11930 results for "division 2 coins fc 26 Visit Buyfc26coins.com Kupiłem(a) duży pakiet monet FC 26 i dostałem(a) dodatkowy rabat. Świetnie!.fXzt"

in 31.65 milliseconds.

• National Institute on Aging - Late Onset Alzheimer's Disease Family Study: Genome-Wide Association Study for Susceptibility Loci

  Alzheimer disease is the most common neurodegenerative disorder of the elderly affecting an estimated five million Americans. Genetic factors contribute to the risk for disease with heritability estimates ranging from 57% to 79%. More than a decade ago, the ε4 variant of APOE was identified and remains the most consistently replicated genetic variant influencing the risk of late onset Alzheimer disease. A segregation analysis suggests there may be four additional genes influencing the age-at-onset of Alzheimer disease. In 2007 there were 968 association studies in 398 candidate genes reported, but none replicated consistently. There are many reasons for the lack of consistency, but one important reason for the lack of progress is the paucity of a sufficient number of well characterized families and patients available to the entire scientific community. The extensive effort and expense required to ascertain such a population has been addressed by the NIA-LOAD Family Study. Its goal is to identify and recruit families with two or more siblings with the late-onset form of Alzheimer's disease and a cohort of unrelated, non-demented controls similar in age and ethnic background, and to make the samples, the clinical and genotyping data and preliminary analyses available to qualified investigators world-wide. Genotyping by the Center for Inherited Disease Research (CIDR) was performed using the Illumina Infinium II assay protocol with hybridization to Illumina Human 610Quadv1_B Beadchips. This genotyping represents the largest collection of families ever assembled with Alzheimer's disease combining the NIA-LOAD Genetics Initiative Multiplex Family Study, the National Cell Repository for Alzheimer's Disease (NCRAD) with additional controls from the University of Kentucky. These genotyping results will serve as a focal point for future research that will identify all of the remaining genetic variants in Alzheimer's disease.

  Study phs000168

• Childhood Cancer Data Initiative (CCDI): Enhancement of Data Sharing in Pediatric, Adolescent and Young Adult Cancers

  NCI's Childhood Cancer Data Initiative (CCDI) is building a community centered around childhood cancer care and research data. Through enhanced data sharing, we can improve our understanding of cancer biology to improve preventive measures, treatment, quality of life, and survivorship, as well as ensure that researchers learn from every child with cancer. While childhood cancers represent the leading cause of death in children over the age of 1, they are collectively rare, comprising approximately 1%‒3% of cancers diagnosed annually in the United States. Information on diagnosis, treatment, and outcomes is often stored at the hospital or institution where a child is treated, making it difficult to answer scientific questions about childhood cancer. Sharing clinical care and research data generated by children's hospitals, clinics, or networks broadly with the community can help us learn faster and, on a scale much larger than any single institution caring for children can learn on its own. To exploit the rapid advances in high-throughput DNA sequencing technologies and realize the goals of precision cancer medicine, the UMICH Cancer Center established the Michigan Oncology Sequencing Center (MI-ONCOSEQ). This UMICH Cancer Center provisions genomic data derived from the Michigan Oncology Sequencing Center (MI-ONCOSEQ) clinical sequencing assay for patients that fall within the inclusion criteria of the CCDI data sharing initiative. An "integrative sequencing approach" carried out in a CLIA-certified laboratory is utilized to provide a comprehensive landscape of the genetic alterations in individual tumor specimens for the purpose of identifying informative and/or actionable mutations. Using a number of computational pipelines that we have developed in-house or have adapted from the public domain, candidate molecular aberrations are nominated and then analyzed by scientists for clinical significance and/or relevance. This approach enables the detection of point mutations, insertions/deletions, gene fusions and rearrangements, amplifications/deletions, and outlier expressed genes. Furthermore, we can identify certain germline alterations that may also be relevant.

  Study phs002431

• Structure and Diversity of Urinary Cell-Free DNA Informative of Host-Pathogen Interactions in Human Urinary Tract Infection

  The risk of acquiring urinary tract infection (UTI) is very high for patients who have received kidney transplants; nearly half will develop bacteriuria and an eighth viruria via BK polyomavirus in the first three years following transplantation. Current methodology for diagnosing viral and bacterial infections, while well practiced, is often limited in scope. The advent of next generation sequencing of cell-free DNA has shown promise in its ability to capture multiple perspectives of human health from discovering the origin of cell-free DNA in plasma; such a diagnostic has not been readily applied to urinary cell-free DNA. In this study, we selected 141 urine samples from a cohort of kidney transplant patients, which were collected and stored at Weill Cornell Medical College - New York Presbyterian Hospital. Of these samples, 43 samples were determined to be culture positive (> 10,000 CFU) for one or more bacterial species, including E. coli, Enterococcus, Klebsiella, Haemophilus, and Raoultella. A separate 23 samples were confirmed for BK virus nephropathy, with presence of BK polyomavirus confirmed via qPCR. We also included 29 samples from 14 patients who did not develop UTIs in the first three months following transplantation, and 11 samples that were negative for BK virus nephropathy. For a full description of samples, please see the Supplementary Data 1 in https://pubmed.ncbi.nlm.nih.gov/29925834/. From these urine samples, we aimed to capture and sequence urinary cell-free DNA using a single-stranded library preparation. In addition, we performed whole-genome bisulfite sequencing to 170 plasma samples collected from 27 hematopoietic cell transplant patients who developed graft-versus host disease and BK polyomavirus infection. We also performed Sample-Intrinsic microbial DNA Found by Tagging and sequencing (SIFT-seq) on 196 cell-free DNA (cfDNA) samples (154 plasma and 42 urine) collected from five groups of subjects. For a full description of samples, please see publications in PMID: 35864089 and PMID: 35058359.

  Study phs001564

• Genomic features of Helicobacter pylori-na��ve diffuse-type gastric cancer.

  Helicobacter pylori (HP) is a major etiologic driver of diffuse-type gastric cancer (DGC). However, improvements in hygiene have led to an increase in the prevalence of HP-na��ve DGC; that is, DGC that occurs independent of HP. Although multiple genomic cohort studies for gastric cancer have been conducted, including studies for DGC, distinctive genomic differences between HP-exposed and HP-na��ve DGC remain largely unknown. Here, we employed exome and RNA sequencing with immunohistochemical analyses to perform binary comparisons between 36 HP-exposed and 27 HP-na��ve DGCs from sporadic, early-stage, and intramucosal or submucosal tumor samples. Among the samples, 33 HP-exposed and 17 HP-na��ve samples had been preserved as fresh-frozen samples. HP infection status was determined using stringent criteria. HP-exposed DGCs exhibited an increased single nucleotide variant burden (HP- exposed DGCs; 1.97 [0.48���7.19] and HP-na��ve DGCs; 1.09 [0.38���3.68] per megabase; p=0.0003) and a higher prevalence of chromosome arm-level aneuploidies (p<0.0001). CDH1 was mutated at similar frequencies in both groups, whereas RHOA���ARHGAP pathway misregulation was exclusive to HP-exposed DGCs (p=0.0167). HP-exposed DGCs showed gains in chromosome arms 8p/8q (p<0.0001), 7p (p=0.0035) and 7q (p=0.0354), and losses in 16q (p=0.0167). Immunohistochemical analyses revealed a higher expression of intestinal markers such as CD10 (p<0.0001) and CDX2 (p=0.0002) and a lower expression of the gastric marker, MUC5AC (p=0.0305) among HP-exposed DGCs. HP-na��ve DGCs, on the other hand, had a purely gastric marker phenotype. This work reveals that HP-na��ve and HP-exposed DGCs develop along different molecular pathways, which provide a basis for early detection strategies in high incidence settings.

