12405 results for ""non-traditional+communal+storytelling+approach"+novel+segment+noted+in+critical+commentary"

in 37.49 milliseconds.

• Functional genomics approaches to understand osteoarthritis (2019-08-01)

  The aim of this work is to apply an integrated systems approach to understand the biological underpinnings of large joint (hip and knee) osteoarthritis which culminates in the need for total joint replacement (TJR). We will obtain diseased and non-diseased cartilage as well as other disease-relevant tissue following TJR, coupled with a blood sample. We will generate genotype data and will characterise the pairs of diseased and non-diseased tissue samples in terms of methylation, transcription (RNASeq) and expression (quantitative proteomics). We will apply integrative approaches to combine information across the omics levels to characterise genes, pathways, and networks that underlie osteoarthritis progression. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ . This dataset contains all the data available for this study on 2019-08-01.

  Dataset EGAD00001005215

• Subclonal diversification of primary breast cancer

  Cancers are ecosystems of genetically related clones, competing across space and time for limited resources. To understand the clonal structure of primary breast cancer, we applied genome and targeted sequencing to 295 samples from 49 patients’ tumors. The extent of subclonal diversification varied considerably among patients and encompassed many spatial patterns, including local growth, intraductal dissemination and clonal intermixture. Landmarks of disease progression, such as acquiring invasive or metastatic potential, arose within detectable subclones of antecedent lesions, suggesting that subclonal mutations could be relevant if actionable. No defined temporal order of mutation was evident, with the commonest genes, including PIK3CA, TP53, BRCA2, PTEN and MYC, mutated early in some, late in others, often exhibiting parallel evolution across subclones. Signatures of homologous recombination deficiency correlated with response to neoadjuvant chemotherapy. Thus, the interplay of mutation, growth and competition drives clonal structures of breast cancer that are complex, variable across patients and clinically relevant.

  Dataset EGAD00001000965

• Next Generation Sequencing in an IBD Pedigree Whole Genome Data

  In 2009 we identified a four-generation family with over 700 members and 41 affected with Crohn's disease (CD). At the time we sequenced the exome of 6 affected individuals but did not identify any coding variants which appear to explain the high prevalence of disease. Since then we have collected DNA from a large number of additional family members, genotyped linkage arrays on the entire family to refine genomic regions shared by identity by descent and genotyped affected and unaffected members at known CD risk loci identified by Genome Wide Association Studies (GWAS). These analyses have confirmed that a significant unexplained excess of disease remains after accounting for all known genetic factors, and that several regions of the genome are shared by a large fraction of affected individuals. We therefore perform whole genomes sequencing from 8 individuals which will allow us to impute the complete sequence of nearly all the members of the two largest and most severely affected branches of the family.

  Dataset EGAD00001000399

• INSPIRE multi-timepoint cfMeDIP dataset

  This dataset contains raw sequencing data from multi-timepoint cell-free methylated DNA immunoprecipitation and sequencing (cfMeDIP-seq) of plasma samples from the INSPIRE study (NCT02644369). Details about the study, including inclusion/exclusion criteria and interventions are available at https://clinicaltrials.gov/study/NCT02644369. Briefly, five cohorts were included, INS-A (head & neck squamous cell carcinoma), INS-B (triple-negative breast cancer), INS-C (high-grade serous ovarian cancer), INS-D (melanoma), and INS-E (mixed solid tumors). All patients in the study were diagnosed with advanced cancer and received treatment with pembrolizumab. Plasma samples were collected at baseline and every 3 cycles until disease progression, death, loss of follow-up, or completion of the study. Plasma samples were first processed for cell-free DNA mutations and remaining samples were then processed by cfMeDIP-seq, prioritizing baseline and post-cycle 3 samples. In total, data from 204 timepoints from 87 distinct patients are deposited.

