16131 results for "free fc coins and points Visit Buyfc26coins.com Alennukset toistuvista ostoista..p4v2"

in 31.59 milliseconds.

• Cancer-independent, second somatic NF1 mutation of normal tissues in neurofibromatosis type 1

  Cancer predisposition syndromes mediated by recessive cancer genes generate tumours via somatic variants (second hits) in the unaffected allele. Second hits may or may not be sufficient for neoplastic transformation. Here, we performed whole genome and exome sequencing on 479 tissue biopsies from a child with neurofibromatosis type 1, a multi-system cancer-predisposing syndrome mediated by constitutive monoallelic NF1 inactivation. We identified multiple independent NF1 driver variants in histologically normal tissues, but not in 610 biopsies from two non-predisposed children. We corroborated this finding using targeted duplex sequencing, including a further nine adults with the same syndrome. Overall, truncating NF1 mutations were under positive selection in normal tissues from individuals with neurofibromatosis type 1. We demonstrate that normal tissues in neurofibromatosis type 1 commonly harbour second hits in NF1, the extent and pattern of which may underpin the syndrome's cancer phenotype.

  Dataset EGAD00001015398

• Targeted sequencing of Human esophageal epithelium microbiopsies

  NOTCH1 mutant clones occupy the majority of normal human esophagus by middle age, but are comparatively rare in esophageal cancers, suggesting NOTCH1 mutations may promote clonal expansion but impede carcinogenesis. Here we test this hypothesis. Visualizing and sequencing NOTCH1 mutant clones in aging normal human esophagus, reveals frequent biallelic mutations that block NOTCH1 signaling.  In mouse esophagus, heterozygous Notch1 mutation confers a competitive advantage over wild type cells, an effect enhanced by loss of the second allele.  Notch1 loss alters transcription but has minimal effects on epithelial structure and cell dynamics. In a carcinogenesis model, Notch1 mutations were less prevalent in tumors than normal epithelium. Deletion of Notch1 reduced tumor growth, an effect recapitulated by anti-NOTCH1 antibody treatment.  We conclude that Notch1 mutations in normal epithelium are beneficial as wild type Notch1 promotes tumor expansion. NOTCH1 blockade has therapeutic potential in esophageal squamous tumors.

  Dataset EGAD00001006969

• Single-cell RNA sequencing data of peripheral blood mononuclear cells obtained from 30 ATL patients, 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Single-cell RNA sequencing (scRNA-seq) data of peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Dataset EGAD00001007015

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. It seems plausible that rates of implantation would improve if we had a better understanding of molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to identify candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Dataset EGAD00001005044

• Effects of busulfan, fludarabine and clofarabine treatment on human small intestinal organoids generated from healthy donors

  The intestine is vulnerable to chemotherapy-induced toxicity due to its high epithelial proliferative rate, making gut toxicity an off-target effect in several cancer treatments, including conditioning regimens for allogeneic hematopoietic cell transplantation (HSCT). In HSCT, intestinal damage is an important factor in the development of Graft-versus-Host Disease (GVHD), an immune complication in which donor immune cells attack the recipient's tissues. Here, we developed a novel human intestinal organoid-based 3D model system to study the effects of chemotherapy-induced intestinal epithelial damage at the RNA level. We show that chemotherapy conditioning specifically reprograms the intestinal epithelial transcriptome after treatment with either busulfan (3.5μM), fludarabine (15μM) or clofarabine (0.5μM) for 24h. This knowledge can potentially enable us to understand which changes undergo in healthy tissues upon conditioning and how those are related with immune activation typical in GVHD.

  Study EGAS00001007550

• Tracking the evolution of esophageal squamous cell carcinoma under dynamic immune selection by multi-omics sequencing

  Intratumoral heterogeneity (ITH) has been linked to decreased efficacy of clinical treatments. However, although genomic ITH has been characterized in genetic, transcriptomic and epigenetic alterations are hallmarks of esophageal squamous cell carcinoma (ESCC), the extent to which these are heterogeneous in ESCC has not been explored in a unified framework. Further, the extent to which tumor-infiltrated T lymphocytes (TILs) are directed against cancer cells, but how the immune infiltration acts as a selective force to shape the clonal evolution of ESCC is unclear. In this study, we perform multi-omic sequencing on 186 samples from 36 primary ESCC patients. Through multi-omics analyses, it is discovered that genomic, epigenomic, and transcriptomic ITH are underpinned by ongoing chromosomal instability. Based on the RNA-seq data, we observe diverse levels of immune infiltrate across different tumor sites from the same tumor. We reveal genetic mechanisms of neoantigen evasion under distinct selection pressure from the diverse immune microenvironment. Overall, our work offers an avenue of dissecting the complex contribution of the multi-omics level to the ITH in ESCC and thereby enhances the development of clinical therapy.