  Study JGAS000575

• Local In Time Statistics for processual research

  Background: Functional genomics in a processual analysis cover the time-dependent changes in transcriptomics and epigenetics before diagnosis of a disease, reflecting the changes in both life style and disease processes. The aim of this paper is to explore the dynamic, time-dependent mechanisms of the metastatic processes, using blood transcriptomics and including time in a continuous manner. For achieving this goal we develop new statistical methods based on statistics that are local in time. Methods: The new statistical method, Local In Time Statistics (LITS), is based on calculating statistics in moving windows and randomization. The method has been tested for the analysis of a dataset that collectively provides information on the blood transcriptome up to eight years before breast cancer diagnosis. The dataset from the NOWAC Post-genome Cohort consists of 467 case-control pairs matched on birth year and time of blood sampling. The data for a pair is the difference in log2 gene expression between the case and control. The stratified analyses are based on important biological differences like metastatic versus non-metastatic cancer, and the mode of cancer detection, i.e. screening detected versus clinically detected cancers. The dataset was used for examining whether the gene expression profile varies between cases and controls, with time, or between cases with and without metastases. Results: The null hypotheses of no differences between cases and controls, no time-dependent changes, and no differences between different strata were all rejected. For screening detected cancers the probability of correct prediction of metastasis status was best in year 1 before diagnosis compared to year 3 and 4 before diagnosis for clinically detected cancers. The predictor was not very sensitive to the number of genes included.Conclusions: Using a new statistical method, LITS, we have demonstrated time-dependent changes of the blood transcriptome up to eight years before breast cancer diagnosis.

  Study EGAS00001002520

• Dataset SNP tumours

  This dataset contains 30 idat files each from 15 SNP array runs on patient colitis-associated colorectal cancer tumours. All phenotypes are cancer. See Baker et al. 2018 Supplementary Table 2 for patient details of 12 tumours used in the analyses in the publication.

  Dataset EGAD00010001587

• COLONOMICS Whole Exome Sequencing

  This dataset consists of Illumina HiSeq 2000 Whole Exome Sequencing of 84 colorectal samples: 42 Tumor tissue samples and 42 Normal tissue samples (adjacent to tumor sites). 2x75bp paired-end sequencing reads: 2 fastq files per sample

  Dataset EGAD00001004826

• Transcriptome - Uveal Melanomas MPI

  Total RNA sequencing on 4 uveal melanoma samples. Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001138

• RNA-seq dataset for two NUP98-Rearranged Acute Myeloid Leukemia PDX samples

  This dataset includes RNA-seq of two patient-derived xenograft (PDX) samples with NUP98-Rearranged Acute Myeloid Leukemia. Bam files are provided for each sample.

  Dataset EGAD50000001564

• Two scRNA-seq datasets from control and irradiated organoids.

  Dataset includes two scRNA-seq samples from control and irradiated organoids. Files included in the dataset are Fastq files. Sample libraries produced with Chromium X were sequenced on an Illumina NovaSeq 6000 sequencer.

  Dataset EGAD50000001933

• Human normal brain single-cell

  We profiled two human fetal brainstem specimens at 17 and 19 post-conception weeks by single-cell RNA-seq using 10X Chromium Single Cell 3'. The BAM files are provided.

  Dataset EGAD00001005128

• Exome sequencing of women with familial high-grade serous ovarian carcinoma

  Germline exome sequencing data (paired Fastq files) from 516 BRCA1/2-negative women affected with familial high-grade serous (or similar) ovarian carcinoma, as analysed and described in Subramanian et al (Nature Communications, 2020).

  Dataset EGAD00001006030

• WGS of B-cell lymhpoma tumor and control, HiSeq XTen sequencing, one patient, H021

  paired WGS sequencing of nodal B-cell lymphoma, one tumor and one control, one patient (H021). Sequencing on Hiseq XTen with TruSeq Nano library preparation kit.

  Dataset EGAD00001006057

• Whole genome sequencing data of high-grade serous ovarian cancer samples (set 9 part 2)

  Whole genome sequencing data of 35 high-grade serous carcinoma (HGSC) patients (112 samples) sequenced with Illumina Novoseq 6000

  Dataset EGAD00001011368

• Exome and Targeted sequencing of GZL

  Tumor and matching normal exomes for 28 GZL cases (n=56) and targeted capture sequencing for 42 GZL cases with 3 matching normals and 2 pooled normals (n=47)

  Dataset EGAD00001006328

• Copy number profiles detected by shallow coverage WGS

  We performed shallow coverage whole genome sequencing on 147 glioma samples and analyzed their copy number profile. The coverage of each sample is about 2. Data are presented as VCF files which describe the copy number segments and their log2 ratio.

  Dataset EGAD00001005062

• FFPE CPA Accreditation Study Part 2

  FFPE CPA accreditation of genome-scale sequencing in routinely collected formalin-fixed paraffin-embedded (FFPE) cancer specimens versus matched fresh-frozen samples using targeted pulldown capture prior to Illumina sequencing.

  Dataset EGAD00001000868

• Feasibility of targeted capture sequencing in FFPE cancer specimens 2

  Testing the feasibility of genome-scale sequencing in routinely collected formalin-fixed paraffin-embedded (FFPE) cancer specimens versus matched fresh-frozen samples using targeted pulldown capture prior to Illumina sequencing.

  Dataset EGAD00001001448

• RRBS - MBD4-deficient AML

  Reduced Representation Bisulfite Sequencing for WEHI-AML-1 and WEHI-AML-2. RRBS libraries were made with the NuGEN Ovation RRBS Methyl-Seq System. Bisulfite conversion was performed with the Qiagen Epitect kit. Sequencing was performed on an Illumina HiSeq2500.

  Dataset EGAD00001003567

• WGS data of XPC-ko human small intestinal organoid cultures

  Whole genome sequencing (WGS) data of human small intestinal organoid cultures, which were deleted for the XPC gene using CRISPR-Cas9. Contains WGS data of 1 clone and 1 subclone.

  Dataset EGAD00001003779

• Indonesian Genome Diversity Project 2

  This dataset reports whole genome sequences for 82 individuals from different populations from Mentawai, New Guinea, Sumatra and Sumba islands.

  Dataset EGAD00001005059

• Matched WXS of 147 lung cancer patients treated with immunotherapy

  This data includes whole exome sequencing of matched normal-tumor samples of patients who have received immunotherapy. '-1' refers to matched normal sample and '-2' refers to matched tumor sample.