  Dataset EGAD00001011312

• This study aims to evaluate the relationship between cardiometabolic risk factors and the most common genetic variation (SNPs)

  Comprehensive data on lifestyle-related modifiable factors, sociodemographic, anthropometric, economic, biochemical, and genetic markers related to the occurrence of cardiometabolic diseases as part of the observational cross-sectional survey “2015 Health Survey of Sao Paulo with Focus on Nutrition (2015 ISA-Nutrition)”, a population-based study. Data of 805218 SNPs for 841 individuals was genotyped using the Axiom™ 2.0 Precision Medicine Research Array in the Thermo Fisher Scientific laboratory (Affymetrix Inc, Santa Clara, CA).

  Study EGAS00001007818

• Cold Ischemia Study

  This study aimed to evaluate the impact of cold ischemia time on the expression of cancer-related genes, particularly those involved in hypoxia, apoptosis, and epithelial-to-mesenchymal transition (EMT). We performed RNA sequencing on 54 normal colon mucosa samples from nine patients undergoing colorectal cancer surgeries, freezing samples at predefined intervals ranging from 0 to 60 minutes. A total of 44 differentially expressed genes (DEGs) (p < 0.05) were identified when comparing samples frozen immediately (T0) with those frozen after 60 minutes (T5).

  Study EGAS00001008233

• NHLBI TOPMed - NHGRI CCDG: Early-onset Atrial Fibrillation in the CATHeterization GENetics (CATHGEN) Cohort

  The CATHeterization GENetics (CATHGEN) biorepository collected biospecimens and clinical data on individuals age ≥18 undergoing cardiac catheterization for concern of ischemic heart disease at a single center (Duke University Medical Center) from 2000-2010; a total of N=9334 individuals were collected. Samples were matched at the individual level to clinical data collected at the time of catheterization and stored in the Duke Databank for Cardiovascular Diseases (DDCD). Clinical data included subject demographics, cardiometabolic risk factors, cardiac history including symptoms, age-of-onset of cardiovascular diseases, coronary anatomy and cardiac function at catheterization, laboratory data, and yearly follow-up for hospitalizations, vital status, medication use and lifestyle factors. AF cases were defined as individuals who had ever had AF based on any ECG available at Duke University or ICD-9 code for AF used for inpatient or outpatient billing.

  Study phs001600

• Genetics of Hypertension Associated Treatment (GenHAT) Study, Genomic Background of Blood Pressure Response to Treatment in African Americans

  The GenHAT study is an ancillary pharmacogenomics study to the Antihypertensive and Lipid Lowering Treatment to Prevent Heart Attack Trial (ALLHAT). ALLHAT was a randomized, double-blind, multi-center trial that enrolled 42,418 participants ≥55 years of age with hypertension and at least one additional risk factor for cardiovascular disease (CVD). Participants were randomized to treatment with one of four primary antihypertensive drugs: chlorthalidone (thiazide-like diuretic), amlodipine (CCB), lisinopril (ACE-i), or doxazosin (alpha-adrenergic blocker) in a ratio of 1.7:1:1:1, respectively. Participants were followed for treatment response and CVD outcomes. The original GenHAT study (N=39,114) evaluated the association of candidate hypertensive genetic variants with CVD outcomes for participants consenting to genetic research. The current GWAS study focuses on a subset of African American GenHAT participants (n=6908).  

  Study phs002716

• NHLBI TOPMed - NHGRI CCDG: Genes-Environments and Admixture in Latino Asthmatics (GALA II)

  This is a case-only pharmacogenetic study of bronchodilator drug response among racially admixed Latino children with asthma. Each participant had two spirometry measurements using the KoKo PFT System. With the first spirometry test, participant was administered with 4 puffs of HFA Albuterol. The second albuterol measurement was based on age, for participants under 16 years of age, additional 2 puffs were administered and for those over 16 years of age, additional 4 puffs were administered. The overall goal is to identify genetic factors which are predictive of drug response in children with asthma. The principal tools include a questionnaire and biological specimen collection. Participants are 8-21 years old at time of recruitment. Children with asthma have physician-diagnosed asthma, symptoms and medications. Comprehensive phenotypic data for GALAII study participants are available through dbGaP phs001180.

