10648 results for "fc coins olx Navštivte Buyfc26coins.com Podpora pro profesionální hráče a týmy..zSiZ"

in 44.36 milliseconds.

• Center for Common Disease Genomics [CCDG] - Cardiovascular ATVB: Atherosclerosis Thrombosis and Vascular Biology

  Italian Atherosclerosis Thrombosis and Vascular Biology study is a prospective, nationwide, case-control study involving 125 coronary care units in Italy. The cases were patients who were hospitalised for a first MI before the age of 45 years and underwent coronary angiography. Acute MI was defined as resting chest pain lasting more than 30 minutes, accompanied by persistent electrocardiographic changes, and confirmed by an increase in total creatine kinase or in the MB fraction to more than twice the upper normal limits. The controls were healthy subjects without a history of thromboembolic disease who were unrelated to the patients, but individually matched with them by age, gender and geographical origin. They were enrolled from among the blood donors or staff of the same participating hospitals. Recruitment of cases and controls took place between 1994 and 2007. This site hosts data from ~60 whole exomes.

  Study phs001592

• HuBMAP: KULMAP - Human Kidney, Urinary Tract, and Lung Mapping Center

  The major goal of the Human Kidney, Urinary Tract, and Lung Mapping Center (KULMAP) is to generate multi-omic and spatially resolved molecular anatomical maps of the human bladder, ureter and kidneys (BUKMAP) and the lung airways and parenchyma (LAPMAP) at a single cell resolution. This entails sequencing of the transcriptomes and epigenomes of dissociated single cells in a massively parallel manner. These profiles will then inform on highly multiplexed RNA in situ imaging for spatial mapping of hundreds of molecular targets in the tissue sections, at a subcellular resolution. These spatial molecular maps will serve as scaffolds for computational registration of cell types and the associated transcriptome/chromatin maps to the tissue space. The combination of sequencing single dissociated cells and multiplexed in situ mapping will allow the construction of detailed spatial maps for these large organs.

  Study phs002249

• Rapid Acceleration of Diagnostics - Digital Health Technologies (RADx-DHT): NIH Digital Health Solutions for COVID-19: IBM Covid19 Contact Tracing and Data Exchange Tools

  The goal of this project is to develop both contact tracing and secure data exchange tools. The contact tracing solution securely combines data from a variety of sources (including manual self-report data and mobile device surveys) to enable tracing of contacts with individuals that have tested positive for COVID-19 or have been exposed to COVID-19. The data exchange solution is a secure mechanism that empowers users to control the data they share in the course of their return to work, including the ability to provide a verifiable health status claim. These tools are being used by an employer to evaluate the risk of allowing individuals to return to normal activities, and also the ability to trace user contact with individuals diagnosed with or suspected of having contracted COVID-19. DOI: https://rapids.ll.mit.edu/10.57895/h0an-m559

  Study phs002516

• Breast Cancer Susceptibility

  Genetic factors account for a large fraction of breast cancer risk and it is estimated that up to 30% of breast cancers have a heritable component. Inherited cancer susceptibility is associated with early-onset of malignancies in general. Although 20% of young women with breast cancer have germline mutations in the best understood breast cancer susceptibility genes, BRCA1, BRCA2 and TP53, in the remaining 80% of women with early-onset breast cancer, the genetic factors contributing to disease remain unexplained. By studying the extreme phenotype of women diagnosed at an early age there is enrichment for genetic factors that contribute to breast cancer. This study contains the whole exome sequence of 384 women diagnosed with invasive breast cancer prior to 40 years of age. Each of the subjects reported a family history of breast cancer and lacked mutations in BRCA1 and BRCA2.

  Study phs001017

• Deciphering Maternal-Fetal Crosstalk in the Human Placenta During Parturition Using Single-Cell RNA-Sequencing

  Labor is a complex physiological process requiring a well-orchestrated dialogue between the mother and fetus. However, the cellular contributions and communications that facilitate maternal-fetal crosstalk in labor have not been fully elucidated. In this latest version (#5), scRNA-seq was applied to decipher maternal-fetal signaling in the human placenta and chorioamniotic membranes during term labor. Samples were obtained from women who underwent spontaneous labor (n = 24) or who were delivered in the absence of spontaneous labor (n = 18) at term. Samples from previous versions (#1-3) of this study include the placental villous tree, basal plate, and chorioamniotic membranes of women across a range of pregnancy physiologic and pathologic conditions, including the processes of labor (term labor and preterm labor), and COVID-19 (version #3). Version #4 includes samples from the human myometrium during spontaneous term labor.

  Study phs001886

• Study of Adaptation to Hypoxia in Ethiopian Highlanders via Whole Genome Sequencing

  Although it has long been proposed that genetic factors contribute to adaptation to high altitude, such factors remain largely unverified. Recent advances in high-throughput sequencing have made it feasible to analyze genome-wide patterns of genetic variation in human populations. Since traditionally such studies surveyed only a small fraction of the genome (either exons or a subset of SNPs) or a group of candidate genes, interpretation of the results was limited. We focused our study on Ethiopian highlander populations, which have been found to be well adapted to high altitudes (~3500m). We sequenced and analyze the genomes of 13 high altitude native Ethiopians: 6 individuals of Oromo heritage living on Bale Plateau (labeled "Oromos"), and 7 individuals residing on the Chennek field in the Simien Mountains (labeled "Amhara"). Our study revealed evolutionarily conserved genes that modulate hypoxia tolerance.

  Study phs000647

• Genome-Wide Analysis of Splenic Marginal Zone Lymphoma

  Splenic Marginal Zone Lymphoma (SMZL) is a B-cell malignancy of unknown pathogenesis and thus orphan of targeted therapies. By integrating whole-exome sequencing and copy-number analysis of 8 paired tumor-normal DNAs from patients with SMZL, we show that the typical SMZL exome carries ~30 genetic alterations. Targeted resequencing of selected candidates in an extended panel of 40-117 samples revealed activating mutations of NOTCH2, a gene required for marginal-zone (MZ) development, as the most frequent and SMZL-specific lesion, accounting for approximately 20% of cases. Additional altered genes suggest that deregulation of signaling pathways normally involved in MZ development (NOTCH, NF-kappa B, and B-cell receptor) represents a critical event in SMZL pathogenesis. These findings have direct implications for the treatment of SMZL patients since drugs are available which can target NOTCH as well as other pathways deregulated in this disease.

  Study phs000502

• DAXX restoration suppresses alternative lengthening of telomeres in ATRX wild-type cells

  Many tumors maintain chromosome ends through a telomerase-independent, homologous recombination based mechanism called alternative lengthening of telomeres (ALT). While ALT occurs in only a subset of tumors, it is strongly associated with mutations in the genes encoding components of the histone H3.3 chaperone complex, ATRX and DAXX. To date the mechanistic role of ATRX and particularly DAXX mutations in potentiating ALT remains poorly understood. We identify an osteosarcoma cell line, G292, with a unique chromosomal translocation resulting in loss of DAXX function, while retaining functional ATRX. Using this distinctive resource, we demonstrate that introduction of wild type DAXX suppresses the ALT phenotype and restores localization of the ATRX/DAXX complex to PML bodies. This provides the first direct molecular evidence that ongoing DAXX deficiency is essential for maintenance of the ALT phenotype and highlights the potential for therapeutic targeting of this oncogenic pathway.

  Study phs001495

• Massachusetts General Hospital (MGH)/Broad Hurthle cell carcinoma whole exome sequencing study

  In this study, we performed whole-exome sequencing of 41 patients with Hurthle cell carcinoma, a thyroid cancer variant with abundant mitochondria. We were able to identify recurrent somatic mutations in both the nuclear and mitochondrial genomes of Hurthle cell carcinoma. Our study identifies mutations in DAXX (GeneID: 1616), TP53 ( GeneID:7157), NF1(GeneID:4763) , NRAS (GeneID:4893), CDKN1A (GeneID:1026), ARHGAP35 (GeneID:2909), the TERT (GeneID:7015) promoter, and mitochondrial-encoded complex I genes to be candidate driver events in Hurthle cell carcinoma. Furthermore, copy number analysis revealed widespread chromosomal losses, resulting in loss-of-heterozygosity and a near-haploid state, to be a defining feature of these tumors. Finally, by analyzing locoregional recurrences and metastases, we were able to identify that widespread chromosomal losses and mitochondrial complex I mutations appear to be early driver events that are selected during clonal evolution.