  Dataset EGAD00001005211

• PCa mtDNA data

  50 paired benign/cancer samples from prostate tissue generated in 2 different runs - on 3 plates on the IonTorrent Proton. Total of 200 fastq.gz single end runs. Read length ~300 bp. %GC 44 Sequences per file approx 1 Mio.

  Dataset EGAD00001005945

• Effects of interferon-gamma treatment on human small intestinal organoids generated from healthy donors

  The intestine is vulnerable to interferon-gamma as intestinal epithelial stem cells undergo cell death when exposed to interferon-gamma. Here, we developed a novel human intestinal organoid-based 3D model system to study the effects of interferon-gamma-induced intestinal epithelial damage at the RNA level. We treated organoids with 10 ng/mL for either 6 or 18h. Knowledge generated with this dataset is relevant for a variaty of intestinal pathologies with an immune component, for instance graft-versus-host disease.

  Study EGAS50000000083

• SARS-CoV2 mRNA-vaccination-induced Immunological Memory in Human Non-Lymphoid and Lymphoid Tissues

  SARS-CoV2 mRNA vaccination-induced CD4+ Th cells were isolated based on activation marker expression from human bone marrow (n=3), lung (n=5), liver (n=4) and paired blood samples (to liver donors, n=4) of virus-naive vaccinees after Spike peptide mix stimulation in vitro. The 10X platform was used for single cell transcriptome analysis, along with T cell receptor clonotype analysis in a total of 1985 cells. Samples were sequenced on a NovaSeq 6000 (Illumina).

  Study EGAS50000000045

• International Multi-Center ADHD Gene Project (IMAGE) II Case Sample

  This sample represents a collection of cases across a range of sites. All of these samples were ascertained for ADHD with most meeting criteria for combined type ADHD. The collection sites span Europe and America. Further details on the source and inclusion and exclusion information can be found in Neale et al. "Case-Control Genome-Wide Association of Attention-Deficit / Hyperactivity Disorder" J Am Acad Child Adolesc Psychiatry. 2010 September; 49(9): 906-920 PMID20732627. For online access to this manuscript see: PMC2928577.

  Study phs000407

• Whole Exome Sequencing for Colorectal Cancer

  This project was designed to use next generation sequencing technology to screen the protein coding regions of the genome for low frequency variants in a panel of high-risk colorectal adenocarcinoma cases. Blood and cell-line DNA for colorectal cancer patients and a subset of quality control samples that had existing whole exome sequence data were analyzed using Illumina HiSeq sequencers. Samples from this project were from participants in the Women's Health Initiative (WHI) and the Diet, Activity, and Lifestyle Study (DALS).

  Study phs000410

• The Mexican-American Coronary Artery Disease Study (MACAD)

  The MACAD Study, funded by NHLBI, was designed to explore genetic contributions to coronary artery disease and glucose homeostasis traits among Hispanics using a family-based design. The baseline examination of the cohort included the euglycemic hyperinsulinemic clamp test from which the two key phenotypes were obtained: insulin sensitivity (M) and metabolic clearance rate of insulin (MCRI). Genome-wide genotyping was obtained under separate funding by NIDDK as a part of the GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium.

  Study phs001397

• Genome Wide Association Study of Chronic TMD: Discovery Phase

  The OPPERA project is investigating effects of genetic, physiological, psychological and clinical factors on the risk of developing painful temporomandibular disorder (TMD). This case-control study is a discovery-phase genome wide association study that aims to identify commonly-occurring genetic variants associated with chronic TMD. It represents the first step in a series of studies that seek to identify the genetic background of TMD. For related phenotype and targeted genotype data, please see additional studies from the OPPERA project at dbGaP phs000761).

  Study phs000796

• NCI Laboratory of Translational Genomics (LTG) Human Pancreas QTL study

  We created a human histologically normal pancreas eQTL resource using 91 fresh frozen tissue samples from patients diagnosed with pancreatic cancer (Mayo Clinic and Memorial Sloan Kettering Cancer Center) or from organ donors without a history of pancreatic cancer (Penn State University) by RNA-Sequencing. Genome wide genotyping was done using blood derived DNA samples or normal derived tissue samples. An average of ~369,4 million reads (paired end, stranded, 101 bp) and 724981 genotypes (per sample) were generated.

  Study phs001776

• Kids First: Genetic Basis of Fetal Alcohol Spectrum Disorders

  Fetal Alcohol Spectrum Disorder (FASD) is estimated to occur in at least 1-5% of all children in the USA and is a major public health issue. However, in addition to alcohol, other susceptibility factors, such as maternal or fetal genetic variation, must play a role as not all children prenatally exposed to alcohol are similarly affected. The proposed study will examine the role of genetic susceptibility for FASD. This work will help to inform more effective intervention efforts for this common congenital disorder.

  Study phs002594

• Myocardial Infarction Genetics Exome Sequencing Consortium: BioImage Study

  The BioImage Study (BioImage Study: A Clinical Study of Burden of Atherosclerotic Disease in an At-Risk Population, NCT00738725), is a prospective, observational study aimed at characterizing subclinical atherosclerosis in U.S. adults (55 to 80 years old) at risk for clinical atherosclerotic cardiovascular disease (PMID: 25790876). All exome sequencing was performed at the Broad Institute of Harvard and MIT; samples sequence capture was performed using Illumina's ICE Capture reagent and sequencing was performed on an Illumina HiSeq 2000 or 2500.

  Study phs001058

• RB1 Loss Triggers Dependence on ESRRG in Retinoblastoma

  Retinoblastoma (Rb) is a deadly childhood eye cancer that is classically initiated by inactivation of the RB1 tumor suppressor. Clinical management continues to rely on nonspecific chemotherapeutic agents that are associated with treatment resistance and toxicity. Here, we analyzed whole exomes from primary Rb tumors to identify novel Rb dependencies. Several recurrent genomic aberrations implicate estrogen-related receptor gamma (ESRRG) in Rb pathogenesis. ESRRG is an essential mediator of hypoxic adaptation and cell survival in retinoblastoma, representing a promising new therapeutic target.

  Study phs002859

• The Hypertension-Insulin Resistance Family Study (HTN-IR)

  The HTN-IR Study, funded by NHLBI, was designed to explore genetic contributions to hypertension and glucose homeostasis traits among Hispanics using a family-based design. The baseline examination of the cohort included the euglycemic hyperinsulinemic clamp test from which the two key phenotypes were obtained: insulin sensitivity (M) and metabolic clearance rate of insulin (MCRI). Genome-wide genotyping was obtained under separate funding by NIDDK as a part of the GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium.

  Study phs001394

• C9ORF72 Hexanucleotide Repeat Sequence Genotyping Project

  This study reports long-range and high-resolution repeat sizing of the C9orf72 repeat region for 2095 samples from the National Institute of Neurological Disorders and Stroke (NINDS) repository's ALS collection. Genomic DNA samples were analyzed with a PCR assay (AmplideX® PCR/CE C9orf72 Kit) and resolved on capillary electrophoresis. Expanded samples were also analyzed using a gene-specific assay and resolved by capillary electrophoresis (up to 145 GGGGCC hexanucleotide repeats) and AGE agarose gel electrophoresis (up to 950 hexanucleotide repeats, respectively).