  Study phs000920

• Immune Determinants of Resistance to PD-1 Blockade in Renal Cell Carcinoma

  We performed an integrated bulk and single-cell transcriptomic analysis of tumors from 102 advanced renal cell carcinoma patients enrolled in a phase II clinical trial of frontline nivolumab (NCT03117309) to investigate determinants of response to anti-PD1 monotherapy. The present study includes 112 archival or pre-treatment tumors of clear cell and non-clear cell histologies from 90 patients that underwent bulk RNA sequencing (RNA-seq). For 76 patients, 74 of whom had matched RNA-seq, whole exome sequencing (WES) was also performed on tumor samples as well as matched peripheral blood. Additionally, 19 fresh tumor samples from 17 patients, including pre and post-treatment samples and mixed histologies, were locally cryopreserved and centrally processed for single cell RNA (scRNA-seq) and TCR (scTCR-seq) sequencing. 7 patients had matched scRNA/scTCRseq, RNAseq, and WES.

  Study phs003618

• Immediate Postoperative Minimal Residual Disease Detection with MAESTRO Predicts Recurrence and Survival in Head and Neck Cancer Patients Treated with Surgery

  We selected 24 patients with locally advanced head and neck squamous cell carcinoma (HNSCC) who were surgically treated. MAESTRO, our ultrasensitive, tumor-informed, mutation enrichment sequencing assay, was applied in a pooled format (MAESTRO-Pool) to plasma samples collected from these patients at baseline (pre-op) and postoperatively. We show that detection of circulating tumor DNA (ctDNA) 1 to 9 days after surgery is associated with significantly worse survival. Many plasma samples also had tumor fractions detected below 100 parts-per-million, the detection limit for first-generation commercial assays, highlighting the need for more sensitive ctDNA assays. Here we provide whole genome sequencing of matched tumor biopsy and normal germline DNA from 24 patients that were used to identify somatic single nucleotide variants (SNVs) to be tracked using our MAESTRO-Pool assay.

  Study phs003981

• Genetics of gene expression in primary human immune cells

  The purpose of this study was to identify cell specific expression quantitative trait loci in freshly isolated highly purified primary B-cells and monocytes from healthy subjects of European ancestry. Cells were purified from Ficoll gradient prepared peripheral blood mononuclear cell fractions using positive selection via magnetic bead labelling of the B-cell marker CD19 and monocyte marker CD14. RNA was extracted from 287 B-cell samples and 288 monocyte samples. RNA was then hybridised to HumanHT-12 v4 BeadChips whole genome expression arrays (Illumina). Individuals were genotyped on HumanOmniExpress-12v1.0 BeadChips (Illumina) at 733202 genetic markers. Data presented include the raw expression values and Robust Spline Normalised values (RSN) for expression for each cell type per individual. Additional genotype data per individual is available on request.

  Study EGAS00000000109

• Single-nucleus brain transcriptomics reveals microglia dysfunction in Multiple System Atrophy

  Multiple System Atrophy (MSA) is a rare, age-related neurodegenerative disease that shares clinical and pathological features with Parkinson’s disease (PD) but presents a more devastating disease course. To elucidate the distinct cellular pathophysiology underlying multiple system atrophy (MSA) or Parkinson's disease (PD), we performed single-nucleus RNA sequencing on postmortem striatal brain tissue from 7 MSA and 12 PD patients, and 10 non-neurological cases. Using 10x Genomics Chromium Next GEM Single Cell 3' Reagent Kits v3.1, we isolated 130k nuclei covering all major cell types of the striatum. We performed state-of-the-art bioinformatic analyses on the data followed by orthogonal analyses to validate our findings. We identified a disease-specific activation of microglia cells distinguishing the two diseases and possibly explaining some of the detrimental effects observed in both.

  Study EGAS50000001406

• Translational analyses from a phase II study of pembrolizumab and epigenetic modification with azacitidine in platinum-resistant epithelial ovarian cancer

  Epigenetic modulators may sensitize platinum-resistant ovarian cancer (PROC) to immune checkpoint inhibition by reprogramming the tumor microenvironment. We report clinical and translational findings from a phase II non-randomized study of pembrolizumab and oral azacytidine in 34 women with PROC (NCT02900560). The effect of combined epigenetic and immunotherapy was evaluated by transcriptomic analyses of serially biopsied tumors. Differential gene expression analyses revealed an upregulation of inflammatory and cytolytic genes and co-inhibitory checkpoints 6 weeks on-therapy. Upregulation of interferon signaling, antigen presentation and immune cell adhesion and migration gene sets was prominent on-therapy, together with an increased density of CD8+ T -cells. Patients with a CA-125 and/or clinical response showed an enrichment of adaptive and conserved immune response gene sets on-therapy.