  Study phs001580

• National Heart, Lung, and Blood Institute SNP Health Association Asthma Resource Project (SHARP)

  SNP Health Association Resource (SHARe) Asthma Resource project (SHARP) is conducting a genome-wide analysis in adults and children who have participated in National Heart, Lung, and Blood Institute's clinical research trials on asthma. This includes 1041 children with asthma who participated in the Childhood Asthma Management Program (CAMP), 994 children who participated in one or five clinical trials conducted by the Childhood Asthma Research and Education (CARE) network, and 701 adults who participated in one of six clinical trials conducted by the Asthma Clinical Research Network (ACRN). There are three study types. The longitudinal clinical trials can be subsetted for population-based and/or case-control analyses. Each of the childhood asthma studies has a majority of children participating as part of a parent-child trio. The ACRN (adult) studies are probands alone. Control genotypes will be provided for case-control analyses.

  Study phs000166

• National Human Genome Research Institute Tumor Sequencing Project (TSP) - Lung Adenocarcinoma

  The Tumor Sequencing Project (TSP) Consortium is a collaboration among participants at the Baylor College of Medicine Human Genome Sequencing Center, the Broad Institute Genome Sequencing Platform, the Dana Farber Cancer Institute, the Memorial Sloan-Kettering Cancer Center, the Genome Sequencing Center and Siteman Cancer Center at Washington University, the M.D. Anderson Cancer Center and the University of Michigan Medical Center. The TSP Part A will pilot approaches to large-scale identification of genomic changes in tumors by sequencing the exonic regions of 623 genes in 188 specimens of adenocarcinoma of the lung, as well as using high density SNP genotyping arrays for high resolution identification of changes in chromosomal copy number. The TSP Part B will pilot approaches to tumor characterization of lung adenocarcinoma samples using next-generation sequencing technologies and benchmark those results against Part A data generated with ABI3730 instruments.

  Study phs000144

• A phase II trial of the aurora kinase A inhibitor alisertib for patients with castration resistant and neuroendocrine prostate cancer: efficacy and biomarker evaluation

  Neuroendocrine prostate cancer (NEPC) is an aggressive variant of prostate cancer that may develop de novo or as a mechanism of treatment resistance. N-myc is capable of driving NEPC progression. Alisertib inhibits the interaction between N-myc and its stabilizing factor Aurora-A, inhibiting N-myc signaling, and suppressing tumor growth. In this single arm, multi-institutional open label phase 2 clinical trial of alisertib, sixty men were treated with alisertib 50mg twice daily for 7 days every 21-days. Eligibility included metastatic prostate cancer and at least one: small cell neuroendocrine morphology; ≥50% neuroendocrine marker expression; new liver metastases without PSA progression; elevated serum neuroendocrine markers. The primary endpoint was six-month radiographic progression free survival. Pre-treatment biopsies were evaluated by whole exome and RNA-seq.

  Study phs001666

• ASsessing and Predicting Infant RSV Effects and Severity (AsPIRES) Study

  A prospective multi-year clinical translational study including three cohorts of term infants experiencing their first Respiratory Syncytial Virus (RSV) season. All infants are less than or equal to nine months of age at study entry. The three subject cohorts represent the full spectrum of RSV disease severity and include a birth cohort, a cohort of infants hospitalized for RSV disease and infants evaluated at ambulatory settings for RSV infection. All infants are followed longitudinally and evaluated at recognition of acute RSV infection and twice during convalescence. Innate and adaptive immune status are comprehensively measured in association with clinical, environmental, viral, and bacteriologic factors. Genome-wide expression is assessed in the nasal airways, and in sorted peripheral blood lymphocytes. The study goal is to Identify host responses to RSV infection and factors associated with severe disease.

  Study phs001201

• Genetics of Hypertension Associated Treatment (GenHAT) Study, Genomic Background of Blood Pressure Response to Treatment in African Americans

  The GenHAT study is an ancillary pharmacogenomics study to the Antihypertensive and Lipid Lowering Treatment to Prevent Heart Attack Trial (ALLHAT). ALLHAT was a randomized, double-blind, multi-center trial that enrolled 42,418 participants ≥55 years of age with hypertension and at least one additional risk factor for cardiovascular disease (CVD). Participants were randomized to treatment with one of four primary antihypertensive drugs: chlorthalidone (thiazide-like diuretic), amlodipine (CCB), lisinopril (ACE-i), or doxazosin (alpha-adrenergic blocker) in a ratio of 1.7:1:1:1, respectively. Participants were followed for treatment response and CVD outcomes. The original GenHAT study (N=39,114) evaluated the association of candidate hypertensive genetic variants with CVD outcomes for participants consenting to genetic research. The current GWAS study focuses on a subset of African American GenHAT participants (n=6908).  

  Study phs002716

• Admixture Mapping of Staphylococcus aureus Bacteremia

  In this study, we used admixture mapping to test the hypothesis that genomic variations with different frequencies in European and African ancestral genomes influence susceptibility to Staphylococcus aureus bacteremia (SAB) in a sample of African Americans. A total of 565 adult African Americans were genotyped for admixture mapping. Cases were unique African American adult inpatients with monomicrobial SAB (N=390) and controls are age-matched adult African American inpatients with no current or past S. aureus infection (N=175). After empirical multiplicity adjustment, one region on chromosome 6 (52 SNPs, P = 4.56e-05) in the HLA class II region was found to exhibit a genome-wide statistically significant increase in European ancestry. This region encodes genes involved in HLA-mediated immune response and these results provide additional evidence for genetic variation influencing HLA-mediated immunity, modulating susceptibility to SAB.

  Study phs001441

• The Ultrasound Study of Tamoxifen

  The Ultrasound Study of Tamoxifen is a 12-month longitudinal study to describe volumetric breast density change over time among women with and without tamoxifen exposure. Women were enrolled at the Karmanos Cancer Institute and Henry Ford Health Systems in Detroit, Michigan between 2011-2014. Enrollment included women prescribed tamoxifen for clinical indication (n=82) and a comparison group of women frequency matched on age, race, and menopausal status (n=165). Whole breast ultrasound tomography (UST) scans were used to measure volume averaged sound speed (m/s) as a surrogate of volumetric breast density. Ultrasound tomography (UST) scans were completed at baseline prior to tamoxifen initiation and were repeated at 1-3 months, 4-6 months, and 12 months after tamoxifen initiation. For the comparison group, UST scans were completed at baseline and 12 months. Questionnaires were completed at each scan.

  Study phs003183

• CRISPR-Mediated ASD Gene Knockout Reduces Neuronal Activity

  Autism Spectrum Disorder is phenotypically and genetically heterogeneous. We present a CRISPR gene editing strategy to insert a protein tag and premature termination sites creating an induced pluripotent stem cell (iPSC) knockout resource for functional studies of 10 ASD-relevant genes (AFF2/FMR2, ANOS1, ASTN2, ATRX, CACNA1C, CHD8, DLGAP2, KCNQ2, SCN2A, TENM1). Neurogenin 2 (NGN2)-directed induction of iPSCs allowed production of excitatory neurons, and mutant proteins were not detectable. RNAseq revealed convergence of several neuronal networks. Using both patch-clamp and multi-electrode array approaches, the electrophysiological deficits measured were distinct for different mutations. However, they culminated in a consistent reduction in synaptic activity, including reduced spontaneous excitatory post-synaptic current frequencies in AFF2/FMR2-, ASTN2-, ATRX-, KCNQ2- and SCN2A-null neurons. Despite ASD susceptibility genes belonging to different gene ontologies, isogenic stem cell resources can reveal common functional phenotypes, such as reduced functional connectivity.