  Study phs001718

• The Genetics of Lung Cancer Susceptibility in Smokers

  Over 85% of all patients diagnosed with lung cancer report a history of tobacco use, though only 10% of tobacco smokers eventually develop lung cancer. Epidemiologic studies have shown that family members of patients with lung cancer have a higher risk of developing lung cancer than controls. In an effort to identify variants associated with tobacco induced lung cancer, we have sequenced germline DNA from affected and unaffected members of families with strong histories of tobacco related lung cancer.

  Study phs000728

• Luminal Androgen Receptor-Enriched Triple Negative Breast Cancer

  This is a study to determine the efficacy of androgen receptor (AR) inhibitors in LAR (luminal androgen receptor)-enriched triple-negative breast cancer (TNBC) in the neoadjuvant setting. Twenty-four patients were treated with neoadjuvant AR inhibitor enzalutamide and paclitaxel for 12 weeks. Whole exome sequencing and RNA-sequencing was performed prior to treatment. The data for only two patients are consented for release through dbGaP. The remaining data are available under a Materials Transfer Agreement with the University of Texas MD Anderson Cancer Center.

  Study phs003586

• The Role of GPD1L in the Pathogenesis of Brugada Syndrome

  This study performed exome sequencing on a proband with Brugada Syndrome, as well as high-density SNP array data from the proband, affected family members, and unaffected family members. The principal findings of this study were the identification of GPD1L-A280V as the only plausible variant present in a linkage region on chromosome 3, which co-segregated with the Brugada Syndrome phenotype in this family. Exome sequencing data of the proband, as well as SNP array data from the family, are available.

  Study phs003468

• Paired Analysis of Host and Pathogen Genomes Identifies Determinants of Human Tuberculosis

  The outcome of infectious diseases may depend on the interaction between human and pathogen genomic variations. This study was designed to explore and validate this relationship in tuberculosis (TB) by conducting a genome-to-genome study of paired genomes from human hosts and the infectious agent Mycobacterium tuberculosis.Blood samples were collected from 699 TB patients in Lima, Peru, as part of a 2020 cohort study during the COVID-19 pandemic. Genotyping data for these individuals are available through dbGaP.

  Study phs003718

• DIAMOND PCR : plasma DNA LINE-1 targeted bisulfite sequencing, a new non-invasive multi-cancer detection marker

  The detection of circulating tumor DNA, which allows non-invasive tumor molecular profiling and disease follow-up, promises optimal and individualized management of patients with cancer. However, detecting small fractions of tumor DNA released when the tumor burden is reduced remains a challenge. We developed a PCR-based targeted bisulfite method coupled to deep sequencing to detect methylation patterns of L1PA elements,which we named DIAMOND (for Detection of Long Interspersed Nuclear Element Altered Methylation ON plasma DNA). We used sodium bisulfite chemical conversion to achieve base-pair resolution analysis and designed a multiplexed PCR based on 8 amplicons covering L1PAs .

  Dataset EGAD50000000646

• Testicular large B-cell lymphoma is genetically similar to PCNSL and distinct from nodal DLBCL

  Next generation sequencing (NGS) data analyzed in Rivas-Delgado, López, et al. HemaSphere 2024. Single nucleotide variants (SNVs) and short insertions /deletions (indels) were evaluated in 42 samples using a B-cell malignancy-oriented targeted panel covering 115 genes (SureSelectXT, Agilent Technologies and sequenced in a MiSeq instrument (Illumina; 2x150bp; mean coverage of 599x). The NGS data of 39 samples is provided here. The 3 additional samples were previously published. Please, see the original publication for additional details.

  Study EGAS50000000521

• TIRE-seq: an Integrated Sample Extraction and Transcriptomics Workflow for High Throughput Perturbation Studies

  TIRE-seq is a novel RNA sequencing method that integrates mRNA purification directly into library preparation, eliminating separate RNA extraction. The technique demonstrated utility across three biological applications, including capturing transcriptional changes in human T cells, identifying genes driving murine dendritic cell differentiation, and analyzing the dose-response effects of temozolomide on patient-derived neurospheres. With its simplified approach and high sequencing efficiency, TIRE-seq offers a cost-effective solution for large-scale gene expression studies.

  Study EGAS50000000867

• PRADO trial - Personalized response-directed surgery and adjuvant therapy after neoadjuvant ipilimumab plus nivolumab in stage III melanoma

  The PRADO trial tested a personalized response-directed treatment approach based on the pathologic response after neoadjuvant ipilimumab plus nivolumab in stage III melanoma patients. In patients achieving a major pathologic response, in their index lymph node (the largest lymph node metastasis at baseline), therapeutic lymph node dissection (TLND) and adjuvant therapy were omitted. Patients with partial response underwent TLND only, whereas patients with pathologic non-response underwent TLND and adjuvant systemic therapy ± synchronous radiotherapy.

  Study EGAS50000000268

• Emirati Phased Diploid Trio-Assemblies

  This study, conducted under the Emirati Genome Project, aims to build a foundational pangenome reference to enable precision medicine in the United Arab Emirates. We generated phased diploid genome assemblies for 27 Emirati nationals using deep PacBio HiFi sequencing and a trio-based assembly procedure. In total, this produced 54 haplotype-resolved assemblies representing maternal and paternal genomes for each participant. The resulting high-quality reference captures population-specific genetic diversity and will accelerate translational research, variant interpretation, and genome-informed healthcare in the region.

  Study EGAS50000001234

• Filtered variants including SLC12A2 in patients with hearing loss

  Hereditary hearing loss is challenging to diagnose because of the heterogeneity of the causative genes. Further, some genes involved in hereditary hearing loss have yet to be identified. Using whole-exome analysis of three families with congenital, severe-to-profound hearing loss, we identified a missense variant of SLC12A2 in five affected members of one family showing a dominant inheritance mode, along with de novo splice-site and missense variants of SLC12A2 in two sporadic cases, as promising candidates associated with hearing loss.

  Study JGAS000379

• Transcriptome sequencing of fibroblast-dependent alveolar organoids derived from patient-specific iPS cells with SFTPC^Y104H variant and their gene-corrected (monoallelic wild type SFTPC) ones.

  A disease-specific iPS cell line derived from a pulmonary fibrosis patient with SFTPC^Y104H and its gene-corrected (monoallelic wild type SFTPC) one were established. Then lung progenitor cells were differentiated from each cell line and co-cultured with human fetal lung fibroblasts to generate alveolar organoids, respectively. Alveolar epithelial cells and fibroblasts were isolated by fluorescence-activated cell sorting and each RNA was extracted. We performed transcriptome analysis of those samples by RNA-sequencing.

  Study JGAS000617

• Immune Biomarkers in Metastatic Castration-resistant Prostate Cancer

  Background: Metastatic castration-resistant prostate cancer (mCRPC) is a heterogeneous disease in which molecular stratification is needed to improve clinical outcomes. The identification of predictive biomarkers can have a major impact on the care of these patients, but the availability of metastatic tissue samples for research in this setting is limited. Objective: To study the prevalence of immune biomarkers of potential clinical utility to immunotherapy in mCRPC by tumour RNA sequencing, and to determine their association with overall survival (OS).

