19276 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins This is the best service ever..VBsp"

in 41.06 milliseconds.

• Whole genome sequence of intratumor heterogeneity study

  This dataset contains whole genome sequence data from 12 samples from 1 patient, including 8 tumor sectors and 4 normal samples. All the experiments were performed on Illumina HiSeq platform with raw reads stored in fastq format.

  Dataset EGAD00001005452

• MGRB dataset. GATK joint called variants of 2570 phase 2 samples.

  This dataset comprises a 2572 sample joint called vcf from the Medical Genome Reference Bank.

  Dataset EGAD00001005228

• Proteogenomic Landscape of Curable Prostate Cancer

  Aligned RNA-seq sequences in this dataset are from the Proteogenomic Landscape of Curable Prostate Cancer study

  Dataset EGAD00001004875

• 200PT : WG Aligned Sequence (bam)

  200PT : WG Aligned Sequence (bam)/ Aligned WG sequence data in this dataset are from CPCGene Tumour/Normal Pairs used in the 200PT Study

  Dataset EGAD00001004061

• TruSight Oncology 500 ctDNA targeted sequencing data from endometrial cancer patients

  This dataset contains targeted sequencing data generated using the TruSight Oncology 500 ctDNA v2 assay from plasma-derived cell-free DNA of dMMR endometrial cancer patients, at baseline and C3D1 of immunotherapy. Sequencing was performed on Illumina NovaSeq600. Dataset includes aligned sequencing files in BAM format generated using the DRAGEN TruSight Oncology 500 ctDNA v2.6.0 analysis pipeline.

  Dataset EGAD50000002262

• Purified vs unpurified stem cell-islets

  A scRNAseq dataset consisting of stem cell-derived islets treated with gradient separation (HUES8_Pure_Islets) and unpurified control (HUES8_control_islets). scRNAseq was done on cryopreserved stage 7 stem cell (HUES8 cell line)-derived islets. Details about stem cell differentiation and sequencing can be found on the publication by Rajaei et al. (2025, Science Translational Medicine). This dataset correspond to Fig 4 of the publication.

  Dataset EGAD50000001396

• Whole genome sequencing of circulating cell-free DNA on Illumina and Ultima platforms

  The dataset includes Illumina (n=1) and Ultima (n=92) sequencing of circulating cell-free DNA. The dataset was generated through standard whole genome sequencing (Illumina n=1 & Ultima n = 15) and using a duplex unique molecular identifier whole genome sequencing workflow (Ultima, n=77). This dataset includes cancer samples and cancer-free control samples.

  Dataset EGAD50000001234

• Whole-genome sequencing with complement C1s deficiency linked to systemic lupus erythematosus

  This dataset includes two FASTQ files (R1 and R2) from an Illumina germline nuclear DNA whole-genome sequencing run of a single sample. The sample corresponds to a 34-year-old male with a rare deficiency in complement component C1s, linked to systemic lupus erythematosus (SLE). Genomic analysis revealed two novel mutations in the C1S gene.

  Dataset EGAD50000000988

• RNA-Seq profiles from the CheckMate-649 Clinical Trial

  This dataset contains RNA sequencing (RNAseq) data of 814 patients from the CheckMate 649 clinical trial whose ICF allows data deposition into a public repository. Gene expression profiling was performed retrospectively using RNAseq on a subset of baseline tumor samples. Paired-end FASTQ files were processed on Seven Bridges platform (Seven Bridges Genomics).

  Dataset EGAD50000001105

• Total RNA sequencing of fibroblasts from an individual with fragile X syndrome

  Total RNA sequencing of fibroblasts from an individual with a methylated CGG repeat >200x in the FMR1 5'UTR. Libraries were prepared with total RNA with Ribo-Zero ribosomal RNA depletion (illumina), and sequenced paired-end, 75bp on a NextSeq 550 system. This dataset contains three RNA-sequencing replicates from the same cell line.

  Dataset EGAD50000000920

• Pediatric CNS tumor classification by DNA-methylation dataset

  In this study nanopore sequencing was applied to obtain sparse DNA methylation profiles from pediatric CNS tumor samples. A neural network was used to classify the tumor based on the obtained methylation profile.

  Dataset EGAD00010002599

• PacBio Rare Disease Study

  This study leverages PacBio HiFi long-read sequencing technology to comprehensively analyze the genomic architecture of rare diseases. By generating highly accurate, long-read sequences, we aim to resolve complex structural variants, repeat expansions, and other genomic features that are often missed by short-read sequencing. Our approach facilitates improved variant detection and interpretation, advancing the understanding of rare disease etiology and enabling more precise genetic diagnoses.