  Study phs001816

• National Institutes of Health H3Africa African Collaborative Center for Microbiome and Genomics Research (ACCME)

  The African Collaborative Center for Microbiome and Genomics Research is a multi-institutional collaborative research project. The objectives of the project are to collaborate and implement high impact integrative epidemiology and genomics research into discovery of biomarkers associated with cervical carcinogenesis. Specifically ACCME links and leverages existing funded research and program activities at the collaborating institutions to study the interaction between vaginal microbiome, host genetic factors and molecular variants of Human Papilloma Virus (HPV) to determine correlates of viral persistence in the causal pathway of cervical cancer, a major cause of preventable mortality in Nigeria and other parts of sub-Saharan Africa. This research offers several opportunities to advance understanding of cervical carcinogenesis, viral oncogenesis, new biomarker discovery and risk stratification by genotype in a cohort of African women. Sponsorship: This project is sponsored by the National Institutes of Health (NIH)

  Study phs001945

• Genetic Analysis of Psoriasis and Psoriatic Arthritis: GWAS of Psoriatic Arthritis

  This study is a genome-wide study of genetic associations with psoriatic arthritis (PsA), an inflammatory musculoskeletal condition that develops in up to 30% of people who have chronic psoriasis skin lesions. 1,526 cases affected with psoriatic arthritis and 1,508 unaffected controls were recruited and typed on the Illumina HumanOmni1-Quad BeadChip array. After application of quality control measures to both samples and SNPs, genotypes for 791,217 autosomal SNPs were available for 1,430 PsA cases and 1,417 controls. Imputation using phased haplotypes for the EUR subpopulation of release 3, phase 1 of the 1000 Genomes Project as a reference, resulted in genotypes for 11,532,644 SNPs and 918,976 indels passing our imputation quality threshold (Mach r2 ≥ 0.3) that were available for downstream analysis. Association at a genome-wide threshold of significance was found for five regions (near genes TNIP1, IL12B, HLA-C, TRAF3IP2, and TYK2).

  Study phs000982

• Minnesota Center for Twin and Family Research (MCTFR) Genome-Wide Association Study of Behavioral Disinhibition

  This is an epidemiological study of substance abuse and related psychopathology in which the subjects have been drawn from the Minnesota Center for Twin and Family Research (MCTFR). The MCTFR is a large, ongoing, family-based study. It is in part a longitudinal study of two cohorts of adolescent twins and their parents. It additionally includes a parallel longitudinal study of adolescent adoptive siblings, biologically related siblings, and their parents. Over 1500 twin families and 350 adoptive and biological sibling families have been studied, with follow-up assessments occurring approximately every 3 years. The MCTFR gathered detailed, standardized data on study participants including DSM-IIIR and DSM-IV diagnostic interview and questionnaire data. For the Genome-Wide Association Study of Behavioral Disinhibition, parental intake data plus that adolescent data gathered closest to the children 17th birthday (between ages 16.5 and 21) was used.

  Study phs000620

• Circulating Tumor DNA in Intermediate Risk Rhabdomyosarcoma

  In this study, we evaluated circulating tumor DNA (ctDNA) as a biomarker in the serum of 124 patients with newly diagnosed intermediate risk rhabdomyosarcoma (IR RMS) from the Children's Oncology Group (COG) biorepository. In addition to pre-treatment serum, we also analyzed matched tumor tissue and germline in a subset of patients. We profiled samples using ultra-low passage whole genome sequencing (ULP-WGS) and a new custom hybrid-capture sequencing assay, Rhabdo-Seq, to detect copy number alterations, rearrangements, and single nucleotide variants. We found that patients with detectable ctDNA at diagnosis had significantly worse outcomes than those without detectable levels of ctDNA. Our study demonstrates that baseline ctDNA detection is feasible and prognostic in IR RMS. The ULP-WGS and targeted next-generation sequencing (Rhabdo-Seq and TranSS-Seq) data are available in this study.  

  Study phs002866

• Genomic Analysis of Peripheral T-Cell Lymphomas

  Peripheral T-cell lymphomas (PTCLs) are a heterogeneous and poorly understood group of non Hodgkin lymphomas. We aim to identify new genetic alterations in PTCL transformation by using a combination of whole exome sequencing of tumor-normal DNA pairs, RNAseq analysis and targeted deep sequencing of candidate genes. Our data identified highly recurrent mutations in epigenetic factors such as TET2, DNMT3A and IDH2 as well as a new highly prevalent mutation in RHOA, the G17V allele that is present in almost 70% of angioimmunoblastic T-cell lymphomas (AITL) and almost 20% of not otherwise specified PTCL (PTCL NOS) samples. In addition, we describe new and recurrent genetic defects including mutations in FYN, ATM, B2M and CD58 implicating SRC signaling, impaired DNA damage response and escape from immune surveillance processes as key players in the pathogenesis of PTCL.

  Study phs000689

• HCI-PDX Trial Center for Breast Cancer Therapy

  The HCI-PDX Trial Center for Breast Cancer Therapy study is a collection of patient-tumor samples that are serially established as patient-derived tumor xenografts (human tumor in mouse) and matching organoids. For this study, we describe valuable methods and resources to generate organoids and use them as cost-effective models for precision drug screens. This study leveraged whole-exome sequencing, RNAseq, and SNP-array data to illustrate how the heterogeneity of tumors is preserved in xenograft and organoid models. Sequencing files are provided for whole-exome and RNAseq data. Processed copy number variant calls from the SNP arrays are also available. A full description of the study can be found in the article entitled, "A human breast cancer-derived xenograft and organoid platform for drug discovery and precision oncology," written by Guillen et al., 2022 in Nature Cancer (PMID: 35221336).

  Study phs002479

• PLCO - Limited Use Pilot Test Data

  This is a sample of Prostate, Lung, Colorectal, and Ovarian (PLCO) Cancer Screening Trial data for limited use in a pilot test for remote data access. The PLCO is a randomized, controlled trial of screening tests for prostate, lung, colorectal and ovarian cancers. Approximately 155,000 participants were enrolled between November 1993 and July 2001. Participants were individually randomized to the control arm or intervention arm in equal proportions. Participants assigned to the control arm received usual care, whereas participants assigned to the intervention arm were invited to receive screening exams for prostate, lung, colorectal and ovarian cancers as outlined in the study protocol. The goal of the study was to assess whether these screening exams reduce mortality from prostate, lung, colorectal and ovarian cancers. Data were collected on cancer diagnoses and deaths from all causes that occurred through December 31, 2009. Median follow-up time was 12.4 years.

  Study phs002011

• The Epilepsy Phenome/Genome Project

  The Epilepsy Phenome/Genome Project (EPGP) is a large-scale, international, multi-institutional, collaborative research project, sponsored by the National Institute of Neurological Disorders and Stroke, designed to understand the genes that cause common and rare epilepsies. The overall goal of EPGP is to collect detailed, high quality phenotypic (i.e., characteristics of individuals, from the molecular level to the whole person) information on persons with epilepsy and to compare the phenotypic information with genomic information. 27 clinical centers enrolled more than 4,100 participants of families with epilepsy. EPGP will provide a resource that may lead to many discoveries related to the diagnosis and treatment of epilepsy, including the eventual development of new therapies based on a better understanding of causes of the disorder. Documents and questionnaires that provide context to the variables and measurements available through the current study, are available for download from EPGP: Download EPGP Forms.

  Study phs000742

• Characterization of Macrophage-Tropic HIV Infection of Central Nervous System Cells and the Influence of Inflammation

  In this study, we utilize macrophage-tropic and T cell-tropic HIV-1 Env proteins to establish accurate infection profiles for multiple CNS cells under basal and interferon alpha (IFN-α) or lipopolysaccharide (LPS)-induced inflammatory states. We found that macrophage-tropic viruses confer entry advantages in primary myeloid cells, including monocyte-derived macrophages, microglia, and induced pluripotent stem cell (iPSC)-derived microglia. Following 24-h IFN-α or LPS treatments, total RNA was harvested from 100,000 to 200,000 cells using an RNeasy RNA isolation kit (Qiagen, 74004). RNA was quantified using a NanoDrop spectrophotometer and TapeStation electrophoresis prior to library preparation. cDNA libraries were prepared using the KAPA RNA HyperPrep kit (Roche, 08098115702). Paired-end RNA sequencing was performed on a NovaSeq S4 platform at a read length of 100 bp, resulting in approximately 60 million reads per sample.

  Study phs003306

• Combinatorial Indexed 10x Genomics Single-Cell ATAC-seq on Human Cerebral Cortex

  Single-cell chromatin accessibility profiling (scATAC) using droplet fluidics (10x Genomics) is inherently limited in throughput due to the number of available indexed droplets. This study leverages single-cell combinatorial indexing workflows with modified adapter designs to enable indexed tagmentation and superloading of pre-indexed nuclei into the 10x Genomics scATAC workflow, enabling a substantial increase in the number of cell profiles that can be obtained per channel. This workflow, 10x single-cell combinatorial indexed ATAC-seq (txsciATAC), is demonstrated on human brain tissue (middle frontal gyrus), along with mouse brain tissue to enable doublet and crosstalk assessment. This study includes all human data and includes a single preparation taken through nuclei isolation and indexed tagmentation using 96 indexes then split to produce two datasets, one targeting 20k cells and one targeting 70k, each using a single channel of the 10x Chromium controller.