  Study EGAS50000001269

• LCM-ATACseq on human lung macrophages

  In this study we employed Laser Capture Microdissection (LCM) for the multimodal profiling of lung macrophages cell populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (~100 cells) were collected from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation), and processed for ATAC-seq.

  Study EGAS00001006167

• iNeuron_RNAseq

  Characterisation of a timecourse of differentiation of induced cortical excitatory neurons generated by overexpression of the Ngn2 transcription factor transgenically in BOB iPSCs. The aim is to understand the differentiation trajectory undergone in this process, and characterise the transcriptome in these cells for further disease modelling. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001004238

• Whole_genome_sequence_of__third_generation_family_member__SFHS_

  Previously we performed deep WGS on 6 parents and 13 children from 3 large families from the Scottish Family Health Study to identify de novo mutations. This prelim is cover the additional sequencing of one grandchild from one of these three families. The inclusion of a third generation individual will provide additional experimental validation for the de novo mutations found in the initial trio. As in the previous study, the DNA will be WGS to a depth of approximately 25X to achieve this purpose.

  Study EGAS00001000429

• Comprehensive single-cell genome analysis at nucleotide resolution using the PTA Analysis Toolbox

  We developed a comprehensive bioinformatic workflow, called the PTA Analysis Toolbox (PTATO), to accurately detect single base substitutions, insertions-deletions (indels) and structural variants in PTA-based WGS data. PTATO includes a machine learning approach and filtering based on recurrency to distinguish PTA-artefacts from true mutations with high sensitivity (up to 90%), outperforming existing bioinformatic approaches. Our results show that PTATO enables studying somatic mutagenesis in the genomes of single cells with unprecedented sensitivity and accuracy.

  Study EGAS00001007288

• Investigation of different library preparation and tissue of origin deconvolution methods for urine and plasma cfDNA methylome analysis

  In this study, a single- and a double-stranded library preparation approach was evaluated with respect to their technical biases when applied on cfDNA from plasma and urine. This study thus outlines potential limitations of double-stranded library preparation for methylation analysis of cfDNA especially for urinary cfDNA. While the double-stranded method allows jagged end analysis in addition to TOO analysis, it leads to significant methylation bias in urinary cfDNA, which single-stranded methods can overcome.

  Study EGAS00001007314

• Fixative optimisation study for BRITROC project

  The British Translational Research Ovarian Cancer Collaborative (BriTROC), spanning more than 10 centres across UK, is a prospective observational project focused on relapsed high-grade serous ovarian cancer (HGSOC). The first study, as a part of the project, is the Fixative optimisation study, which analyses the utility for next-generation sequencing of UMFIX samples compared to NBF-fixed and fresh frozen samples. Various DNA and sequencing quality analyses were performed to compare fixation methods in bulk tumour and biopsy samples.

  Study EGAS00001001433

• Targeted sequencing of brain expressed miRNA genes

  As regulators of gene expression, microRNAs (miRNAs) are likely to play an important role in the development of disease. In this study we present a large-scale strategy to identify miRNAs with a role in the regulation of neuronal processes by screening 289 brain expressed miRNAs. Thereby we found variant rs7861254 located near the MIR204 gene to be significantly associated with schizophrenia. This variant resulted in reduced expression of miR-204 in neuronal-like SH-SY5Y cells.

  Study EGAS00001001607

• Egypt_Genome_Project___high_coverage_whole_genome_sequencing

  All humans outside Africa are descendants of the same single exit, usually dated at 50-70 thousand years ago. However, the route taken out of Africa is still debated. The two main candidates are a northern route via Egypt and the Levant, or a southern route via Ethiopia and the Arabian Peninsula. We are generating genetic data to evaluate these two possibilities. In this study we propose to generate high-coverage sequencing data for 3 Egyptian samples.

  Study EGAS00001000482

• Targeted_sequencing_of_genes_recurrently_mutated_in_AML___part2

  Genomic libraries will be generated from total genomic DNA derived from 4000 samples with Acute Myeloid Leukaemia. Libraries will be enriched for a selected panel of genes using a bespoke pulldown protocol. 64 Samples will be individually barcoded and subjected to up to one lanes of Illumina HiSeq. Paired reads will be mapped to build 37 of the human reference genome to facilitate the characterisation of known gene mutations in cancer as well as the validation of potentially novel variants identified by prior exome sequencing.

  Study EGAS00001000570

• WES sequencing of malignant peripheral nerve sheath tumours

  Investigate the genomic landscape of MPNST tumours. Cases where a diagnosis of MPNST had been considered in the differential diagnosis with a variable degree of confidence was included. The diagnosis of MPNST was excluded in 12/51 (49 cases had WES data) of the sequenced tumours following review of the pathology, new IHC, molecular tests and clinical information. Article: Lyskjær et al, 2020, J Pathol, "H3K27me3 expression and methylation status in histological variants of malignant peripheral nerve sheath tumours".

  Study EGAS00001004527

• Investigating_the_genetics_of_immunity_against_Salmonella_in_humans

  This study entails whole genome sequencing of an interleukin (IL)-12 b-1 receptor-deficient individual who presented with a chronic systemic Salmonella Enteritidis infection that did not resolve with standard IFNg and antibiotic treatment. Whole genome sequencing of the patient’s parents are also included.This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001001664

• We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas.

  Schwannomas are common peripheral nerve sheath tumors that can cause significant debilitating morbidities. We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas. Exome sequence analysis with validation by targeted DNA-sequencing of 125 samples uncovered, in addition to expected NF2 disruption additional recurrent mutations. RNA sequencing identified a recurrent in-frame SH3PXD2A-HTRA1 fusion in 12/125 (10%) cases, and genomic analysis demonstrated the mechanism as resulting from a balanced 19Mb chromosomal inversion on chromosome 10q.

  Study EGAS00001001886

• Mutational Landscape of Plasmablastic Lymphoma

  Plasmablastic lymphoma (PBL) represents a clinically heterogeneous subtype of aggressive B-cell non-Hodgkin lymphoma. Although targeted sequencing studies and a single center whole exome sequencing (WES) study in HIV+ patients recently revealed several genes, associated with PBL pathogenesis, the global mutational landscape and transcriptional profile of PBL remain elusive. To inform on disease-associated mutational drivers, mutational patterns and perturbed pathways in HIV+ and HIV- PBL we performed WES and RNA-sequencing (RNA-seq) of 34 PBL tumors.

  Study EGAS00001004906

• Blood RNA-seq from Mexican DMD patients and healthy controls

  These data are part of a study that aimed to assess the potential of blood RNA-seq to track non-invasively disease progression for DMD. In particular, here we focus on a study designed to compare gene expression in blood from DMD patients to that of healthy controls. These data are analysed in the following manuscript: Signorelli, M., Ebrahimpoor, M. et al. (accepted). Peripheral blood transcriptome profiling enables monitoring disease progression in dystrophic mice and patients. To appear in EMBO Molecular Medicine.