  Dataset EGAD00001015611

• Ultra-fast deep-learned pediatric CNS tumor classification.

  In this study nanopore sequencing was applied to obtain sparse DNA methylation profiles from pediatric CNS tumor samples. A neural network was used to classify the tumor based on the obtained methylation profile.

  Dataset EGAD00001011303

• Whole-genome sequencing of paired tumor and blood samples from 65 bladder cancer patients

  65 paired tumor and normal whole-genome sequencing samples from urothelial bladder carcinomas (UBC, the most common type of bladder cancer) are used to uncover the whole-genome mutational landscape of UBC. Recurrent mutations in noncoding regions affecting gene regulatory elements and structural variations leading to gene disruptions are prevalent in this type of cancer.

  Dataset EGAD00001004545

• Whole genome sequencing of metastatic cutaneous squamous cell carcinoma

  This dataset includes somatic small variant calling files derived from fifteen metastatic samples from cutaneous squamous cell carcinoma matched to normal blood samples. These samples were whole-genome sequenced by HiSeq X Ten and the resulting reads were mapped against the human genome (hg37) using BWA-MEM 0.7.10-r789. Somatic variant calling was then performed using strelka 1 (version 2.0.17).

  Dataset EGAD00001004530

• RNA-Seq for SF3B1 splicing signature

  This dataset includes exome-captured RNA-Seq made with exome v8 (Agilent) - library preparation on a MAGNIS XT-HS2 starting from 100ng of RNA. RNA has been extracted from lymphocytes cultures from 2 probands with SF3B1 mutations and 14 controls. All 16 RNA-Seq were sequenced on a single HighOutput flowcell 2x75bp (NextSeq550). Raw fastq files have between 20 and 30M paired-reads.

  Dataset EGAD50000002121

• DNA methylation changes associated with hyperglycemia in type 1 diabetes

  This dataset includes DNA methylation profiles from 112 young with Type 1 Diabetes (T1D) at T1D diagnosis, who were longitudinally monitored for hyperglycemia over an average duration of 3 years. These datasets were generated using whole-genome bisulfite sequencing. It includes 1872 fastq files (i.e. 936 paired-end fastq files) generated through 150 bp paired-end sequencing on Illumina HiSeqX.

  Dataset EGAD50000000545

• WES and RNAseq dataset

  This dataset includes WES and RNAseq for 7 patients with metastatic melanoma (4), non-small cell lung adenocarcnioma (1), cervix adenocarcinoma (1), and Epidermoid nasophaeyngeal carcinoma (1), enrolled in phase I clinical trials (NCT03475134m NCT04643574 and NCT05195619). WES was performed on matched cancer and healthy tissues, whereas RNAseq was performed on cancer tissues, using Illumina HiSeq 4000/6000 and Illumina NextSeq 500/550 systems.

  Dataset EGAD50000000337

• RNAseq of neuroblastoma PDX and cell lines

  This dataset contains 72 RNAseq (BAM and Fastq files are available for each sample).

  Dataset EGAD00001006558

• Transcriptome sequencing of myelodysplasia

  Transcriptome sequencing was performed on 214 patients with myelodysplasia in this study. RNA was obtained from bone marrow CD34+ cells (n=100) and/or bone marrow mononuclear cells (n=165). Transcriptome sequencing was performed for both cell fractions in 51 patients. A total of 211 patients were genotyped by targeted deep sequencing. We also studied bone marrow CD34+ cells and bone marrow mononuclear cells obtained from three healthy adults each.

  Dataset EGAD00001003891

• CATHeterization GENetics (CATHGEN)

  The CATHGEN biorepository consists of biological samples collected on 9334 sequential consenting individuals undergoing cardiac catheterization at Duke University Medical Center between 2001 and 2010 inclusive. The Institutional Review Board informed consent allowed for 50 mL of blood to be collected from fasting patients through the femoral arterial sheath during the catheterization procedure. Three 7.5 mL EDTA tubes for DNA extraction are stored at -80°C. The Duke Database for Cardiovascular Disease (DDCD) provides the bulk of the clinical data used for analysis. Follow-up includes mortality information gleaned from the National Death Index and Social Security Death Index plus follow-up phone calls and written questionnaires regarding MI, stroke, re-hospitalization, coronary re-vascularization procedures, smoking, exercise, and medication use.