  Study phs003497

• Association Between Telomere Length and Falciparum Malaria Endemicity in Sub-Saharan Africans

  The goal of this study was to identify the genetic and environmental drivers of telomere length variation in an ethnically diverse African cohort. It comprises 1,818 participants from Cameroon, Tanzania, Ethiopia, and Botswana. For each participant, leukocyte telomere length was measured using the Southern blotting of the terminal restriction fragment methodology. 1,758 of the individuals with phenotype data also had genetic data, and these individuals were subjected to a genome-wide association study which accounted for age, sex, and genetic relatedness. Individuals were genotyped on one of two genotyping arrays (Illumina Infinium Omni5 array or Illumina H3Africa consortium array). Genetic datasets were merged, and missing genotypes were imputed for a final genetic dataset of 11,001,107 genetic variants. Correlations between telomere length and a variety of environmental factors, including malaria endemicity, were also examined in this study.

  Study phs003567

• Genetic Analysis of Skin Cells

  Cutaneous squamous cell carcinoma (cSCC) is a form of skin cancer originating from keratinocytes in the skin. They have high mutation burdens, primarily driven by UV-radiation-induced DNA damage. The order in which mutations undergo selection during the evolution of cSCC is not known. A subset of cSCCs grow out of benign neoplasms called actinic keratoses. To better understand the evolution of cSCC, we identified cases of cSCCs adjacent to actinic keratoses. From these cases, we separately microdissected the surrounding normal skin, the actinic keratosis, and the cSCC, and we performed targeted DNA-sequencing on the tissue from each area. We reconstructed tumor phylogenies and performed spatial transcriptomics on the 10X FFPE Visium platform on a subset of cases. Collectively, these studies revealed the mutational and gene expression changes that arise during the evolution of cSCC.

  Study phs003282

• The Contribution of De Novo Coding Mutations to Meningomyelocele

  Meningomyelocele (MM) is considered a genetically complex disease resulting from the failure of the neural tube to close; a neural tube defect (NTD). Patients display neuromotor disability and frequent hydrocephalus requiring ventricular shunting. A few genes have been proposed to contribute to disease susceptibility, but most risk remains unexplained. 851 MM trios were recruited and we found 187 likely gene disrupting or damaging missense de novo mutations (DNMs) that are estimated to contribute to disease risk. These DNMs collectively define networks including actin cytoskeleton and microtubule-based processes, axon guidance, and histone modification. Gene validation demonstrates partial or complete loss of function, impaired signaling and defective neural tube closure in Xenopus embryos. Our results suggest DNMs make key contributions to MM risk, and highlight critical pathways required for neural tube closure in human embryogenesis. Data for 245 WES trios and 1 quad are available through dbGaP.

  Study phs003746

• The Genetic Evolution of Acral Melanoma

  Acral melanoma is a rare melanoma subtype arising on the sole, palm, or nail apparatus. We performed whole-exome sequencing (WES) for a cohort of 35 acral melanoma patients. For each patient, we sequenced multiple tumor areas representing different tumor stages, including the in situ and invasive portions of the primary tumor and available regional or distant metastases. Normal areas were included for all except one patient. We identified distinct evolutional trajectory compared to melanomas arising on the sun-exposed skin. Whole-genome sequencing and targeted sequencing were additionally performed for a subset of the samples. Particularly, in acral melanomas, complex genomic aberrations, characterized by clustered copy number transitions and focal amplifications, and telomerase reverse transcriptase (TERT) activating alterations occur very early during evolution, while MAP-kinase pathway mutations, such as BRAF V600E and NRAS hotspot mutations, can occur late and often result in striking intra-tumor heterogeneity.

  Study phs003451

• Origin of second malignancies in children

  Pediatric cancers are rare diseases, and children without known germline predisposing conditions who develop a second malignancy during developmental ages are extremely rare. We present four such clinical cases and through whole-genome and error-correcting ultra-deep duplex sequencing of tumor and normal samples, we explored the origin of the second malignancy in four children, uncovering different routes of development. The exposure to cytotoxic therapies was linked to the emergence of a secondary AML. A common somatic mutation acquired early during embryonic development was the driver of two solid malignancies in another child. In two cases, the two tumors developed from completely independent clones diverging during embryogenesis. Importantly, we demonstrate that platinum-based therapies contributed at least in one order of magnitude more mutations per day of exposure than aging to normal tissues in these children.

  Study EGAS50000000167

• Whole-genome sequencing of BRCA-mutant breast cancer patient samples from tumour, germline tissue and plasma

  The use of circulating tumor DNA (ctDNA) to profile mutational signatures presents a non-invasive opportunity for understanding cancer mutational processes. In this study we developed MisMatchFinder, a liquid biopsy approach for mutational signature detection using low- coverage whole-genome sequencing of ctDNA. Through analysis of plasma samples across multiple different cancers, we demonstrated that MisMatchFinder accurately infers single-base and doublet-base substitutions as well as indels to enhance detection of ctDNA and clinically relevant mutational signatures. This study contains fastq files from whole-genome sequencing of temporally matched tumour (fresh frozen biopsies), blood germline and plasma samples collected from a BRCA1-mutant breast cancer patient to directly compare mutation signature analysis using gold-standard tumour-germline paired variant calling with our novel ctDNA-based method (MisMatchFinder).

  Study EGAS50000000569

• Genetic and Genomic Analysis of Primary Human Chondrocytes

  Osteoarthritis (OA) is a common, degenerative joint disease characterized by the gradual breakdown of the cartilage in the joints. Despite osteoarthritis affecting over 500 million individuals, the lack of a comprehensive mechanistic understanding of the disease has greatly hindered the development of adequate treatment options. To address this, we generated RNA-seq, Hi-C, and ATAC-seq data in primary human chondrocytes treated with either PBS as resting or a fibronectin fragment (FN-f) to model the OA chondrocyte phenotype. We mapped expression quantitative trait loci and splicing quantitative trait loci, and performed colocalization with OA GWAS data to identify putative OA risk genes. Integration of ATAC-seq and Hi-C data provided insights into the regulatory mechanisms. This study revealed both expression-based and splicing-based OA risk genes, several of which had not been previously identified in chondrocyte studies.

  Study phs003581

• P4HA1 Mediates Hypoxia-Induced Invasion in Human Pancreatic Cancer Organoids

  Pancreatic ductal adenocarcinoma (PDAC) is an aggressive malignancy defined by extensive invasion into the local tumor microenvironment and systemic metastasis. PDAC develops in a hypoxic microenvironment and adapts to survive under low oxygen conditions, including the activation of processes that may enhance the ability of cancer cells to invade locally or metastasize. Here we employ bulk RNA-sequencing of eight patient-derived organoid (PDO) cultures grown in hypoxia and normoxia to identify differentially expressed genes. PDOs were grown in Matrigel, transferred into collagen domes, then incubated in hypoxia or normoxia. Invasive organoids were individually collected from collagen domes grown in hypoxia and normoxia separately and processed for RNA-sequencing analysis. Using this dataset, prolyl 4-hydroxylase subunit alpha (P4HA1) was identified as a potential regulator of PDAC invasion in hypoxia. This dataset exists as a reference for gene expression of invasive organoids in hypoxia and normoxia.

  Study phs003961

• Genomic Sequencing of Ewing Sarcoma

  Pediatric Ewing sarcoma is a pediatric cancer that primarily arises from the bone. It is characterized by chimeric fusions of the EWS gene and an ETS family transcription factor. In this study, we performed massively parallel sequencing of a larger collection of Ewing sarcoma tumors to define the genomic landscape of this disease. We found that these tumors are among of the most genetically normal cancers currently characterized. There was also a marked absence of recurrent mutations in immediately targetable signaling transduction pathway genes. In this study we answer outstanding questions about ETS transcription factor expression, effects of treatment on mutational burden in Ewing sarcoma tumors, and describe patterns of tumor evolution. We also found that loss-of-function mutations in STAG2 were present in approximately 15% of Ewing sarcoma tumors and loss of STAG2 expression was associated with disease metastasis in this patient cohort.