  Study EGAS00001004907

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Gene expression profiles of matched primary and recurrent fresh frozen tumor tissues from 66 HGSOC patients were obtained by RNA sequencing. RNA libraries were created using the Illumina TruSeq RNA sample preparation kit V2 according to the manufacturer’s instructions and sequenced on a HiSeq2000 (Illumina, California, USA) using a V3 flowcell generating 1 x 50 bp reads. Raw sequencing reads were mapped to the transcriptome and the human reference genome (NCBI37/hg19) using TopHat 2.0 and Bowtie 2.0.

  Study EGAS00001002660

• The WID-CIN test identifies women with, and at risk of, cervical intraepithelial neoplasia grade 3 and invasive cervical cancer (CIN3+)

  We analysed DNA methylation at >850,000 CpG sites across the genome using the Illumina EPIC array in a total of 1,254 cervical liquid-based cytology samples from cases of screen-detected histologically verified CIN1-3+ (98% hrHPV-positive) and population-based control women free from any cervical disease (100% hrHPV-positive). We developed the WID-CIN-test which is a DNA methylation signature consisting of 5,000 CpG sites.

  Study EGAS00001005078

• Sequencing of an adolescent patient with germline RET mutant alveolar rhabdomyosarcoma

  An adolescent patient presented with an alveolar rhabdomyosarcoma made more unique by the presence of a germline RET mutation ordinarily associated with and a known driver of multiple endocrine neoplasia type 2A (MEN2A) cancer. To better understand the role of this germline RET mutation in the genetics and phenotypic response of this unique alveolar rhabdomyosarcoma, we performed DNA and RNA sequencing of the patients in addition to functional studies on patient-derived cultures and genetically similar similar cell models.

  Study EGAS00001004359

• 46 CLL Whole Genome Sequencing Study

  Chronic lymphocytic leukaemia (CLL) consists of two biologically and clinically distinct subtypes defined by the abundance of somatic hypermutation (SHM) affecting the Ig variable heavy-chain locus (IgHV). The molecular mechanisms underlying these subtypes are incompletely understood. Here, we present a comprehensive whole-genome sequencing analysis of somatically acquired genetic events from 46 CLL patients, including a systematic comparison of coding and non-coding single nucleotide variants, copy number variants and structural variants, regions of kataegis and mutation signatures between IgHVmut and IgHVunmut subtypes.

  Study EGAS00001003254

• Identifying the role of ID3 in DNA repair and maintenance of genome integrity

  The inhibitor of DNA-binding 3 (ID3) is a transcriptional repressor protein that limits the binding of basic helix­loop-helix (bHLH) transcription factors to DNA. Preliminary results from our lab confirm that cellular depletion of ID3 is associated with an impaired DNA damage response. we hypothesize that ID3 has the potential to epigenetically affect DNA repair. This is based on our observation that upon cellular ID3 knockdown, a reduction of chromatin-bound H4K16ac and H3K36me3.

  Study EGAS00001004478

• Molecular analysis of FIT interval colorectal cancers

  To optimize a fecal immunochemical test-based screening program, the rate of missed colorectal cancers (CRCs), so-called FIT-interval CRCs, should be minimized. A specific molecular make-up of those CRCs could be an explanation for those interval CRCs. Knowledge of the molecular make-up of these missed lesions could facilitate more accurate detection of all precursor lesions. In this study we aimed to compare the molecular make-up of FIT-interval CRCs and screen-detected CRCs (SD-CRCs).

  Study EGAS00001004683

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• Induced pluripotent stem cell lines (iPSC lines) produced from skin and blood cells.

  The IMBA stem cell bank, iPSC Biobank, is a collection of induced pluripotent stem cell lines (iPSC lines) produced from skin and blood cells. The iPSC Biobank is integrated into the IMBA Stem Cell Core Facility. It stores and provides high-quality reference control panels of iPSC clones as a tool to the research community. The resource is available to all scientists and commercial institutions. The ethical guidelines of the iPSC Biobank are always based on prevailing laws and internal regulations.

  Study EGAS00001006262

• Human pan-cancer plasma cfRNA study - raw data

  This study contains mRNA capture sequencing data from plasma of 266 different human donors. The first, pan-cancer, cohort covers 25 high-grade to metastatic cancer types (8 cancer patients per type) and a control group (8 healthy donors). The validation cohort comprises additional plasma samples from ovarian, prostate and uterine cancer patients (12 per type) as well as additional samples from controls (22 new and 8 repeated). Samples were sequenced on a NovaSeq 6000 and are provided in FASTQ format.

  Study EGAS00001006755

• Whole exome sequencing identifies clinically relevant mutational signatures in resected hepatocellular carcinoma

  We conducted a multicentre pilot study on patients with localized HCC following complete radiological response to surgical resection. Patients received 250 mg oral gefitinib once daily as adjuvant therapy, up to a maximum of 6 months. The clinical endpoints included recurrence-free survival (RFS) and overall survival (OS), and correlative genetic analyses were conducted from whole exome sequencing data (n=33). All statistical analyses were carried out on an intention-to-treat basis. The study is registered with ClinicalTrials.gov (NCT00282100).

  Study EGAS00001004371

• Molecular analysis of cancer genomes in children with Lynch syndrome: exploring causal associations

  Lynch syndrome (LS) predisposes to cancer in adulthood and is caused by heterozygous germline variants in a mismatch repair (MMR) gene. Recent studies show an increased prevalence of LS among children with cancer, suggesting a causal relationship. For LS-spectrum (LSS) cancers, including high-grade gliomas and colorectal cancer, causality has been supported by typical MMR-related tumor characteristics, but for non-LSS cancers, causality is unclear. This dataset contains 5 patients with Lynch Syndrome from the INFORM registry.

  Study EGAS00001007146

• Blood neutrophils in COPD derive from activated progenitors in the bone marrow

  Chronic obstructive pulmonary disease (COPD) is a major respiratory disease characterized by small airway inflammation, emphysema and severe breathing difficulties. Low-grade systemic inflammation is an established hallmark of severe disease, however, the molecular changes in peripheral immune cells remain far from understood. We combined multi-color flow cytometry with single-cell RNA sequencing and showed that blood neutrophil numbers are significantly increased in COPD and they are a heterogeneous population. A transcriptomic state that expressed interferon response genes correlated with alveolar damage and acute exacerbations. Furthermore, bronchoalveolar neutrophils expressed gene signatures corresponding to certain blood neutrophil states. Last, our data in a murine model of cigarette smoke exposure demonstrated that bone marrow neutrophil progenitors are expanded in smoke-treated animals and display signs of immune activation. Our study provides evidence that COPD systemic inflammation may derive from an activated haematopoietic precursor compartment.

  Dataset EGAD00001008788

• Targeted DNA panel sequencing analysis of PanNEN tumors of varying grades using custom and commercial panels

  Targeted panel sequencing data from PanNEN samples. Sample ID is annotated in the following manner: each patient is given a number and "P" is appended to the patient number if it is a primary tumor, "M” if it is metastasis and "N" if it is normal (healthy tissue) sample. All NETG1 and NETG2 samples underwent panel sequencing using a custom panel (in-house PanNEN panel). All NEC and NETG3 samples (except PNET2, PNET77P and PNET77M) underwent panel sequencing using a commercial CCP panel.