  Study EGAS50000001165

• Raw human sequencing data for “Characterization of intestinal immune responses in generalized human and murine lipodystrophy”

  This dataset contains raw FASTQ files generated from peripheral blood and intestinal biopsy samples collected for the study “Characterization of intestinal immune responses in generalized human and murine lipodystrophy.” Peripheral blood sequencing was performed on samples from three healthy donors as controls and from a patient with acquired generalized lipodystrophy and Crohn’s disease (AGLCD) at two distinct timepoints. Intestinal biopsy–derived immune cells were sequenced from three individuals with Crohn’s disease as disease controls, as well as from the AGLCD patient (single timepoint). The data include paired-end FASTQ files derived from single-cell RNA sequencing and T-cell receptor repertoire profiling, enabling analyses of immune composition, transcriptional states, and clonal T-cell expansion. All data are controlled-access human genomic datasets and require appropriate authorization for secondary use.

  Study EGAS50000001517

• BCR-ABL is enriched in S- and G2-cell cycle phases

  To address the unusually long duration of imatinib therapy for chronic myelogenous leukemia, we sought to understand the expression of BCR-ABL gene expression with different phases of the cell cycle. A precedent for dynamic fusion oncoprotein expression already exists for the pediatric solid tumor, rhabdomyosarcoma. Quantitative immunocytochemistry was conducted to compare the expression of BCR-ABL with markers of each cell cycle phase: CDK6 for G1, CDK2 for S, phospho-CDC2 for G2, and phospho-HH3 for M phase. BCR-ABL expression was most strongly correlated with the G2 and S cell cycle phases. Low BCR-ABL expression only coincided with high cell cycle marker expression for the G1. BCR-ABL was rarely if at all expressed in M. Our results suggest a possible explanation for the prolonged nature of imatinib therapy, which may be only effective on S- and G2-phase actively replicating leukemia cells.

  Study EGAS00001006769

• Reconstructing the dispersals and adaptive history of Bantu-speaking populations in Africa and North America

  Bantu languages are spoken by ~310 million Africans, yet the genetic history of Bantu-speaking populations remains largely unexplored. We generated genomic data for 1,318 individuals from 35 populations in western central Africa, where Bantu languages originated. We found that early Bantu speakers first moved southward, through the equatorial rainforest, before spreading toward eastern and southern Africa. We also found that genetic adaptation of Bantu speakers was facilitated by admixture with autochthonous populations, particularly for the HLA and LCT loci. Finally, we identified a major contribution of western central African Bantu speakers to the ancestry of African Americans, whose genomes present no strong signals of natural selection. Together, these results highlight the contribution of Bantu-speaking peoples to the complex genetic history of Africans and African Americans.

  Study EGAS00001002078

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• Erythroid/megakaryocytic differentiation confers BCL-XL dependency and venetoclax resistance in acute myeloid leukemia

  Myeloid neoplasms with erythroid or megakaryocytic differentiation include pure erythroid leukemia (PEL), myelodysplastic syndrome (MDS) with erythroid features, and acute megakaryoblastic leukemia (FAB M7) and are characterized by poor prognosis and limited treatment options. Here, we investigate the drug sensitivity landscape of these rare malignancies. We show that acute myeloid leukemia (AML) cells with erythroid or megakaryocytic differentiation depend on the anti-apoptotic protein BCL-XL, rather than BCL-2, using combined ex vivo drug sensitivity testing, genetic perturbation, and transcriptomic profiling. Single-cell and bulk transcriptomics of patient samples with erythroid and megakaryoblastic leukemias identified high BCL2L1 expression compared to other subtypes of AML and other hematological malignancies, where BCL2 and MCL1 were more prominent. Our results suggest targeting BCL-XL as a potential therapy option in erythroid/megakaryoblastic leukemias and highlight an AML subgroup with potentially reduced sensitivity to venetoclax-based treatments.