  Study phs000804

• Stress and Treatment Response in Puerto Rican and African American Children with Asthma (STAR)

  The Stress and Treatment Response in Puerto Rican and African American Children with Asthma Study (STAR) was a 6-week study of response to inhaled corticosteroids (ICS) in youth aged 8-20 years recruited at the University of Puerto Rico Medical Center and UPMC Children's Hospital of Pittsburgh from June 5, 2018 to May 16, 2022. At a baseline visit, participants completed questionnaires and underwent collection of nasal specimens. After nasal sampling, participants were treated with daily medium-dose inhaled Mometasone for 6 weeks, with adherence measured using a dose-counter. Spirometry and fractional exhaled nitric oxide (FeNO) measurements were conducted at baseline and after 6 weeks of ICS. STAR was approved by the institutional review boards (IRBs) of the University of Puerto Rico and the University of Pittsburgh. Written parental consent and assent were obtained from participants

  Study phs004052

• DNA methylation dynamics during early human development

  DNA methylation is globally reprogrammed during mammalian preimplantation development, which has been well characterized in the mouse but not in other mammals. Here we report on the single base-resolution DNA methylome of human gametes and blastocysts. Near complete demethylation of the paternal genome was apparent, except for tandem repeat-containing CpG-rich regions, whereas the maternal genome was essentially resistant to replication-dependent global demethylation. The human oocyte methylome was characterized by a unique bimodal distribution of gene body methylation, a particular promoter methylation profile and a high proportion of hypomethylated transposable elements. Methylome and transcriptome comparisons between the human and mouse suggested species-specific regulation of many genes including the important DNA methylation regulators. Our findings are essential to understand the unique gene regulatory mechanisms during early human development and will facilitate preimplantation epigenetic diagnosis of human embryos.

  Study JGAS000006

• Exploring Extracellular Vesicle microRNAs in Usher Syndrome Type 1B: Tear-Derived EVs as Indicators of Retinal Health

  The goal of this study was to explore extracellular vesicles (EVs) from human tears and iPSC-derived RPE cells as biomarkers for Usher syndrome type 1B (USH1B), a rare inherited disorder causing deafness and retinitis pigmentosa. Researchers found that tear EVs showed higher levels and diversity of miRNAs, making them a promising non-invasive source for diagnosing USH1B. In contrast to patient-derived RPE cells, which did not express MYO7A protein despite similar expression levels in controls, the study identified specific microRNA signatures associated with retinal degeneration in both tear EVs and RPE-derived EVs. The findings suggest that tear EVs can serve as a useful biomarker for USH1B diagnosis, monitoring, and therapeutic development. Overall, this research aims to contribute to our understanding of disease mechanisms and identify potential targets for treatment in patients with Usher syndrome type 1B.

  Study EGAS50000001200

• Single-nucleus brain transcriptomics reveals microglia dysfunction in Multiple System Atrophy

  Multiple System Atrophy (MSA) is a rare, age-related neurodegenerative disease that shares clinical and pathological features with Parkinson’s disease (PD) but presents a more devastating disease course. To elucidate the distinct cellular pathophysiology underlying multiple system atrophy (MSA) or Parkinson's disease (PD), we performed single-nucleus RNA sequencing on postmortem striatal brain tissue from 7 MSA and 12 PD patients, and 10 non-neurological cases. Using 10x Genomics Chromium Next GEM Single Cell 3' Reagent Kits v3.1, we isolated 130k nuclei covering all major cell types of the striatum. We performed state-of-the-art bioinformatic analyses on the data followed by orthogonal analyses to validate our findings. We identified a disease-specific activation of microglia cells distinguishing the two diseases and possibly explaining some of the detrimental effects observed in both.

  Study EGAS50000001406

• PanProstate Cancer Group DK data

  THE PAN PROSTATE CANCER PROJECT: Many groups around the world have generated Whole Genome DNA Sequence (WGS) data from prostate cancer patients. The pan prostate group have gathered with the idea that the accumulated data, should be collected and compared in a common format including common storage, re-analysis through a single pipeline, and investigation to achieve a variety of scientific goals. The combined collection would include the following categories: (i) cancers from different ethnic groups: eg Caucasian, Asian, Black Caribbean; (ii) cancer from different stages of progression from normal, to organ-confined disease, to metastases; (iii) early-onset prostate cancer; (iv) prostate cancer from aggressive and indolent disease; and (v) prostate cancer patients managed by different treatments with information linked to long-term clinical follow up data in many cases.This study contains the samples from the Danish prostate group.

  Study EGAS50000001616

• Genomic_profiling_of_B_other_Adult_ALL_WGS

  Adult ALL is an aggressive leukaemia, affecting adults of all ages. It is associated with a rapid onset and poor outcomes. Our understanding of adult ALL genome has been limited to molecular markers first described in paediatric ALL and validated in adult ALL and to date there have been no studies investigating the genomics of Adult ALL. We will perform whole genome sequencing on at least 100 Adult ALL cases. Priority will be given on ALL cases without a known primary lesion by cytogenetic analysis which are categorised as “B-other”. We will also sequence representative cases of each known subtype. This will deliver a comprehensive annotation of the genomic landscape of Adult ALL to include acquired somatic mutations (substitutions, indels, structural variants/fusion genes) and copy number profiles. The focus on B-other Adult ALL is likely to result in new and previously undescribed genomic lesions.

  Study EGAS00001002474

• Measuring the level of relatedness between NGS datasets

  Sequencing technologies are providing increasingly detailed insight in genetic makeup are paving their way into molecular diagnostics. The field will benefit from rigorous and bias-free measures for the quality of sequence data and for the proper representation of the complexity of the original samples. While current methodologies rely on the availability of a well-characterized reference genome, we propose kMer profiling for alignment-free assessment of the quality, comparability, and complexity of sequencing datasets. We show that kMer detects technical artefacts such as high duplication rates, library chimaeras, and differences in library preparation protocols in whole-genome, whole-exome, and RNA sequencing data. Additionally, it successfully captures the complexity and diversity of microbiomes. Thus, kMer allows for a robust evaluation of the quality and complexity of sequencing data without relying on any prior information and opens the way to a more reliable biological reasoning.

  Study EGAS00001000600

• Validation_of_a_Haloplex_platform_for_targeted_re_sequencing_of_the_exons_of_25_genes

  We recently used the Agilent SureSelect platform to re-sequence a set of genes known to bemutated in human AML. The results from 10 AML DNA samples were very satisfactory, butthe effort required was significant.Thus, we decided to re-sequence the same genes using the Haloplax system for targetenrichment in 48 AML samples. We planned to do this using MiSeq and have data from apilot of 3 samples. The data is promising but coverage appears pathcy so far.However, in order to get a better understanding of the data we will need deeper sequencing. Wewill need two lanes of HiSeq to get the same degree coverage as Sureselect.his data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001000285

• ALK_inhibitors_in_the_context_of_ALK_dependent_cancer_cell_lines

  Anaplastic lymphoma kinase (ALK) has recently been found to be a critical cancer gene in cases of lung cancer, neuroblastomas and lymphomas. ALK inhibitors have recently shown significant activity in lung cancer patients with tumours that harbour the EML4-ALK gene rearrangement, but already drug-resistance is emerging. We have taken a lung cancer cell line H3122 (with the EML4-ALK rearrangement) and generated clones resistant to a small molecule inhibitor of ALK by serial exposure to the drug over 8 weeks. We now wish to characterise at the exome level whether the acquisiton of resistance has been accompanied by the development of new mutations that we can take forward for further study as the potential mechansims underlying the resistance. We therefore propose to exome sequence the parental NCI-H3122 cell line as well as drug-resistant clones.

  Study EGAS00001000082

• Quantitative microbiome profiling disentangles inflammation- and bile duct obstruction-associated microbiota alterations across IBD/PSC diagnoses

  Disease-association microbiome dataset comprising 106 primary sclerosing cholangitis and/or inflammatory bowel disease (PSC/IBD) patients. Assessing quantitative taxon abundances, we study microbiome alterations beyond symptomatic stool moisture variation. We observe a high prevalence of a low cell count Bacteroides2 enterotype across patient groups when compared to healthy controls, with microbial loads correlating inversely with intestinal and systemic inflammation markers. Quantitative analyses allow us to differentiate between taxa associated to either intestinal inflammation severity (Fusobacterium) or cholangitis/biliary obstruction (Enterococcus) among previously suggested PSC marker genera. We identify and validate a near-exclusion pattern between the inflammation-associated Fusobacterium and Veillonella genera, with Fusobacterium detection being restricted to Crohn’s disease (CD) and PSC-CD patients. Overall, through absolute quantification and confounder control, we single out clear-cut microbiome markers associated to pathophysiological manifestations and disease diagnosis.