  Dataset EGAD00001008432

• Blood neutrophils in COPD derive from activated progenitors in the bone marrow sc Seqwell

  Chronic obstructive pulmonary disease (COPD) is a major respiratory disease characterized by small airway inflammation, emphysema and severe breathing difficulties. Low-grade systemic inflammation is an established hallmark of severe disease, however, the molecular changes in peripheral immune cells remain far from understood. We combined multi-color flow cytometry with single-cell RNA sequencing and showed that blood neutrophil numbers are significantly increased in COPD and they are a heterogeneous population. A transcriptomic state that expressed interferon response genes correlated with alveolar damage and acute exacerbations. Furthermore, bronchoalveolar neutrophils expressed gene signatures corresponding to certain blood neutrophil states. Last, our data in a murine model of cigarette smoke exposure demonstrated that bone marrow neutrophil progenitors are expanded in smoke-treated animals and display signs of immune activation. Our study provides evidence that COPD systemic inflammation may derive from an activated haematopoietic precursor compartment.

  Dataset EGAD00001008908

• Blood neutrophils in COPD derive from activated progenitors in the bone marrow sc Rhapsody

  Chronic obstructive pulmonary disease (COPD) is a major respiratory disease characterized by small airway inflammation, emphysema and severe breathing difficulties. Low-grade systemic inflammation is an established hallmark of severe disease, however, the molecular changes in peripheral immune cells remain far from understood. We combined multi-color flow cytometry with single-cell RNA sequencing and showed that blood neutrophil numbers are significantly increased in COPD and they are a heterogeneous population. A transcriptomic state that expressed interferon response genes correlated with alveolar damage and acute exacerbations. Furthermore, bronchoalveolar neutrophils expressed gene signatures corresponding to certain blood neutrophil states. Last, our data in a murine model of cigarette smoke exposure demonstrated that bone marrow neutrophil progenitors are expanded in smoke-treated animals and display signs of immune activation. Our study provides evidence that COPD systemic inflammation may derive from an activated haematopoietic precursor compartment.

  Dataset EGAD00001009704

• The landscape of somatic mutation in normal colorectal epithelial cells

  The colorectal adenoma-carcinoma sequence has provided a paradigmatic framework for understanding the successive somatic genetic events and consequent clonal expansions leading to cancer. As for most cancer types, however, understanding of the earliest phases of colorectal neoplastic change, which may occur in morphologically normal tissue, is comparatively limited because of the difficulty of detecting somatic mutations in normal cells. Each colorectal crypt is a small clone of cells derived from a single recently-existing stem cell. Here, we sequenced hundreds of normal crypts from 42 individuals. Signatures of multiple mutational processes were revealed, some ubiquitous and continuous, others only found in some individuals, in some crypts or during some phases of the cell lineage from zygote to adult cell. Likely driver mutations were present in ~1% of normal colorectal crypts in middle-aged individuals, indicating that adenomas and carcinomas are rare outcomes of a pervasive process of neoplastic change across morphologically normal colorectal epithelium.

  Dataset EGAD00001004193

• Next Generation Sequencing in an IBD Pedigree Whole Genome Data

  In 2009 we identified a four-generation family with over 700 members and 41 affected with Crohn's disease (CD). At the time we sequenced the exome of 6 affected individuals but did not identify any coding variants which appear to explain the high prevalence of disease. Since then we have collected DNA from a large number of additional family members, genotyped linkage arrays on the entire family to refine genomic regions shared by identity by descent and genotyped affected and unaffected members at known CD risk loci identified by Genome Wide Association Studies (GWAS). These analyses have confirmed that a significant unexplained excess of disease remains after accounting for all known genetic factors, and that several regions of the genome are shared by a large fraction of affected individuals. We therefore perform whole genomes sequencing from 8 individuals which will allow us to impute the complete sequence of nearly all the members of the two largest and most severely affected branches of the family.

  Dataset EGAD00001000399

• Genomic Landscape of Human Skin at a Single-Cell Resolution

  Every cell in the human body has a unique set of somatic mutations, yet it remains difficult to comprehensively genotype an individual cell. Here, we developed solutions to overcome this obstacle in the context of normal human skin, thus offering the first glimpse into the genomic landscapes of melanocytes at single-cell resolution. We comprehensively genotyped 133 melanocytes from 19 sites across 6 donors. As expected, sun-shielded melanocytes had fewer mutations than sun-exposed melanocytes. However, within sun-exposed sites, melanocytes on chronically sun-exposed skin (e.g. the face) displayed a lower mutation burden than melanocytes on intermittently sun-exposed skin (e.g. the back). Melanocytes from donors with a history of skin cancer had higher mutation burdens than melanocytes from donors without skin cancer, implying that the mutation burden of normal skin can be harnessed to measure cumulative sun damage and skin cancer risk. Moreover, melanocytes from healthy skin commonly harbor pathogenic mutations, likely explaining the origins of the melanomas that arise in the absence of a pre-existing nevus. Phylogenetic analyses identified groups of related melanocytes, suggesting that melanocytes spread throughout skin as fields of clonally related cells, invisible to the naked eye. Overall, our study offers an unprecedented view into the genomic landscapes of individual melanocytes, revealing key insights into the causes and origins of melanoma.

  Study phs001979

• Mid-pass Whole-genome Sequencing in a Malagasy Cohort Uncovers Body Composition Associations

  The majority of human genomic research studies have been conducted in European-ancestry cohorts, reducing the likelihood of detecting potentially novel and globally impactful findings. Here, we present mid-pass whole-genome sequencing data and a genome-wide association study in a cohort of 264 self-reported Malagasy individuals from three locations on the island of Madagascar. We describe genetic variation in this Malagasy cohort, providing insight into the shared and unique patterns of genetic variation across the island. We observe phenotypic variation by location, and find high rates of hypertension particularly in the Southern Highlands sampling site as well as elevated self-reported malaria prevalence in the West Coast site relative to other sites. After filtering to a subset of 214 minimally-related individuals, we find a number of genetic associations with body composition traits, including many variants that are only observed in African populations or populations with admixed African ancestry from the 1000 Genomes Project. This study highlights the importance of including diverse populations in genomic research for the potential to gain novel insights, even with small cohort sizes. This project was conducted in partnership and consultation with local stakeholders in Madagascar and serves as an example of genomic research that prioritizes community engagement and that has potential impacts on our understanding of human health and disease.