  Study EGAS00001006819

• Characterization of Cell Free Plasma Methyl-DNA From Xenografted Tumors to Guide the Selection of Diagnostic Markers for Early-Stage Cancers

  Circulating cell-free methyl-DNA (mcfDNA) contains promising cancer markers but its low abundance and possibly diverse origin pose challenges toward the accurate diagnosis of early stage cancers. By whole-genome bisulfite sequencing (WGBS) of cell-free DNA (cfDNA) from about 0.5 mL plasma of mice xenografted with human tumors, we obtained and aligned the reads to the human genome, filtered out the mouse and carrier bacterial sequences, and confirmed the tumor origin of methyl-cfDNA (mctDNA) by methylation-sensitive restriction enzyme digestion prior to species-specific PCR. We estimated that human tumor-specific reads (ctDNA) or mctDNA comprised about 0.29 or 0.01%, respectively of the xenograft mouse cfDNA, and about 0.029 or 0.001% of the cfDNA of human early stage cancer patients. Similar WGBS of early stage (0-II, node- and metastasis-free) breast, lung or colorectal cancer samples identified hundreds of specific DMRs (differentially methylated regions) compared to healthy controls. Their association with tumourigenesis was supported by stage-dependent methylation, tumor suppressor or oncogene clusters, and genes also identified in the xenograft samples. Using 20 three-cancer-common and 17 colorectal cancer-specific DMRs in combination (top 0.0018% of the WGBS methylation clusters) was sufficient to distinguish the stage I colorectal cancers from breast and lung cancers and healthy controls. Our data thus confirmed the tumor origin of mctDNA by sequence specificity, and provide a selection threshold for authentic tumor mctDNA markers toward precise diagnosis of early stage cancers solely by top DMRs in combination.

  Dataset EGAD00001008696

• Single cell characterization of T-cell lymphoma: RNA (2025-07-31)

  Lymphomas are types of blood cancer derived from lymphocytes, and can be classified into two main categories, Hodgkin's lymphomas (HL) and non-Hodgkin lymphomas (NHL). T-cell lymphoma is a type of NHL that develops from T lymphocytes and accounts for 10-15% of total NHL cases. As a rare disease, T-cell lymphoma is functionally, pathologically, and clinically complex and heterogeneous. The 2016 revision of the WHO classification has listed 29 subtypes of mature T/NK-cell neoplasms, among which over 25 are T lymphocyte in origin. These subtypes of T-cell lymphomas have different biological behaviours and clinical prognosis. Clinically, T-cell lymphoma ranges from indolent (slow-growing) to aggressive (fast-growing and spreading) disease. According to the guideline booklet provided by the Lymphoma Research Foundation (https://lymphoma.org/aboutlymphoma/nhl/), indolent T-cell lymphoma subtypes include adult T-cell leukaemia/lymphoma (ATLL), cutaneous T-cell lymphoma (CTCL), and mycosis fungoides (MF), while the aggressive subtypes include anaplastic large cell lymphoma (ALCL), angioimmunoblastic T-cell lymphoma (AITL), peripheral T-cell lymphoma (PTCL), and T lymphoblastic lymphoma (TLBL). PTCL and ALCL represent the most common subtypes of aggressive T-cell lymphoma whereas TLBL is a rare and aggressive subtype mostly diagnosed in children. In this study, we will use single cell RNA sequencing and single cell multiomic methods three aggressive T-cell lymphoma subtypes (ALCL, PTCL and TLBL) and try to gain a deeper insight into the genotypic and phenotypic features of these T-cell lymphomas. . This dataset contains all the data available for this study on 2025-07-31.