  Study EGAS00001003600

• Colorectal advanced adenomas NKI-AvL TGO COCOS series

  Colorectal cancer (CRC) develops from normal epithelium, through a benign precursor lesion called adenoma, by accumulation of genetic alterations affecting oncogenes and tumour suppressor genes. About 5% of colorectal adenomas are estimated to progress to CRC. However, it is important to identify which adenomas actually carry a high-risk of progression, because these serve as intermediate endpoints for e.g. screening programs. In clinical practice, adenomas with a size of ≥10 mm, villous component and/or high-grade dysplasia, called advanced adenomas, are considered high-risk, although solid evidence for this classification is lacking. Specific DNA copy number changes are associated with adenoma-to-carcinoma progression.For this tissue dataset, we applied low-pass whole genome sequencing to 96 advanced adenomas. Advanced adenomas were classified as lesions with low-risk or high-risk of progression, according to the presence of specific DNA copy number changes (Carvalho et al, CancerPrevRes, 2018).

  Study EGAS00001002952

• BLUEPRINT DNase accessibility of Epigenetic programming during monocyte to macrophage differentiation and trained innate immunity

  Monocyte differentiation into macrophages represents a cornerstone process for host defense. Concomitantly, immunological imprinting of either tolerance or trained immunity determines the functional fate of macrophages and susceptibility to secondary infections. Transcriptomes and epigenomes in four primary cell types: monocytes, in vitro differentiated naïve, tolerized and trained macrophages were characterized. Inflammatory and metabolic pathways were modulated in macrophages, including decreased inflammasome activation, and pathways functionally implicated in trained immunity were identified. Strikingly, β-glucan training elicits an exclusive epigenetic signature, revealing a complex network of enhancers and promoters. Analysis of transcription factor motifs in DNase I hypersensitive sites at cell-type specific epigenetic loci unveiled differentiation and treatment specific repertoires. Altogether, this study provides a resource to understand the epigenetic changes that underlie innate immunity in humans.

  Study EGAS00001000954

• Exome Sequencing in Moebius Syndrome

  Möbius syndrome (MBS; MIM 157900) is a neurological disorder that is characterized by paralysis of the facial nerves and variable other congenital anomalies. The etiology of this syndrome has been an enigma since the initial description in 1880 by von Graaefe and in 1888 by Möbius, and it has been debated for decades whether MBS has a genetic or a non-genetic etiology. Here, we reveal various de novo mutations affecting two genes, PLXND1 and REV3L. The finding that de novo mutations can cause Möbius syndrome will have considerable impact on further research, as well as in diagnostics. PLXND1 and REV3L represent totally unrelated pathways involved in hindbrain development: neural migration and DNA translesion synthesis, essential for the replication of endogenously damaged DNA. However, analysis of Plxnd1 and Rev3l-mutant mice revealed that both genetic defects converge at the facial branchiomotor nucleus, affecting either motoneuron migration or proliferation.

  Study EGAS00001001250

• BLUEPRINT RNA-seq of Epigenetic programming during monocyte to macrophage differentiation and trained innate immunity

  Monocyte differentiation into macrophages represents a cornerstone process for host defense. Concomitantly, immunological imprinting of either tolerance or trained immunity determines the functional fate of macrophages and susceptibility to secondary infections. Transcriptomes and epigenomes in four primary cell types: monocytes, in vitro differentiated naïve, tolerized and trained macrophages were characterized. Inflammatory and metabolic pathways were modulated in macrophages, including decreased inflammasome activation, and pathways functionally implicated in trained immunity were identified. Strikingly, β-glucan training elicits an exclusive epigenetic signature, revealing a complex network of enhancers and promoters. Analysis of transcription factor motifs in DNase I hypersensitive sites at cell-type specific epigenetic loci unveiled differentiation and treatment specific repertoires. Altogether, this study provides a resource to understand the epigenetic changes that underlie innate immunity in humans.

  Study EGAS00001000953

• Capture Hi-C identifies the chromatin interactome of colorectal cancer risk loci

  Multiple regulatory elements distant to their targets on the linear genome can influence the expression of a single gene through chromatin looping. Chromosome conformation capture implemented in Hi-C allows for genome-wide agnostic characterization of chromatin contacts. However, detection of functional enhancer-promoter interactions is precluded by its effective resolution that is determined by both restriction fragmentation and sensitivity of the experiment. Here we have developed a capture Hi-C (cHi-C) approach to allow an agnostic characterisation of these physical interactions on a genome-wide scale. Single nucleotide polymorphisms associated with complex diseases often reside within regulatory elements and exert effects through long-range regulation of gene expression. Applying this cHi-C approach to 14 colorectal cancer risk loci has allowed us to identify key long-range chromatin interactions in cis and trans involving these loci.

  Study EGAS00001001085

• Integrative sequencing reveals alterations in untreated and castration resistant prostate cancer

  We report the integrative sequencing of genomic, transcriptomic and DNA methylation changes in 28 untreated (PC) and 13 castration resistant prostate cancers (CRPC). AR, TGF-β and WNT signaling pathways were altered in CRPCs. We identified two new fusion genes, TMPRSS2-SKIL and DOT1L-HES6. Fusion analysis in an independent cohort validated SKIL as a recurrent 3’ fusion partner and oncogene in prostate cancer. The HES6 fusion was found in an AR-negative CRPC, and HES6 overexpression in vitro led to androgen independent growth. A distinct DNA methylation signature was found for CRPC. Transcriptome assembly uncovered 128 previously unannotated prostate cancer associated transcripts, including the ERG regulated transcript TPCAT-10-36067 whose knockdown had a dramatic effect on the growth, invasiveness, and rate of apoptosis of prostate cancer cells.

  Study EGAS00001000526

• BLUEPRINT ChIP-seq of Epigenetic programming during monocyte to macrophage differentiation and trained innate immunity

  Monocyte differentiation into macrophages represents a cornerstone process for host defense. Concomitantly, immunological imprinting of either tolerance or trained immunity determines the functional fate of macrophages and susceptibility to secondary infections. Transcriptomes and epigenomes in four primary cell types: monocytes, in vitro differentiated naïve, tolerized and trained macrophages were characterized. Inflammatory and metabolic pathways were modulated in macrophages, including decreased inflammasome activation, and pathways functionally implicated in trained immunity were identified. Strikingly, β-glucan training elicits an exclusive epigenetic signature, revealing a complex network of enhancers and promoters. Analysis of transcription factor motifs in DNase I hypersensitive sites at cell-type specific epigenetic loci unveiled differentiation and treatment specific repertoires. Altogether, this study provides a resource to understand the epigenetic changes that underlie innate immunity in humans.

  Study EGAS00001000951

• Detection of low-frequency DNA variants by targeted sequencing of the Watson and Crick strands

  Identification and quantification of low-frequency mutations remain challenging despite improvements in the baseline error rate of next-generation sequencing technologies. Here, we describe a method, termed SaferSeqS, that addresses this challenge by (1) efficiently introducing identical molecular barcodes in the Watson and Crick strands of template molecules and (2) enriching target sequences with strand-specific PCR. The method achieves high sensitivity and specificity and detects variants at frequencies below 1 in 100,000 DNA template molecules with a background mutation rate of <5 × 10-7 mutants per base pair (bp). We demonstrate that it can evaluate mutations in a single amplicon or simultaneously in multiple amplicons, assess limited quantities of cell-free DNA with high recovery of both strands and reduce the error rate of existing PCR-based molecular barcoding approaches by >100-fold.

  Study EGAS00001005048

• Molecular patterns of response and treatment failure after frontline venetoclax combinations in older patients with AML

  This study assessed molecular determinants of response in a cohort of patients with AML that were treated with venetoclax in combination with either DNA methyltransferase inhibitors or low dose cytarabine. RNA sequencing was performed on 31 patients from three different response classes [10 Group A - Durable remission (n=10), Group B - Relapsed (n=10) and Group C - Refractory (n=11)]. Library preparation and sequencing was performed at the Australian Genome Research Facility, using the Truseq Stranded mRNA library kit. Technical and batch replicate samples are included, and these replicates are designated in the sample name. Gene count data are provided with the original publication. The use of the sequencing data is subject to a data transfer agreement and is restricted to ethically approved research into blood cell malignancies and cannot be used to assess germline variants.