  Study phs000703

• BAM files of Dorado base-called Oxford Nanopore whole-genome sequencing data from sporadic PD cases and non-PD controls

  This dataset contains whole genome sequencing data from 16 colon tissue samples, including 5 Parkinson’s disease (PD) cases and 11 non-PD controls. Sequencing was performed on the Oxford Nanopore PromethION platform using R10.4.1 flow cells. Raw pod5 files were processed with the public NanoWGS pipeline (https://github.com/AlexanRNA/nanowgs), which includes base calling using ONT Dorado v0.3.2 with modified bases detected using the --modified-bases 5mCG_5hmCG option. The processed data are provided as one BAM file per sample.

  Dataset EGAD50000002424

• RNAseq data from 112 samples of benign or malignant ovarian tumours

  This dataset contains ~1.2 TB RNA sequencing data in fastq format from 112 samples of fresh-frozen ovarian tumours from a total of 111 women, two samples being replicates. The samples were collected from the U-CAN collection at Uppsala Biobank and include both benign (n = 18) and malignant (n = 94) tumours. The RNA sequencing samples were sequenced using paired-end sequencing (2x150 bp) on an Illumina NovaSeq 6000 instrument at the SciLifeLab National Genomics Infrastructure (NGI) in Uppsala.

  Dataset EGAD50000001521

• Phase II Trial with Correlative Genomic Analysis of Durvalumab plus Pazopanib Combination in Patients with Advanced Soft Tissue Sarcomas

  This study includes an open-label, phase 2 study to determine the activity of the anti-VEGF receptor tyrosine-kinase inhibitor, pazopanib, combined with the anti-PD-L1 immune checkpoint inhibitor, durvalumab, in unselected advanced sarcomas. We conducted whole exome and transcriptomic sequencing with pre-treatment tissue biopsy to correlate clinical outcomes with molecular and genomic biomarkers to identify patients who would most likely benefit from the combination treatment.

  Dataset EGAD50000000114

• RNA-Seq data from tumor samples collected from 12 UTSW translocation renal cell carcinoma (tRCC) patients.

  This study investigates differentially expressed genes associated with the progression of translocation renal cell carcinoma (tRCC) by analyzing RNA-Seq data from 23 tumor samples obtained from 12 patients. The samples were collected from affiliated hospitals of the University of Texas Southwestern Medical Center (UTSW), including Parkland Hospital and Children’s Medical Center. RNA isolated from tumor samples was sequenced using the Illumina platform.

  Dataset EGAD50000000172

• Whole Mitochondrial DNA sequencing of Gingivo-buccal Cancer : ICGC-India Project

  This dataset pertains to mitochondrial DNA amplicon sequencing of paired DNA samples from gingivo-buccal oral cancer patients. DNA was isolated from the tumor and blood tissues of 89 patients (178 samples). The sequencing libraries were prepared from whole mitochondrial amplicons using Nextera XT DNA Library Preparation Kit (Illumina) and sequenced in Illumina HiSeq platform. The uploaded BAM files are generated by aligning paired-end reads to the mitochondrial reference sequence (rCRS) using BWA-MEM.

  Dataset EGAD00001004987

• Type 1 Diabetes Genetics Consortium (T1DGC): ImmunoChip Study

  The Type 1 Diabetes Genetics Consortium (T1DGC) was formed to address issues of limited sample size and consistency of phenotyping that had limited genetic investigations on risk of type 1 diabetes (T1D). The T1DGC first collected affected sib pair (ASP) families from four geographic networks (Asia-Pacific, Europe, North America, United Kingdom). In addition, T1D cases and controls were ascertained from existing and de novo collections. The T1DGC assembled 2,601 T1D ASP families and 69 Parent-T1D offspring trios, T1D cases from the UK Genetic Resource Investigating Diabetes (UKGRID, N=6,670), and controls from the British 1958 Birth Cohort (B58BC, N=6,523), the UK National Blood Services collection (NBS, N=2,893) and the NIHR Cambridge Biomedical Research Centre BioResource (CBR, N=2,846). All samples included in this series have reported or self-declared European ancestry. All DNA samples were collected after approval from relevant institutional research ethics committees. Genotyping was performed using a custom Illumina Infinium high-density genotyping array, ImmunoChip (Illumina, Inc; CA) according to manufacturer's protocols. The ImmunoChip was designed to densely genotype, using 1000 Genomes and any other available disease specific resequencing data, immune-mediated disease loci identified by common variant GWAS. The ImmunoChip Consortium selected 186 distinct loci containing markers meeting genome wide significance criteria (P<5x10-8) from twelve such diseases (autoimmune thyroid disease, ankylosing spondylitis, Crohn's disease, celiac disease, IgA deficiency, multiple sclerosis, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, systemic lupus erythematosus, T1D and ulcerative colitis). All 1000 Genomes Project pilot phase CEU population variants (Sept 2009 release) within 0.1cM (HapMap3 CEU) recombination blocks around each GWAS region lead marker were submitted for array design. No filtering on correlated variants (linkage disequilibrium) was applied. Additional content included regional resequencing data (submitted by several groups) as well as a small proportion of investigator-specific undisclosed content including intermediate GWAS results. After data cleaning and quality control, a total of 154,939 single nucleotide polymorphisms (SNPs) from 186 loci on ImmunoChip were scored. Case-control and family data were analyzed independently and combined by meta-analysis.

