". In January 2012, a measure of daily sunlight exposure was added in a separate "sunlight" table. Furthermore, the "followup" table has been revised. The visual acuity for the right eye was inadvertently missing at odd-numbered visits (01, 03, 05, etc.). This data is now part of the table. In February 2014 over 134,500 high-quality fundus photographs (macular field F2) of 4613 AREDS participants were added to the existing AREDS dbGaP resource. The AREDS dbGaP image archive already contains over 72,000 high quality fundus and lens photographs of 595 AREDS participants for whom dbGaP-accessible genotype data exist. Information about the available ocular photographs found in the document "Age-Related Eye Disease Study (AREDS) Ocular Photographs" has been updated with an addendum. It is hoped that this resource will better help researchers understand two important diseases that affect an aging population. These data may be applied to examination and inference on genetic and genetic-environmental bases for age-related diseases of public health significance and may also help elucidate the clinical course of both conditions, generate hypotheses, and aid in the design of clinical trials of preventive interventions. Definitions of Final AMD Phenotype Categories Please see phd001138.1 for a detailed description of how AREDS participants' final AMD phenotype was categorized. User's Guide for AREDS Phenotype Data A detailed User's Guide for the AREDS phenotype data is available. This User's Guide is meant to be a comprehensive document which explains the complexities of the AREDS data. It is recommended that all researchers using AREDS phenotype data make use of this User's Guide.

  Study phs000001

• Human Companion Data for 'A Transcriptomic Atlas of Mouse Cerebellar Cortex Reveals Novel Cell Types'

  In this study, we used single-nucleus RNA-seq to comprehensively define the cell specialization of the mouse cerebellar cortex and vermis. We focused in particular on two interneuron populations—the unipolar brush cells (UBCs) and the molecular layer interneurons (MLIs), identifying continuous variation within the former population, and a new discrete axis of variation in the latter. Human postmortem tissue was used to demonstrate that these specializations are evolutionarily conserved in primates. Together, these findings provide the first comprehensive cellular atlas of the cerebellar cortex, and outline a methodological and conceptual framework for the integration of molecular, morphological, and physiological ontologies for defining brain cell types.

  Study phs002414

• PGRN-Leducq: Identification of the KCNE1 D85N Polymorphism as a Possible Modulator of Drug-Induced Torsades de Pointes

  The goal of this study was to search for genetic variants that could be responsible for modifying the risk of drug-induced long QT syndrome (diLQTS). diLQTS is a relatively common adverse drug event and has been a leading cause for drug relabeling and withdrawal from the market. Our hypothesis, that variants in genes which regulate electrical properties in the heart modify the risk of diLQTS, was tested by genotyping patients of European descent at 1424 single nucleotide polymorphisms (SNPs) in 18 candidate genes. We found that the SNP KCNE1 D85N was highly predictive of diLQTS with an odds ratio of 9.0 (95% confidence interval: 3.5-22.9).

  Study phs000617

• A Phase II Study: CRS207/GVAX Plus Anti-PD1 and Anti-CTLA4 Recruits Mesothelin- and KRAS-Specific T cells into PDAC

  This study examined immunologic correlatives from a phase II study evaluating CRS207/GVAX vaccines in combination with anti-PD1 and anti-CTLA4 in metastatic pancreatic cancer (NCT03190265). Arm A received CRS207/GVAX with anti-PD1 and anti-CTLA4 therapy; Arm B received CRS207 with anti-PD1 and anti-CTLA4 therapy. Patients undergoing treatment in this trial had peripheral blood mononuclear cells (PBMCs) and tumor tissue biopsied serially at pre-treatment and on-treatment timepoints. Single-cell RNA/TCR sequencing was employed on PBMCs. Bulk RNA/TCR sequencing was employed on tumor tissues. We identified treatment-enriched inflammatory pathways as well as T cell repertoires.

  Study phs003798

• Proteomic Characterization of Intrahepatic Cholangiocarcinoma Identifies Risk-Stratifying Subgroups, Proteins Associated with Time-To-Recurrence, and mTOR Effector Molecule EIF4A1 as a Druggable Therapeutic Target

  Using mass spectrometry-based proteomics, we analyzed two independent cohorts comprising 80 and 62 treatment-naive ICC tumors, 67 adjacent non-malignant tissues, and 9 patient-derived xenografts (PDX). In the first cohort, we identifed two subclusters with distinct times-to-recurrence (TTR). A 4-protein classifier trained on our data cohort accurately stratifies these ICC clusters in the Dong et al. dataset (2022) and in our independent second cohort, revealing similar associations between proteomic motifs and clinical outcomes. The Translation regulator EIF4A1 emerges as a therapeutic target, as its inhibition with novel drug eFT226 significantly reduces tumor growth in an ICC PDX model.