  Dataset EGAD00001009482

• Molecular risk stratification in patients with T1 colorectal cancer_WES

  The introduction of bowel cancer screening has led to a significant increase in the proportion of patients being diagnosed with asymptomatic, early-stage colorectal cancer (CRC). Although the majority of these patients are successfully treated with surgery alone, a small proportion of patients have 'born-to-be-bad' aggressive lesions with early dissemination leading to distant metastases. Current standard of care histological assessment is unable to distinguish between these aggressive versus non-aggressive early lesions which is essential to provide appropriate clinical management decisions. This study aims to carry out molecular and histological profiling of approximately 300 T1 CRCs in order to develop a molecular stratifier based on the risk of relapse in early-invasive CRC. This novel T1 cohort will represent the world's largest molecularly characterised T1 cohort of samples, with digital pathology assessment alongside whole exome sequencing, copy number variation analysis and 3' RNA-seq. This data will be used to generate a robust panel of molecular and/or histological markers applicable to formalin-fixed paraffin embedded (FFPE) archival tissue which discriminates between T1 lesions based on risk of relapse, which will ultimately be used to inform clinical management of CRC at the earliest stages of the disease.

  Dataset EGAD00001010890

• ChIIP-seq and RNA-seq

  epigenome profiling in tumor tissues and paired normal tissues of LUAD patients and transcriptome profiling in tumor tissues of LUAD patients.

  Dataset EGAD00001007066

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Exome sequencing for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome

  Exome sequencing was performed for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome. Tumor DNA was extracted from adrenocortical adenomas and normal DNA was extracted from adjacent adrenal tissues or periphral blood.

  Dataset EGAD00001000715

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• Pakistan_Damgaard2018

  Genotype data for 140 present-day individuals from five populations in Pakistan in The first horse herders and the impact of early Bronze Age steppe expansions into Asia DOI: 10.1126/science.aar7711. Sampling details are presented in supplementary section S2.1 Data generation

  Dataset EGAD00010001678

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• AmsterdamUMC Data Access Committee for the study "Multi-omic analysis of thyroid dysfunction in Down Syndrome"

  The current data access committee reviews and assesses data requests of researchers that seek to gain access to data acquired as part of the "Multi-omic analysis of thyroid dysfunction in Down Syndrome" study as performed at the AmsterdamUMC, Amsterdam, Netherlands.

  Dac EGAC50000000186

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• cytogenetically visibile inversions

  Pacbio Hifi whole genome sequencing data from six individuals carrying cytogenetically visible inversions. The HiFi data was produced on the PacBio Revio machine, using 1 flowcell per sample. The resulting data was aligned to hg19 using minimap2, and converted into bam using samtools.

  Dataset EGAD50000000635

• Raw ONT R10 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 207 samples sequenced using rapid-multiplexed barcoded library preparation on Nanopore PromethION R10 flow cells on P2 Solo and P24 systems. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000791

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• Tumor Profiler Project - AML bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 23 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000822

• Tumor Profiler Project - AML scDNA data

  The dataset contains single-cell DNA seq data from 21 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000824

• Tumor Profiler Project - MEL bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 80 samples from 77 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000851

• Tumor Profiler Project - MEL scDNA data

  The dataset contains 10x Chromium single-cell DNA sequencing data from 63 samples from 60 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000852

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• PRPH2-Related Retinal Dystrophies

  NGS dataset including patients affected by genomic variants at gene PRPH2. It includes NGS test using custom IRD gene panels, clinical exome sequencing (CES) and whole-exome sequencing (WES).

  Dataset EGAD50000001239

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Targeted capture sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Targeted capture sequencing for 366 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study and 29 samples from a previously uploaded dataset.

  Dataset EGAD50000001364

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• DDD-Africa Exome Sequencing

  1230 participants from both South Africa and The Democratic Republic of Congo underwent whole exome sequencing on an Illumina NovaSeq 6000 at Wellcome Trust Sanger Institute.

  Dataset EGAD00001015728

• Dataset for desmoplastic small round cell tumor - WGS

  This dataset contains 25 WGS sequencing samples of patients with desmoplastic small round cell tumor. Sequencing was performed on Illumina HiSeq X and NovaSeq 6000 using Illumina TruSeq Nano DNA Kit. The sequencing was always paired.