  Study phs000911

• Leukemia Data Access committee for the deposited data. The committee consists of the principal investigators for the data set.

  Dac EGAC00001003565

• Genetic Diseases of Immune Homeostasis and Autoimmunity Caused by GIMAP Deficiency

  We investigated 17 affected individuals in 9 kindreds with lymphopenia, splenomegaly, liver disease, thrombocytopenia, lymphadenopathy, severe recurrent lung infections, skin diseases, and lymphoma. Whole-exome sequencing of the cohort revealed mutations in GIMAP5. We also found another patient from one kindred with a unique mutation in the gene GIMAP6, discovered by whole-exome sequencing. A comprehensive investigation of this gene mutation through in vivo and in vitro experiments revealed that GIMAP6 deficiency results in defects in autophagy in patient T cells and interruption of GIMAP7 and GABARAPL2 interactions. GIMAP6 deficiency leads to affected patients to present with clinical phenotypes such as recurrent infections, lymphoproliferation, autoimmunity, and inflammation.

  Study phs002816

• Lysosomal Disease Network (LDN6719) Immune Response to Intrathecal Enzyme Therapy in Mucopolysaccharidosis 1 Patients

  In this study we characterized the immune response to intrathecal (IT) recombinant human alpha-L-iduronidase (rhIDU) in mucopolysaccharidosis I (MPS I) subjects with spinal cord compression who had been previously treated with intravenous rhIDU. Concentrations of specific antibodies and cytokines were measured in serum and cerebrospinal fluid (CSF) collected before monthly IT rhIDU infusions. These serologic findings were compared with clinical adverse event (AE) reports to establish temporal correlations with clinical symptoms. We found that IT rhIDU was generally well tolerated in the subjects studied although one subject had moderate to severe clinical symptoms and serologic abnormalities consistent with an immune response.

  Study phs000862

• Transcriptomic Profiling after B-Cell Depletion Reveals Central and Peripheral Immune Cell Changes in Multiple Sclerosis

  We investigated the immunological effects of B cell depletion therapy using ocrelizumab in treatment-naïve relapsing-remitting multiple sclerosis (RRMS) patients. Our primary aim was to delineate transcriptomic alterations in immune cell populations in peripheral blood before and after therapy, using single-cell RNA sequencing (scRNAseq). This study included 18 newly diagnosed, treatment-naïve RRMS patients who provided matched pre- and 6-month post-treatment peripheral blood mononuclear cells (PBMCs). A secondary cohort of five patients also contributed paired cerebrospinal fluid (CSF) samples. All RRMS patients were treated with ocrelizumab, except one patient in the CSF cohort who received rituximab.

  Study phs003938

• Metatranscriptomic Sequencing of Pulmonary Fluid in Immunocompromised Children

  Despite improved diagnostics, pulmonary pathogens in immunocompromised children frequently evade detection, leading to significant mortality. In version 1.0 of this study, we performed RNA-based next generation sequencing (mNGS) on 41 lower respiratory samples collected from 34 children. We identified a rich cross-domain pulmonary microbiome containing bacteria, fungi, RNA viruses, and DNA viruses in each patient. Potentially pathogenic bacteria were ubiquitous among samples but could be distinguished as possible causes of disease by parsing for outlier organisms. Potential pathogens were detected in half of samples previously negative by clinical diagnostics. In version 2.0, we included an addition 278 samples from 229 pediatric stem cell transplant patients with pulmonary disease.