  Study EGAS50000001343

• SCI-MAP: Single Cell Microgel embedded iPS-cells to map molecular variability of cell differentiation using a systems biology approach

  In the SCI-MAP project we will map cell states encountered across a previously established 49 day in vitro chondrogenic differentiation protocol. We do this to optimise the differentiation process for therapeutic and in vitro modelling ends. We collect epigenetic open chromatin and phenotypic transcriptome data to determine cell states and so performed single nucleus sequencing in two modalities: RNA- and ATAC-sequencing. Data was collected in a time series experiment at 7 points: Days 0, 3, 6, 8, 14, 21, and 49, starting with the first pilot data from day 21 (D21) then the actual experiment time series 1 (TS1) of days 0, 3, 6, 8, 14, and 49.

  Study EGAS50000001756

• The European Bank for Induced Pluripotent stem cells (EBiSC) is designed to address the increasing demand by iPSC researchers for quality-controlled, disease-relevant research grade iPSC lines, data and cell services.In this study Whole Genome Sequencing was performed on a selection of lines from the project.

  Induced pluripotent stem (iPS) cells have the potential to significantly advance drug development and health research, yet collections of stem cells are scattered across the world, their quality cannot always be guaranteed, and accessing them is often difficult. The goal of EBiSC is to establish a European iPS cell bank that will be the ‘go-to’ resource for the characterisation, storage and distribution of high quality iPS cells. Ultimately, EBiSC will become an independent organisation, distributing high quality iPS cells on a not-for-profit basis to scientists worldwide.

  Study EGAS00001002755

• Identification and functional characterisation of a rare MTTP variant underlying familial non-alcoholic fatty liver disease

  We identified a rare causal variant in MTTP, c.1691T>C p.I564T (rs745447480) encoding microsomal triglyceride transfer protein (MTP) causing progressive non-alcoholic fatty liver disease with cirrhosis and hepatocellular carcinoma unrelated to metabolic syndrome, without manifestations of abetalipoproteinemia, in a four generation family with South Asian ancestry. Variant-expressing hepatocyte-like-cells (HLCs) derived from human induced pluripotent stem cells generated from homozygous donor skin fibroblasts had lower lipoprotein ApoB secretion, compared to wild type cells. Cytoplasmic triglyceride accumulation in HLCs triggered endoplasmic reticulum stress, secretion of pro-inflammatory mediators, production of reactive oxygen species, delineating the progression of disease associated with homozygosity for MTTP p.I564T

  Study EGAS00001005254

• EGA submission account terms

  Submission account terms Each EGA submission account has a dedicated submission box. To ensure continued service to all submitters EGA submission boxes should not exceed 8Tb in size, and cannot exceed 12Tb. Those that are near to or exceeding this value will be monitored on a weekly basis by the helpdesk team and the submitter will be contacted and guidance provided accordingly on completing their metadata registration. You will be able to register your metadata associated with the files in your submission account via EGA Submitter Portal, Webin or the EGA REST API. EGA also requests that metadata is submitted within 60 days of upload data to a submission box. When we detect files that are over 60 days old in a submission box we will notify the submitter requesting that metadata be submitted or the files removed from the submission box. It is important to note that data is not archived at the EGA until the metadata describing the files has been associated and the archival process has completed. It is only when associated metadata has been submitted that the archival process into EGA is fully triggered. EGA removes files from the submission box once they have been successfully archived, so no action is required by a submitter to remove successfully archived files. Files over 90 days old will be deleted from the submission box unless EGA Helpdesk has been contacted and confirmed an exemption with the submitter.

  Documentation submission/terms

• 33 patients with Monoclonal Gammopathy of Undetermined Significance (MGUS)

  Monoclonal gammopathy of undetermined significance (MGUS) is a premalignant precursor of multiple myeloma (MM) with a 1% risk of progression per year. Although targeted analyses have shown the presence of specific genetic abnormalities such as IGH translocations, RB1 deletion, 1q gain, hyperdiploidy or RAS genes mutations, little is known about molecular mechanism of malignant transformation. We have performed whole exome sequencing together with SNP array analysis in 33 flow-cytometry separated abnormal PC samples of MGUS patients to describe somatic gene mutations and chromosome changes at the genome-wide level. Non-synonymous mutations (NS-SNVs) and copy number alterations (CNAs) were present in 97.0% and in 63.6% of cases, respectively. Importantly, the number of somatic mutations was significantly lower in MGUS compared to MM (p<10-4) and we have identified 6 myeloma significantly mutated genes which are KRAS, NRAS, DIS3, HIST1H1E, EGR1 and LTB in the MGUS dataset. We also found a positive correlation with increasing chromosome changes and somatic mutations. IGH translocations were present in 27.3% of cases comprising t(4;14), t(11;14), t(14;16) or t(14;20) and were in a similar frequency to MM, which corresponded with primary lesion hypothesis. Data from this study showed MGUS is a genetically comprehensive disease, however overall genetic instability is significantly lower compared to MM.

  Dataset EGAD00001001901

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• non-malignant plasma cfRNA

  Dataset contains mRNA capture sequencing data from plasma of 125 different human donors: 88 patients with a non-malignant disease and 37 cancer-free controls. Samples were sequenced on a NovaSeq X and sequencing data is provided in FASTQ format.

  Dataset EGAD50000001806

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234