  Dataset EGAD50000000911

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• Bulk RNASeq of metastatic colorectal cancer organoids with ATOH1 knockout

  Bulk RNA sequencing was performed on mCRC organoids subjected to cetuximab treatment, comparing ATOH1 knockout and control conditions. The dataset is intended to elucidate the contribution of ATOH1-regulated secretory cell population to cetuximab persistence mechanisms.

  Dataset EGAD50000002060

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• 2017_ AML WGS analysis result

  This data is belong to 2017 AML genome data which is aligned to human reference(human_g1k_v37.fasta). There are 10 paired tumor/normal samples from SNUH. All samples has passed QC and recalibration steps while aligning to reference.

  Dataset EGAD00001003599

• Kidney tumour_DNA (2018-09-19)

  This is a bulk DNA and RNA sequencing study of human renal tumours . This dataset contains all the data available for this study on 2018-09-19.

  Dataset EGAD00001004346

• Low pass whole genome sequencing of CACRC

  Genome-wide copy number profiling was performed using low-pass whole genome sequencing on archival non-dysplastic mucosa (n=9), low-grade dysplasia (LGD; n=30), high-grade dysplasia (HGD; n=13), mixed LGD/HGD (n=7) and CA-CRC (n=19).

  Dataset EGAD00001004270

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• Sporadic and endemic Burkitt lymphoma have frequent FOXO1 mutations but distinct hotspots in the AKT recognition motif

  Sample set of 74 whole-exome sequencing samples from sporadic Burkitt lymphoma patients from the UK. 33 of these samples have matched constitutional data, giving a total number of 107 samples

  Dataset EGAD00001005105

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• SMRT-seq

  In this study, we enhanced 5mC detection using SMRT sequencing by holistically analyzing kinetic signals of a DNA polymerase and sequence context for every base within a measurement window. We employed a convolutional neural network to train a methylation classification model.

  Dataset EGAD00001006875

• RNA-seq of SMARCA2/4 knock-down prostate cancer cell lines

  RNA-seq of SMARCA2/4 knock-down prostate cancer cell lines (LNCaP and 22Rv1, 15 samples altogether). Dataset contains BAM files from RNA-seq performed using Illumina HiSeq 2500.

  Dataset EGAD00001005800

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• Whole genome sequencing of adult T-cell leukemia/lymphoma.

  Whole genome sequencing of 48 tumor/normal pairs obtained from adult T-cell leukemia/lymphoma. This data set includes 11 full-pass WGS and 37 low-pass WGS data.

  Dataset EGAD00001001412

• Data files for PCGP SJACT WES

  This dataset contains WES files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002679

• Oxford Nanopore whole genome sequencing of two patients with congenital disease

  BAM files with sequencing reads derived from Oxford Nanopore MinION whole genome sequencing of two DNA samples from lymphoblastoid cell lines from two patients with congenital disease. Samples were prepared using 1D and 2D library preps.

  Dataset EGAD00001003511

• Blood plasma and paired genomic DNA from neuroblastoma patients

  The dataset is comprised of 3 blood plasma samples (Patient 1-3_plasma_cfDNA) paired with genomic DNA (Patient 1-3_tumor gDNA) from the corresponding primary neuroblastoma from three patients. For all these samples whole-exome sequencing (WES) data have been generated.

  Dataset EGAD00001006012

• Leiomyosarcoma RNA-Seq

  RNA was extracted from fresh frozen LMS material for 29 untreated tumors (24 primary tumors, 5 metastatic12 relapses) and 13 tumors treated with radiation(7 primaries, 6 metastatic relapses). RNA-Seq sequencing was performed using established protocols on Illumina HiSeq 2500

  Dataset EGAD00001006628

• Human placenta microRNA sequencing dataset

  Human placenta samples from 52: 5 first trimester , 7 second trimester, and 40 term placenta. Data is uploaded as BAM files.

  Dataset EGAD00001007766

• CASCADE Metastatic Melanoma Rapid Autopsy sequencing data

  Sequence data (paired-end FASTQ format) for 209 samples from 73 sample sites, from 7 individuals. Samples include primary melanomas, metastatic tumours and ctDNA

  Dataset EGAD00001006867

• CBD-RAW-REPERTOIRE-T: T cell bulk repertoire sequence files

  fastq and filtered fasta files for T-cell receptor sequencing. For further information regarding this dataset, please contact Rachael Bashford-Rogers at contact@combat.ox.ac.uk.

  Dataset EGAD00001007961

• 2017_ AML prospective data analysis result

  This data is belong to 2017 AML prospective data which is aligned to human reference(human_g1k_v37.fasta). There are 10 paired tumor/normal samples from SNUH. All samples has passed QC and recalibration steps while aligning to reference.