  Study phs001684

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Genetic Effects on miRNA Expression During Mid-Gestation Neocortical Development

  In this study we aimed to find common genetic variants that influence miRNA expression during mid-gestation neocortical development. Small RNA-sequencing from 212 fetal cortical tissue samples between 14 and 21 weeks gestation were used to profile miRNA expression. Combined with donor genotypes, we were able to find miRNA-eQTLs during neocortical development. The dataset provided here includes 212 Small RNA-sequencing files in FASTQ format from cortical wall samples. Also provided here are 212 donor genotypes in PLINK format (hg19).

  Study phs003106

• TERT rearrangements are frequent in neuroblastoma and identify aggressive tumors

  Whole genome sequencing detected structural rearrangements of TERT in 17/75 high stage neuroblastoma with 5 cases resulting from chromothripsis. Rearrangements were associated with increased TERT expression and targeted immediate up- and down-stream regions of TERT, placing in 7 cases a super-enhancer close to the breakpoints. TERT rearrangements (23%), ATRX deletions (11%) and MYCN amplifications (37%) identify three almost non-overlapping groups of high stage neuroblastoma, each associated with very poor prognosis. This submission contains all newly sequenced samples only.

  Study EGAS00001001479

• Transcriptomic Profiling of an Anti-PD-L1 Treated Cohort of Newly Diagnosed GBM Patients

  Checkpoint inhibitor therapy has limited efficacy in glioblastoma patient outcomes. This study involves RNA sequencing (RNA-seq) of newly diagnosed GBM patients treated with concurrent atezolizumab, radiation therapy, and temozolomide. By analyzing RNA-seq data from 39 tumors, the study aims to explore tumor transcriptomic features, including immune-based transcriptomic programs and immune infiltration, to understand their influence on PD-L1 blockade treatment efficacy and to identify which patients may benefit more from such therapy.

  Study EGAS50000000784

• Evolutionary Genome Analysis of Transformation into Small Cell Carcinomas from Lung Adenocarcinomas

  Anecdotal case have been reported lung adenocarcinoma could occasionally transform into small cell carcinoma. Most of the reported cases were EGFR-mutant lung adenocarcinomas that transform into small cell carcinoma during EGFR tyrosine kinase inhibitor treatment. However, some cases also indicate lung adenocarcinomas without EGFR mutation could also transform into small cell carcinomas. Here we investigate this transformation process by whole genome sequencing of transformed small cell carcinomas as well as serially acquired samples of lung adenocarcinoma into small cell carcinomas.

  Study EGAS00001001757

• Relapse series of two Pediatric ALL patients

  In this proof of principle study, we performed whole genome sequencing of two cases with multiple relapses in order to investigate whether groups of mutations separated in time show distinct mutational signatures. In patient 1, who experienced two relapses, the analysis unraveled a continuous interplay of aberrant AID/APOBEC-associated activities. Patient 2 had three relapses. We identified episodic mutational processes at diagnosis and first relapse leading to mutations resembling UV light-driven DNA damage, and thiopurine-associated damage at first relapse.

  Study EGAS00001005001

• Measuring the level of relatedness between NGS datasets

  Sequencing technologies are providing increasingly detailed insight in genetic makeup are paving their way into molecular diagnostics. The field will benefit from rigorous and bias-free measures for the quality of sequence data and for the proper representation of the complexity of the original samples. While current methodologies rely on the availability of a well-characterized reference genome, we propose kMer profiling for alignment-free assessment of the quality, comparability, and complexity of sequencing datasets. We show that kMer detects technical artefacts such as high duplication rates, library chimaeras, and differences in library preparation protocols in whole-genome, whole-exome, and RNA sequencing data. Additionally, it successfully captures the complexity and diversity of microbiomes. Thus, kMer allows for a robust evaluation of the quality and complexity of sequencing data without relying on any prior information and opens the way to a more reliable biological reasoning.

  Study EGAS00001000600

• RNA sequencing of untreated and treated KRAS-mutated metastatic colorectal cancer PDX-derived organoids.

  RNA sequencing was performed on patient-derived xenograft (PDX)-derived organoid models of metastatic colorectal cancer (mCRC). The aim of this study was to characterize the transcriptional landscape of KRAS-mutant mCRC cells in response to therapeutic strategies targeting the EGFR and KRAS signaling pathways. Transcriptomic profiling was conducted following drug treatments to investigate molecular changes associated with single and combination therapies. A total of 24 samples were analyzed.