  Dataset EGAD00001015669

• RNAseq of whole blood in 359 idiopathic pulmonary arterial hypertension patients reveals biological heterogeneity

  Patients with idiopathic, heritable, or drug-induced pulmonary arterial hypertension (referred to throughout as PAH) were recruited from expert centers across the UK as part of the PAH Cohort study (www.ipahcohort.com). In each case, diagnosis was confirmed by right heart catheterization following established international guidelines, which remained unchanged for the duration of this study. Healthy volunteers were recruited at the same centers and samples processed using the same standard operating procedure at all sites. All individuals gave written, informed consent with local ethical committee approval. Whole blood (3 ml) was collected in Tempus Blood RNA Tubes, and RNAseq was performed using established Illumina methodologies (see online supplement for further details).

  Dataset EGAD00001007981

• Genomic analysis for intrahepatic cholangiocarcinoma

  Intrahepatic cholangiocarcinomas (iCCs) are characterized by their rarity, difficulty in diagnosis, and overall poor prognosis. We performed comprehensive genomic characterization of treatment-naive iCC. This study reports a large-scale genomic analysis of iCC. The findings could assist in patient stratification with iCCs and in developing rational therapeutic strategies.

  Dataset EGAD00001008557

• EGAD00010000702

  SNP-chip genotyping data for one proband in the DDD study (Ref : Carvalho AJHG 2015)

  Dataset EGAD00010000702

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• Tetralogy of Fallot Exome Trios

  Exome sequencing of 30 parent-offspring trios to >50X mean depth, where the offspring has sporadic TOF, to identify potential causal de novo mutations. We will use the exome plus design for pulldown that incorporates ~6.8Mb of additional regulatory sequences in addition to the ~50Mb GENCODE exome.

  Dataset EGAD00001000344

• Genomic profiling of patient-derived xenografts and organoids in prostate cancer

  Dataset contains genomic sequencing of 87 samples (blood germline, normal prostate tissues, human tumors, PDOs and PDXs). Sequencing was performed by whole-exome sequencing or targeted sequencing of prostate cancer genes.

  Dataset EGAD00001006403

• Genotype data for 4607 Greenlandic samples (MEGA array)

  This file fileset has 4607 Greenlanders scored on the Illumina MEGA array (1,622,813 sites), and has been put on the plus strand. The data is in PLINK bed/bim/fam format. The Greenlandic individuals originate from two population surveys, B99 and IHIT.

  Dataset EGAD00010002057

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• Transcriptome-wide gene expression analysis of cocaine use disorder in postmortem human brain tissue

  Dataset contains raw fastq-files from RNA-sequencing analysis of total RNA extracted from Brodmann Area 9 human postmortem brain tissue samples.

  Dataset EGAD50000000212

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Patient-derived xenograft models of head and neck cancers

  Establishment and characterization of two patient-derived xenograft models from HNSCC patients , initiatlly treatment-naive, and for which cetuximab-acquired resistant model couterparts have been generated. All models have been characterized at genomic level. HNSCC tissues were obtained from surgical resections at Cliniques universitaires St Luc in Brussels (Belgium).

  Dac EGAC50000000502

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• Tumor Profiler Project - OV cell-free DNA data

  The dataset contains amplicon sequencing data from 48 samples from 35 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format.

  Dataset EGAD50000001410

• Long-read whole genome sequencing as a tool for variant detection in inherited retinal dystrophies

  WGS sequencing using nanopore long reads sequencing. These data is used for the diagnosis of patients with inherited retinal dystrophies.

  Study EGAS50000000846

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Targeted capture sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Targeted capture sequencing for 366 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study and 29 samples from a previously uploaded dataset.

  Dataset EGAD50000001364

• Whole-genome-sequencing and Whole-exome-sequencing in Spastic paraplegia

  To identify the genetic cause and modifiers of Spastic paraplegia, we performed Whole-genome-sequencing and Whole-exome-sequencing of Spastic paraplegia patients.

  Study JGAS000494

• cfDNA sWGS BAM — Metastatic colorectal cancer

  Plasma cirDNA sWGS for metastatic colorectal adenocarcinoma at diagnosis prior to systemic therapy. Libraries DSP/SSP (per sample). Sequencing by IntegraGen (2022–2024). Alignment: GRCh38 with BWA-MEM; BAMs sorted/indexed; delivered as primary mapped reads only (filters/MAPQ in analysis metadata). Controlled access

  Dataset EGAD50000001879

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• Ultra-long whole-genome and Cas9-targeted nanopore sequencing of fibroblasts: FSHD, BAMS, healthy controls

  Data from the D4Z4End2End study (Xiao et al. 2025), for genetic and epigenetic analysis of the D4Z4 macrosatellite in health and disease.