  Dataset EGAD00001003598

• Transcription factor binding in human monocyte differentiation

  This dataset consists of ChIP-seq data data from human monocytes, monocyte-derived dendritic cells as well as monocyte-derived cells that were subjected to mRNA transfection for PU.1, IRF4, and EGR2. In total, it the data set includes 18 samples.

  Dataset EGAD00001006602

• Whole exome sequencing of 76 individuals with familial atrial fibrillation

  Whole exome sequencing of 76 individuals with familial atrial fibrillation. BAM files have been aligned with BWA meme algorithm. Fastq files were filtered and trimmed using cutadapt. Samples have been sequnced on an Illumina 2500 machine.

  Dataset EGAD00001004333

• Somatic point mutation data from microsatellite unstable colorectal cancers

  The dataset contains the somatic point mutation data from the exome-targeted region of 36 exome or whole genome sequenced microsatellite unstable colorectal cancers and the somatic point mutation data from 93 additional MiSeq sequenced microsatellite unstable colorectal cancers.

  Dataset EGAD00001004281

• Whole genome sequence of liver cancers displaying biliary phenotype

  RIKEN collection WGS reads for 61 liver cancer and matched blood samples from 30 donors displaying biliary phenotype

  Dataset EGAD00001000809

• EFFORT occupationally exposed human stool metagenomes (148 samples)

  Metagenomes of stool samples from 54 pig farmers, 24 broiler farmers and 70 slaughter line workers. Note: Access to the data will only be granted for antibiotic resistance studies in accordance with the EFFORT consents issued by the participants.

  Dataset EGAD00001005444

• Epigentic sequence data of monocytes and macrophages

  Data for paper: Epigenetic dynamics of monocyte to macrophage differentiation with Chip Seq, NOMe, mRNA, total RNA, noncoding RNA, whole genome bisulfite seq,

  Dataset EGAD00001002201

• Chromatin accessibility in human monocyte differentiation

  This dataset consists of ATAC-seq data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 26 samples.

  Dataset EGAD00001006601

• 2014 AML WES analysis result

  This data is belong to 2014 AML patients' exome data which is aligned to human reference(human_g1k_v37.fasta). There are 51 paired tumor/normal samples from SNUH. All samples has passed QC and recalibration steps while aligning to reference.

  Dataset EGAD00001003932

• CBD-RAW-SC-ATAC: 10X Single-Cell ATAC

  Raw Illumina sequencing data from single-cell ATACSeq experiments. For further information regarding this dataset, please contact Julian Knight and Tatjana Sauka-Spengler at contact@combat.ox.ac.uk.

  Dataset EGAD00001007963

• TransNEO neoadjuvant breast cancer study

  Whole exome, shallow whole genome, and RNA-sequencing data from a cohort of 168 women with breast cancer receiving neoadjuvant chemotherapy.

  Dataset EGAD00001008269

• Shwachman-Diamond syndrome (SDS) Exome sequencing

  Shwachman-Diamond syndrome (SDS) is a rare autosomal recessive disorder characterized by exocrine pancreatic insufficiency, bone marrow dysfunction, leukemia predisposition, and skeletal abnormalities. We aim to characterise the structural effects of SDS in patients with this disorder by exome sequencing.

  Dataset EGAD00001000847

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• High-throughput sequencing data for study of molecular drivers of resistance to castration in localised prostate cancer

  Aligned whole-genome sequencing and RNA-seq of localised prostate cancer for study 'Loss of SNAI2 in prostate cancer correlates with clinical response to androgen deprivation therapy'.

  Dataset EGAD00001006640

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• CBD-RAW-RNASEQ: Bulk RNAseq data

  Bulk RNAseq data from whole blood. For further information regarding this dataset, please contact Katie Burnham and Andew Kwok at contact@combat.ox.ac.uk.

  Dataset EGAD00001007957

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• Genetic factors underlying premature MI in Greek families without vessel disease

  The study will analyse by exome sequencing 8 Greek family members with an excess of potentially damaging mutations relating to premature MI and no vessel disease, to identify genetic factors underlying this condition. This is a follow on from project GPMI-NVD

  Dataset EGAD00001002178

• MDS primary and xenografted samples

  This dataset contains bam files mapped to hg19 that either were primary bone marrow cells or sorted human cells after long term engraftment in NSG mice.

  Dataset EGAD00001007760

• Somatic mutations of 256 whole-genome sequenced colorectal cancer tumors.