  Study EGAS50000000496

• A comprehensive DNA methylation landscape of human and mouse cell lines derived from hematological malignancies

  Human cancer cell lines constitute useful models to study the primary disease and many relevant findings in tumor biology have been originated from them since the first immortalized cell line (HeLa) was obtained. The easy experimental intervention, the purity of the transformed cells and their versatility to undergo high-throughput screenings represent advantageous features of the established cancer cell lines. In recent years, major efforts have characterized in detail the multiomics make-up of hundreds of cancer cell lines and studied their association with sensitivity to anticancer drugs. Most of these studies have been genetic-centric and have not characterized in detail the epigenetic profiles underlying the characteristics of these cells or their impact on the efficacy of antitumoral compounds. In this regard, a past version of a DNA methylation microarray or a less accessible and more time-consuming such as reduced representation bisulfite sequencing have been used in those attempts to interrogate the epigenetic setting. Herein, we have obtained the DNA methylation profiles of 210 cell lines derived from hematological malignancies utilizing comprehensive DNA methylation microarrays that interrogates more than 850,000 and 285,000 CpG sites from human and mouse genomes, respectively. Importantly, we also provide a pharmacoepigenetic example of the potential use of this resource by showing how DNA methylation can predict response to nucleoside analogues.

  Study EGAS50000000627

• DUX4 activates novel intergenic transcripts and isoforms in a tissue-specific context

  DUX4, a transcription factor driving zygotic genome activation during the embryonic cleavage stage in mammals, regulates the expression of genic and non-genic elements and modulates chromatin accessibility. Its misexpression in skeletal muscle causes Facioscapulohumeral muscular dystrophy (FSHD). The sporadic expression of DUX4 in FSHD muscle and the limitations of short-read RNA sequencing challenge, however, a comprehensive grasp of its consequences on the muscle transcriptome. Here, leveraging full-length isoform RNA sequencing with short-read RNA sequencing on DUX4-inducible myoblasts, we elucidated DUX4-induced transcriptomic changes within a myogenic context. DUX4 yields a complex transcriptome featuring numerous unannotated isoforms from known and novel loci. Moreover, we observed distinct isoform usage of DUX4 target genes between myogenic and embryonic cleavage states highlighting the distinct differences between DUX4 transcription factor activity in skeletal muscle and during the cleavage stage. We also identified ~1,400 unannotated intergenic isoforms predominantly originating from repetitive elements such as LTRs, LINEs, and SINEs. Integration with available datasets delineates the transcriptional and epigenetic landscape of these loci across myogenic and embryonic backgrounds. Like the cell type-specific isoform production, the usage of DUX4 binding sites at these intergenic loci is in part cell type-specific. Collectively, these findings demonstrate substantial and context-specific transcriptomic alterations induced by DUX4 further enriching our understanding of DUX4-induced muscle pathology.

  Study EGAS50000000503

• What is metadata?

  What is metadata? Data represents units of information and metadata can be seen, simply put, as data about other data. For example, in a simple experiment in which a patient genome was sequenced, there are multiple and diverse fields of metadata: from the biological sex of the patient to the sequencing platform used. Another way to understand metadata, following our genomic experiment example, is going through the different layers of (meta)data: One of the basic units of information (data) would be the sequence of nucleotides (e.g. GCTGG and GCCGG). This DNA sequence can be contextualised within a chromosome by providing its locus (e.g. β-globin gene). This data, the locus, is about other data, the sequence of nucleotides, which would render it metadata. We can go one step further, and provide more context, by giving the associated phenotype of each of these sequences: GCTGG corresponds to a healthy individual, while GCCGG corresponds to a person with β-thalassaemia. Once again, this data is contextualising the data we have provided up to this point, which makes it metadata. With this simple example, what we are doing is adding layers of data that describe the ones below. Had we given the sequences alone, little would be possible from the researchers' point of view. But, now that the data has its accompanying metadata, a researcher could compare both sequences and their phenotypes to infer a possible cause of the disorder. Each layer of information broadens the possible applications of the data. Now that we know what metadata is, it is time to emphasise the importance of submitting good quality metadata. The quality of the metadata will determine whether the data is usable, discoverable, and interpretable by researchers and clinicians. One example that highlights the importance of good quality metadata is the description of biological sex of a patient: while the terms "female," "girl," or "woman" all represent the same concept, they are not harmonised. These different representations of a concept can create confusion and errors in data analysis. By applying standard definitions and terminologies to biological sex metadata, we can avoid misunderstandings and facilitate the integration of different datasets.  In order to comply with the FAIR principles and, more specifically, to allow for the (meta)data to be interoperable (i.e. used universally and unambiguously), we need to place some standards onto the (meta)data EGA  archives. These can be as simple as asserting that the given patient's biological sex is one of the correct terms (e.g. female or male); or as complex as multiple layers and combinations of validation steps with existing records. You can find further details on how EGA manages these standards on our metadata model page.

  Documentation submission/metadata/what-is-metadata

• A Cancer Cell-Line Titration Series for Evaluating Somatic Classification

  Accurate detection of somatic single nucleotide variants and small insertions and deletions from DNA sequencing experiments of tumour-normal pairs is a challenging task. Tumour samples are often contaminated with normal cells confounding the available evidence for the somatic variants. Furthermore, tumours are heterogeneous so sub-clonal variants are observed at reduced allele frequencies. We present here a cell-line titration series dataset that can be used to evaluate somatic variant calling pipelines with the goal of reliably calling true somatic mutations at low allele frequencies. Cell-line DNA was mixed with matched normal DNA at 8 different ratios to generate samples with known tumour cellularities, and exome sequenced on Illumina HiSeq to depths of >300x. The data was processed with several different variant calling pipelines and verification experiments were performed to assay >1,500 somatic variant candidates using Ion Torrent PGM as an orthogonal technology. By examining the variants called at varying cellularities and depths of coverage, we show that the best performing pipelines are able to maintain a high level of precision at any cellularity. In addition, we estimate the number of true somatic variants undetected as cellularity and coverage decrease. Our cell-line titration series dataset, along with the associated verification results, is effective for this evaluation and will serve as a valuable dataset for future somatic calling algorithm development.

  Study EGAS00001001016

• Double mutant DNMT3A AML: a unique subtype

  Mutation of DNMT3A, encoding a de novo methyltransferase essential for cytosine methylation, is a common early event in clonal hematopoiesis (CH) and adult acute myeloid leukemia (AML). Spontaneous deamination of methylated cytosines damages DNA, which is repaired by the base excision repair (BER) enzymes MBD4 and TDG. Congenital MBD4-deficiency has been linked to early-onset CH and AML, and is marked by exceedingly high levels of DNA damage and mutation of DNMT3A. Strikingly, wildtype (WT) DNMT3A binds TDG, thereby potentiating its repair activity. Since TDG is the only remaining BER enzyme in MBD4-deficient AML patients capable of repairing methylation damage, we investigated whether mutant DNMT3A negatively affects the repair function of TDG. We found that, whereas WT DNMT3A stimulates TDG function, mutant DNMT3A impairs TDG-mediated repair of DNA damage in vitro. In light of this finding and to extrapolate our observations to the broader AML patient population, we investigate here the genetic profiles and survival outcomes of AML patients with single (SM) versus double mutant (DM) DNMT3A. DM DNMT3A AML patients show a characteristic driver mutation landscape and reduced overall survival when compared to SM DNMT3A AML patients. Importantly, whole-genome sequencing showed a trend for increased DNA damage in primary DM DNMT3A AML samples, especially when DNMT3A mutations are located at the DNMT3A-TDG interaction interface.

  Study EGAS00001007966

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497