  Dataset EGAD50000001551

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• WGS for 21 samples

  This dataset contains whole-genome sequencing (WGS) data from 14 acute leukemia cases of the newly identified FOXF1/FENDRR ALL subtype, including diagnosis or relapse samples, as well as 7 matched germline samples. All the 21 samples are in bam file type.

  Dataset EGAD50000001790

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• Combination Therapies for Personalised Cancer Medicine in 11-18 (2019-06-10)

  This study involves mutagenizing 11-18 with ENU to identify those mutations which engender resistance to targeted treatment. . This dataset contains all the data available for this study on 2019-06-10.

  Dataset EGAD00001005081

• SMRT-seq

  In this study, we enhanced 5mC detection using SMRT sequencing by holistically analyzing kinetic signals of a DNA polymerase and sequence context for every base within a measurement window. We employed a convolutional neural network to train a methylation classification model.

  Dataset EGAD00001006875

• Chromatin Profiling in Twins (2019-08-21)

  50 lymphoblastoid cell lines of adult female Twins which are part of the MuTHER study, subjected to Chromatin Immunoprecipitation using an antibody for H3K4me1. H3K4me1 peaks mark distal regulatory elements. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005274

• DKFZ-St.Jude Medulloblastoma - 218 CEF control exomes

  218 control exomes, CEF cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006659

• Sporadic and endemic Burkitt lymphoma have frequent FOXO1 mutations but distinct hotspots in the AKT recognition motif

  Sample set of 74 whole-exome sequencing samples from sporadic Burkitt lymphoma patients from the UK. 33 of these samples have matched constitutional data, giving a total number of 107 samples

  Dataset EGAD00001005105

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• Phenotypic characterisation of LRRN4CL over-expression

  This study aims to use RNAseq to identify differentially expressed transcripts in human melanoma cells that over-express the cell surface protein, LRRN4CL, relative to empty-vector control cells, to provide mechanistic insight into how LRRN4CL over-expression confers enhanced pulmonary metastatic colonisation abilities.

  Dataset EGAD00001006249

• Data files for PCGP SJACT WES

  This dataset contains WES files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002679

• Primary tumor/metastatic/germline DNA trios equences files

  Exome sequences of primary tumor/metastatic/germline DNA trios. Tumoral and germline samples were sequenced to an expected depth of respectively 150M and 50M reads in order to obtain differential depth (>100X versus >30X). Submitted data are paired-end fastq files.

  Dataset EGAD00001006324

• CNA vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  CNA calls generated using the SomaticSniper-TITAN-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004440

• DKFZ-St.Jude Medulloblastoma - 70 PAN-GATC control exomes

  Exome controls for 70 individuals, PAN-GATC cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006661

• Non-small cell lung cancer targeted sequencing

  Targeted sequencing of non-small cell lung cancer samples. BAM files of paired end reads aligned to hg19 using BWA MEM v0.7.1573. This targeted panel covers 370 genes of clinical relevance in non-small cell lung cancer.

  Dataset EGAD00001007918

• Pre and Post BCG treated bulk RNAseq dataset.

  We have in total 16 files, technical duplicates of 8 unique samples from Pre and Post BCG samples collected from four non muscle invasive bladder cancer patients. These are bulk RNAseq samples generated by high-throughput sequencing platform.

  Dataset EGAD00001006634

• Whole exome sequencing of 3 primary Plasma Cell Leukemia samples

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 3 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001005306

• Sequencing data for oesophageal / related samples - Foley, Shorthouse et al (RNA)

  Data supporting: "SMAD4 and KCNQ3 Alterations are Associated with Lymph Node Metastases in Oesophageal Adenocarcinoma" RNAseq (FASTQ files) 6 samples

  Dataset EGAD00001011065

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003909

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003957

• HERBY trial RNASeq

  RNA sequencing of non-brainstem paediatric high grade glioma from the HERBY phase II randomised trial. RNA from fresh frozen surgical tissue in 20 cases was subjected to Illumina whole transcriptome paired end sequencing. Data is provided as paired-end FASTQ files

  Dataset EGAD00001004070

• 3_eCLIP_TDP-43

  eCLIP of TDP-43 from iPSC-derived motor neurons in 2 control lines. Per line input and IP samples and analysis including bigWig files and peak files.