  Somatic mutations of 256 whole-genome sequenced colorectal tumors. 234 MSS, 19 MSI and 3 POLE mutants. See Katainen R. et al. CTCF/cohesin-binding sites are frequently mutated in cancer, Nature Genetics 2015. doi:10.1038/ng.3335

  Dataset EGAD00001004329

• Whole Transcriptome Sequencing

  RNA-seq data of 15 snap-frozen tissue of peritoneal mesothelioma. The strand specific RNA library prepared using TruSeq (Illumina) and pair-end sequencing performed in Illumina HiSeq 4000. The datasets contains paired fastq files for each of 15 tumor samples.

  Dataset EGAD00001004504

• NKI-AvL OpACIN DNA-seq of stage III melanoma patients

  The dataset “NKI-AvL OpACIN DNA-seq of stage III melanoma patients" includes 2 x 18 normal and 2 x 18 tumor FASTQ files from paired-end whole exome sequencing on Illumina HiSeq2500 for 18 stage III melanoma patients.

  Dataset EGAD00001004217

• TRACERx pilot study, phase 2

  Multi-region Illumina whole-exome and/or whole-genome sequencing on tumor regions collected from early-stage NSCLC patients who underwent definitive surgical resection prior to receiving adjuvant therapy.Patients covered by this dataset: L012, L013, L015, L017

  Dataset EGAD00001001918

• Metastatic Breast Cancer Whole Genome

  We propose to definitively characterise the somatic genetics of Metastatic breast cancer through generation of comprehensive catalogues of somatic mutations in Metastatic breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000899

• Whole genome sequencing of RIKEN liver cancers

  RIKEN collection of WGS reads of 530 liver cancer and matched blood samples from 260 donors.

  Dataset EGAD00001001642

• Deep-Seq: Resistance to anti-EGFR therapy in colorectal cancer

  In this study we performed ultra deep sequencing of genes associated with anti-EGFR resistance, such as KRAS, BRAF, PIK3CA, and EGFR in 17 plasma-DNA samples from a total of 10 patients treated with anti-EGFR therapy.

  Dataset EGAD00001000688

• ICGC-LIRI-JP Release 15

  RIKEN collection WGS reads for 321 HCC and blood matched samples from 158 donors submitted to ICGC for release 15

  Dataset EGAD00001000808

• Metastatic breast cancer targeted gene screen (2014-09-24)

  The samples will be sequenced for a targeted panel of cancer relevant genes (n ~ 370) and analysed for somatic mutations. This dataset contains all the data available for this study on 2014-09-24

  Dataset EGAD00001001018

• IBDCA_Edinburgh

  In this experiment we have sequenced tumour normal pairs from patients presenting with CRC who have a prior history of inflammatory bowel disease. The idea is to identify driver mutations, new genes and novel pathways associated with the development of these malignancies.

  Dataset EGAD00001001330

• WGS on patients 5-7, study of metastatic prostate cancer

  Data from the study of subclonal metastatic expansion in prostate cancer. Whole genome shotgun sequencing of six samples, tumour and whole blood, from the three additional patients whose somatic variants were examined in depth.

  Dataset EGAD00001001344

• Metastatic breast cancer targeted gene screen (2017-05-11)

  The samples will be sequenced for a targeted panel of cancer relevant genes (n ~ 370) and analysed for somatic mutations. This dataset contains all the data available for this study on 2017-05-11.

  Dataset EGAD00001003330

• Genomic Landscape of Chordoid Glioma

  This data set consist genomic information of 10 Chordoid Glioma samples: - Exome sequencing: 10 tumors and matched normal DNA for four of them (BAM files) - RNAseq : 10 tumors (fastq files) - CNV array: 9 tumors (IDAT files)

  Dataset EGAD00001004112

• Prognostic markers of DNA methylation and NGS sequencing in progressive glioblastoma from the EORTC-26101 trial

  These dataset contains NGS data from 380 samples from the EORTC-26101 clinical trial for patients with progressive glioblastoma.

  Study EGAS00001007421

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• SEF tumor sequencing data

  This dataset contains samples from 8 patients with Sclerosing epithelioid fibrosarcoma. All 8 samples have whole exome tumor data and tumor RNAseq data. 3 samples also have matched normal dna sequence data.

  Dataset EGAD00001011100

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Subset of EGAS00001004662 WGS data (2 tumor/control pairs) which are used in EGAS00001004813 (Titel: Comprehensive Genomic and Transcriptomic Analysis of Rare Cancers for Guiding of Therapy (H021))

  Part of the published data from EGAS00001004662 resulted in the publication of this study EGAS00001004813

  Dataset EGAD00001008906

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975