  Study EGAS00001003820

• Epigenetic profiling of colorectal cancer initiating cells (CC-ICs) to identify bivalently marked genes (H3K4me3 and H3K27me3 ChIP-seq), and investigation of changes in transcriptome following EZH2 inhibition using RNA-seq.

  Epigenetic regulation of transcription plays a crucial role in lineage commitment of embryonic stem cells. Promoters of key lineage-specific differentiation genes are found in a repressed bivalent state, having both activating H3K4me3 and repressive H3K27me3 histone marks, making them poised for transcription upon loss of H3K27me3 in response to environmental cues. Whether the tumour-initiating, self-renewing, cancer-initiating cells (C-ICs) have similar epigenetic regulatory mechanism that prevent lineage commitment is unknown. In order to investigate bivalently marked and repressed promoters, we used a patient-derived CC-IC enriched model to identify the changes in transcriptome following inhibition of EZH2, the H3K27 methyltransferase. We also performed ChIP-seq for H3K27me3 and H3K4me3 at baseline in order to identify repressed and bivalently marked promoters.

  Study EGAS00001003003

• IYDP Indonesian Y chromosome Diversity Project

  Island Southeast Asia and Oceania host one of the world’s richest assemblages of human phenotypic, linguistic and cultural diversity. We compiled ~9.7 Mb of Y chromosome sequence from a diverse sample of over 380 men from this region, including 126 from Indonesian islands, first reported here. The granularity of this dataset allows us to fully resolve and date the regional Y chromosome phylogeny. This improved Y chromosome topology highlights localized events with important historical implications, including pre-Holocene contact between Mainland and Island Southeast Asia, ongoing interactions between Australia and the Papuan world, and a sustained period of diversification following the flooding of the ancient Sunda and Sahul continents as the insular landscape of today formed. The high-resolution phylogeny of the Y chromosome presented here thus enables a detailed exploration of past isolation, interaction and change in one of the world’s least understood regions.

  Study EGAS00001006028

• Spatial atlas of clonal copy number alterations in co-existing benign and malignant tissue

  Defining the transition from benign to malignant tissue is fundamental to improve early diagnosis of cancer. Here, we use a systematic approach to study spatial genome integrity in situ and describe previously unidentified clonal relationships. We employed spatially resolved transcriptomics to infer spatial copy number variations in >120,000 regions across multiple organs, in benign and malignant tissues. We demonstrate that genome-wide copy number variation reveals distinct clonal patterns within tumours and in nearby benign tissue using an organ-wide approach focused on the prostate. Our results suggest a model for how genomic instability arises in histologically benign tissue that may represent early events in cancer evolution. We highlight the power of capturing the molecular and spatial continuums in a tissue context and challenge the rationale for treatment paradigms, including focal therapy.

  Study EGAS00001006124

• Targeting AXL Kinase Uniquely Sensitizes Therapy-Insensitive Leukemic Stem and Progenitor Cells to Venetoclax Treatment in Acute Myeloid Leukemia

  The abundance of genetic abnormalities and phenotypic heterogeneities in AML pose significant challenges to developing improved treatments. Here we demonstrated that a key GAS6/AXL axis is highly activated in AML patient cells, particularly in leukemic stem cells. We developed a potent, selective AXL inhibitor that has excellent pharmaceutical properties and efficacy against preclinical patient-derived xenotransplantation models of AML. Importantly, inhibition of AXL sensitized AML stem/progenitor cells to venetoclax treatment, with strong synergistic effects in vitro and in vivo. Mechanistically, single-cell RNA-sequencing and functional validation studies uncovered that AXL inhibition or in combination with venetoclax potentially targets intrinsic metabolic vulnerabilities of AML stem/progenitor cells, which shows a distinct transcriptomic profile and inhibits mitochondrial oxidative phosphorylation. These findings have direct translational impact on the treatment of AML and other cancers with high AXL activity.

  Study EGAS00001004663

• Genomic_profiling_of_B_other_Adult_ALL_RNA

  Adult ALL is an aggressive leukaemia, affecting adults of all ages. It is associated with a rapid onset and poor outcomes. Our understanding of adult ALL genome has been limited to molecular markers first described in paediatric ALL and validated in adult ALL and to date there have been no studies investigating the genomics of Adult ALL. We will perform whole genome sequencing on at least 100 Adult ALL cases. Priority will be given on ALL cases without a known primary lesion by cytogenetic analysis which are categorised as “B-other”. We will also sequence representative cases of each known subtype. This will deliver a comprehensive annotation of the genomic landscape of Adult ALL to include acquired somatic mutations (substitutions, indels, structural variants/fusion genes) and copy number profiles. The focus on B-other Adult ALL is likely to result in new and previously undescribed genomic lesions.

  Study EGAS00001003428

• Application of high-throughput, high-depth, targeted single-nucleus DNA sequencing in pancreatic cancer

  Despite insights gained by bulk DNA sequencing of cancer it remains challenging to resolve the admixture of normal and tumor cells, and/or of distinct tumor subclones; high throughput single-cell DNA sequencing circumvents these and brings cancer genomic studies to higher resolution. However, its application has been limited to liquid tumors or a small batch of solid tumors, mainly because of the lack of a scalable workflow to process solid tumor samples. Here we optimized a highly automated nuclei extraction workflow that achieved fast and reliable targeted single-nucleus DNA library preparation of 38 samples from 16 pancreatic ductal adenocarcinoma (PDAC) patients, with an average library yield per sample of 2867 single nuclei. We demonstrate that this workflow not only performs well using low cellularity or low tumor purity samples but reveals novel genomic evolution patterns of PDAC as well.

  Study EGAS00001006024

• Single-cell RNA-seq of bronchoalveolar lavage (BAL) fluid in severe COVID-19 and SARS-CoV-2 stimulated classical blood monocytes

  We analyzed pulmonary monocyte and macrophage responses as well as and pulmonary pathology in two cohorts of patients with COVID-19 associated ARDS. Monocyte-derived macrophages accumulated in the lung during ARDS and acquired a profibrotic signature, characterized by high expression of known fibrogenic factors like TGFB1, SPP1 and LGMN. COVID-19 associated macrophages showed highly significant transcriptional similarity with profibrotic macrophage populations identified in idiopathic pulmonary fibrosis (IPF). Notably, overnight exposure to SARS-CoV-2, but not influenza A virus or viral RNA analogues, induced a similar phenotype in human monocytes from healthy volunteers in vitro. Patients with severe COVID-19 associated ARDS showed clear clinical, radiographic and histopathological features of scarring and fibrotic tissue remodeling. In conclusion, SARS-CoV-2 triggers profibrotic macrophage responses, fibroproliferative ARDS, and lung fibrosis

  Study EGAS00001004928

• single-stranded DNA study

  A ssDNA library protocol was applied to cfDNA from plasma samples obtained from different DNA extraction methods and revealed significant differences in DNA fragmentation patterns in comparison to dsDNA-based protocols. In particular, a specific combination of methods revealed a population of ultrashort fragments, organized at ~50 bp. We observed significant differences in the relative abundance of these ultrashort DNA fragments in plasma from healthy individuals and cancer patients. Through shallow whole genome sequencing (sWGS, <0.5-fold coverage) and the analysis of somatic copy number aberrations (SCNA), we determined the landscape of genetic alterations in this newly identified population of cfDNA fragments. In addition, we studied their potential link with regulatory regions by investigating the genome-wide coverage patterns at transcription start sites (TSS). Furthermore, we demonstrated that the ultrashort cfDNA fragments map to regions associated with secondary DNA structures, G-quadruplexes (G4s).