  Dataset EGAD00001008426

• PSC-IBD-CRC

  Formalin-fixed, paraffin-embedded samples from 19 PSC-IBD-CRCs, 15 adjacent (non-tumour) mucosa samples and 18 non-mucosal DNA samples were collected via the nationwide network and registry of histo- and cytopathology in the Netherlands (PALGA). DNA was extracted for molecular analysis.

  Dataset EGAD00001006226

• EFFORT occupationally exposed human stool metagenomes (148 samples)

  Metagenomes of stool samples from 54 pig farmers, 24 broiler farmers and 70 slaughter line workers. Note: Access to the data will only be granted for antibiotic resistance studies in accordance with the EFFORT consents issued by the participants.

  Dataset EGAD00001005444

• The natural history of clonal haematopoiesis: phase 6 targeted

  Deep targeted sequencing of 56 genes associated with clonal haematopoiesis and haematological malignancy in peripheral blood-derived DNA from 11 older adults, each previously sampled 2-5 times over the preceding ~13 years.

  Dataset EGAD00001007683

• Bulk mRNA sequencing of GBM cell lines

  We expressed PDGFRAmut, wild-type PDGFRA and a GFP control from lentivirus, in two primary GBM patient-derived cell lines that we had cultured as monolayers.

  Dataset EGAD00001002269

• Dataset for Ewing_sarcoma_PNET-WHOLE_GENOME

  Rare cancer sequencing data of 18 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008874

• Dataset for colorectal_cancer-WHOLE_GENOME

  Rare cancer sequencing data of 54 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008872

• Shwachman-Diamond syndrome (SDS) Exome sequencing

  Shwachman-Diamond syndrome (SDS) is a rare autosomal recessive disorder characterized by exocrine pancreatic insufficiency, bone marrow dysfunction, leukemia predisposition, and skeletal abnormalities. We aim to characterise the structural effects of SDS in patients with this disorder by exome sequencing.

  Dataset EGAD00001000847

• BLUEPRINT Epigenetic characterization of megakaryocytes and erythroblasts

  Megakaryocytes and erythroblasts derive from the same progenitor cell type but carry out very different functions. In order to understand how the different functional phenotypes arise we have characterised the epigenetic landscape of these cells.

  Dataset EGAD00001001871

• SNV vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  SNV calls generated using the MuTect-Battenberg-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004434

• SNV vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  SNV calls generated using the SomaticSniper-Battenberg-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004432

• CNA vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  CNA calls generated using the MuTect-TITAN-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004442

• CNA vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  CNA calls generated using the MuTect-Battenberg-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004443

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Variants from germline WES data of pediatric cancer patients

  This dataset contains germline variants (in .vcf format) from six pediatric cancer patients (sample IDs D1 - D6). WES data of the children and their parents was mapped to hg38. A consensus of four variant callers was used to obtain germline variants of the children.

  Dataset EGAD00001009678

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• SNV vcf files for CPCG Subclonal Heterogeneity in multiple and single regions

  SNV calls generated using the SomaticSniper-TITAN-PhyloWGS from the CPC-GENE Subclonal Heterogeneity study using single and multiple regions

  Dataset EGAD00001004431

• Genetic factors underlying premature MI in Greek families without vessel disease

  The study will analyse by exome sequencing 8 Greek family members with an excess of potentially damaging mutations relating to premature MI and no vessel disease, to identify genetic factors underlying this condition. This is a follow on from project GPMI-NVD

  Dataset EGAD00001002178

• MDS primary and xenografted samples

  This dataset contains bam files mapped to hg19 that either were primary bone marrow cells or sorted human cells after long term engraftment in NSG mice.

  Dataset EGAD00001007760