  Study EGAS00001005093

• Beacon v2 and Federated EGA, part of the GDI project Starter Kit to enable access to genomic and phenotypic data across borders

  The European Genomic Data Infrastructure project has released a ‘Starter Kit’ based on the rare disease and cancer proof-of-concepts from the Beyond 1 Million Genomes (B1MG) project. The Starter Kit, freely available to any interested parties, contains a set of software applications and components co-developed by the 20 GDI nodes and based on open community standards from the Global Alliance for Genomics and Health (GA4GH). Products in the Starter Kit give all countries the technical capability to access synthetic genomic and phenotypic data across borders. The image above shows the full workflow of the GDI Starter Kit user journey. The dotted circles are not included in the Starter Kit yet The EGA’s work is represented in the Starter Kit with Beacon v2 and Federated EGA among the software applications and components. About Beacon v2 Beacon is a protocol for data discovery. This API allows the search of genomic variants and associated information without breaching the datasets privacy. The European Genome-phenome Archive (EGA) is a key contributor to the Beacon v2 Protocol, the Beacon v2 Reference Implementation (B2RI) and the EGA Beacon(s). About Federated EGA The Federated EGA network offers a tool for data storage and sharing. Officially launched in 2022, this network of connected resources enables transnational discovery of and access to human omics data for research, while also respecting jurisdictional data protection regulations. The Federated EGA Onboarding Website contains all the information related to the establishment of a Federated Node.

  Blog beacon-v2-and-federated-ega-part-of-the-gdi-project-starter-kit

• Genome wide association study of Coeliac Disease

  We performed a second-generation genome-wide association study of 4,533 individuals with celiac disease (cases) and 10,750 control subjects. We genotyped 113 selected SNPs with P(GWAS) < 10(-4) and 18 SNPs from 14 known loci in a further 4,918 cases and 5,684 controls. Variants from 13 new regions reached genome-wide significance (P(combined) < 5 x 10(-8)); most contain genes with immune functions (BACH2, CCR4, CD80, CIITA-SOCS1-CLEC16A, ICOSLG and ZMIZ1), with ETS1, RUNX3, THEMIS and TNFRSF14 having key roles in thymic T-cell selection. There was evidence to suggest associations for a further 13 regions. In an expression quantitative trait meta-analysis of 1,469 whole blood samples, 20 of 38 (52.6%) tested loci had celiac risk variants correlated (P < 0.0028, FDR 5%) with cis gene expression

  Study EGAS00000000057

• Cooperative activity of BRAF F595L and mutant HRAS in histiocytic sarcoma provides new insights into oncogenic BRAF signaling

  Mutations that activate the RAF-MEK-ERK signaling pathway, in particular BRAFV600E, occur in many cancers, and mutant BRAF-selective inhibitors have clinical activity in these diseases. Activating BRAF alleles are usually considered to be mutually exclusive with mutant RAS, whereas inactivating mutations in the D594F595G596 motif of the BRAF activation segment can coexist with oncogenic RAS and cooperate via paradoxical MEK/ERK activation. We determined the functional consequences of a largely uncharacterized BRAF mutation, F595L, which was detected along with an HRASQ61R allele by clinical exome sequencing in a patient with histiocytic sarcoma and also occurs in epithelial cancers, melanoma, and neuroblastoma, and investigated its interaction with mutant RAS. We demonstrate that, unlike previously described DFG motif mutants, BRAFF595L is a gain-of-function variant with intermediate activity towards MEK that does not act paradoxically, but nevertheless cooperates with mutant RAS to promote oncogenic signaling. Of immediate clinical relevance, BRAFF595L shows divergent responses to different mutant BRAF-selective inhibitors, whereas signaling driven by BRAFF595L with and without mutant RAS is efficiently blocked by pan-RAF and MEK inhibitors. Mutation data from primary patient samples and cell lines show that BRAFF595L, as well as other BRAF mutations with intermediate activity, frequently coincide with mutant RAS in a broad spectrum of cancers. These data define a novel class of activating BRAF mutations that cooperate with oncogenic RAS in a non-paradoxical fashion to achieve an optimal level of MEK-ERK signaling, extend the spectrum of patients with systemic histiocytic disorders and other malignancies who are candidates for therapeutic blockade of the RAF-MEK-ERK pathway, and underscore the value of comprehensive genetic profiling for understanding the signaling requirements of individual cancers.

  Dataset EGAD00001001384

• Single Cell Analysis of Human Airways in Healthy and Asthma volunteers

  Bronchoscopies were collected from healthy and asthma volunteers. Cohort inclusion criteria for all subjects were: age between 40 – 65 years and history of smoking &lt; 10 pack years. For the asthmatics, inclusion criteria were: age of onset of asthmatic symptoms ≤12 years, documented history of asthma, use of inhaled corticosteroids with(out) β2-agonists due to respiratory symptoms and a positive provocation test (i.e. PC20 methacholine ≤8mg/ml with 2-minute protocol). For the non-asthmatic controls, the following criteria were essential for inclusion: absent history of asthma, no use of asthma-related medication, a negative provocation test (i.e. PC20 methacholine &gt;8 mg/ml and adenosine 5'-monophosphate &gt;320 mg/ml with 2-minute protocol), no pulmonary obstruction (i.e. FEV1/FVC ≥70%) and absence of lung function impairment (i.e. FEV1 ≥80% predicted). Asthmatics stopped inhaled corticosteroid use 6 weeks prior to all tests. All subjects were clinically characterised with pulmonary function and provocation tests, blood samples were drawn, and finally subjects underwent a bronchoscopy under sedation. If a subject developed upper respiratory symptoms, bronchoscopy was postponed for ≥6 weeks. Fibreoptic bronchoscopy was performed using a standardised protocol during conscious sedation. Six macroscopically adequate endobronchial biopsies were collected for this study, located between the 3rd and 6th generation of the right lower and middle lobe. Extracted biopsies were processed directly thereafter, with a maximum of one hour delay. The medical ethics committee of the Groningen University Medical Center Groningen approved the study, and all subjects gave their written informed consent.

  Dataset EGAD00001005064

• The impact of mutational clonality in predicting the response to anti-PD-L1/PD-L1 in advanced urothelial cancer

  The advent of immune checkpoint inhibitors (ICI) has radically changed the management and therapeutic treatment landscape for patients with cancer. It has been shown that the use of these inhibitors can result in long-term complete remissions even in cases with advanced stages of the disease. However, only a small fraction of patients respond to the treatment. A better understanding of which factors could drive this clinical benefit is fundamental to building more accurate predictive biomarkers and developing alternative therapeutic options for patients who are unlikely to benefit. In order to address this issue, we have generated and analyzed whole exome sequencing (WES) and RNA sequencing (RNASeq) data from a cohort of metastatic urothelial carcinoma patients (N = 27) treated with ICI such as anti-PD-(L)1 monoclonal antibodies.

  Study EGAS00001007086

• Genome-wide cell-free DNA biological patterns in patients with cancer

  The structure of cell-free DNA (cfDNA) is altered in the blood of cancer patients. From whole genome sequencing we retrieved the cfDNA fragment-end composition using a new software (FrEIA), as well as the cfDNA size and tumor fraction in three independent cohorts (n=925 cancer from &gt;10 types and 321 control samples). At 95% specificity, we detect 72% of cancer samples using at least one cfDNA measure, including 64% of early-stage cancer (n=220). cfDNA detection correlates with a shorter overall (p=0.018) and recurrence-free (p=0.006) survival in patients with resectable esophageal adenocarcinoma. Integrating cfDNA measures with machine learning in an independent test set (n=396 cancer, 90 controls) achieve a detection accuracy of 82% and AUROC of 96%. In conclusion, harnessing the biological features of cfDNA can improve at no-extra cost the diagnostic performance of liquid biopsies.

  Study EGAS00001007400

• Cancer of Low survival and UnMet Need – Pathologist Initiated

  Despite significant advances in diagnostic cancer histopathology, a subset of tumors remain unable to be classified using WHO criteria. The resulting diagnostic uncertainty can result in inappropriate clinical management and negative patient outcomes. We investigated whether combining histopathology with whole genome and transcriptome sequencing (WGTS) could improve the classification of tumors that posed diagnostic dilemmas despite extensive histopathology and standard molecular work-up at a quaternary oncology center. We successfully sequenced 45 tumors from an initial set of 54 unclassified tumors (83% success rate). A confident diagnosis was made for 38/45 tumors (84%). Additionally, potential treatment targets were identified in 21/45 tumors (47%). Theoretical comparison with alternative assays demonstrated that WGTS was uniquely capable of detecting critical diagnostic findings in 15/38 tumors (39%). This work supports augmenting histopathology and standard molecular pathology with WGTS in the classification of difficult-to-diagnose tumors.

  Study EGAS00001008112

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423