  Dataset EGAD50000002443

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The dataset comprises 27 single-cell multiome (ATAC + GEX) datasets generated from 13 patients with AML, collected across different stages of disease progression. In addition, matched long-read sequencing data from 5 samples were used to enable longitudinal analyses throughout the manuscript. Finally, bulk RNA-seq and ATAC-seq datasets from the cell line used in this study are also included.

  Dataset EGAD50000002359

• Somatic mutations reveal embryonic genetic bottlenecks generating placental mosaicism

  The human placenta harbours chromosomal aberrations that are absent from the fetus in one to two percent of pregnancies. This confined mosaicism suggests that embryonic genetic bottlenecks exist, which phylogenetically segregate placental tissue. Here, we studied the somatic genetic landscape of human placentas by whole genome sequencing of 86 placental biopsies and of 106 microdissections.

  Dataset EGAD00001006337

• Recalibrated whole-exome sequencing alignment files of Saudi papillary thyroid cancer

  The dataset consists of samples from papillary thyroid cancer patients. A total of 181 DNA samples from blood/normal and cancer tissue are subjected to whole exome sequencing using Illumina. The fastq files generated were aligned with reference genome ‘hg19’, duplicates were marked, realignment around indels and quality recalibration were performed to produce good quality variants. The recalibrated “.bam” files are included with this dataset.

  Dataset EGAD00001003358

• Clonal Evolution and Transcriptional Plasticity Shape Metastatic Dissemination Routes in Prostate Cancer

  This study provides comprehensive insights into the genetic and transcriptomic landscape of prostate cancer, highlighting significant clonal heterogeneity, transcriptional plasticity, and metastatic spread patterns. We examined the clonal evolution and metastatic dissemination of prostate cancer by integrating single-nuclei RNA sequencing (snRNA-seq) and low-pass whole-genome sequencing (WGS) data from 43 spatially distinct tumour samples in five patients with locally advanced disease. By reconstructing the evolutionary trajectories of each tumour, we identified distinct patterns of tumour evolution, including both monophyletic and polyphyletic metastatic dissemination, as well as ongoing primary tumour clonal evolution after metastatic spread. We observed converging changes leading to metastatic potential, such as androgen receptor independence and increased activity in the estrogen, WNT, and JAK/STAT pathways in identified seeding areas. These findings enhance our understanding of the disease's progression and may inform future therapeutic strategies.

  Study EGAS50000000927

• TenK10K Phase 1:  Single Cell

  Understanding the genetic basis of gene expression can shed light on the regulatory mechanisms underlying complex traits and diseases. Single-cell resolved measures of RNA levels and single-cell expression quantitative trait loci (sc-eQTLs) have revealed genetic regulation that drives sub-tissue cell states and types across diverse human tissues. Here, we describe the first phase of TenK10K, the largest- to-date dataset of matched whole-genome sequencing (WGS) and single-cell RNA-sequencing (scRNA-seq). We leverage scRNA-seq data from over 5 million cells across 28 immune cell types and matched WGS from 1,925 individuals. This provides power to detect associations between rare and low-frequency genetic variants that have largely been uncharacterised in their impact on cell-specific gene expression. We map the effects of both common and rare variants in a cell type specific manner using SAIGE-QTL.

  Study EGAS50000001653

• Conserved interferon-gamma signaling and decreased immune exclusion programs in responses to immune checkpoint blockade therapy

  We analyzed baseline and on-therapy tumor biopsies from 101 patients with advanced melanoma treated with nivolumab (anti-PD-1) alone or combined with ipilimumab (anti-CTLA-4). Analysis of whole transcriptome data showed that T cell infiltration and interferon-gamma signaling signatures corresponded most highly with clinical response to therapy, with a reciprocal decrease in cell cycle and WNT signaling pathways in responding biopsies. Clinical outcome differences were likely not due to differential melanoma cell responses to interferon-gamma, as 57 human melanoma cell lines exposed in vitro to this cytokine showed a conserved interferon-gamma transcriptome response unless they had mutations that precluded signaling from the interferon-gamma receptor. Therefore, the magnitude of the antitumor T cell response and the corresponding downstream interferon-gamma signaling are the main drivers of clinical response or resistance to immune checkpoint blockade therapy.

  Study EGAS00001004545

• single-stranded DNA study

  A ssDNA library protocol was applied to cfDNA from plasma samples obtained from different DNA extraction methods and revealed significant differences in DNA fragmentation patterns in comparison to dsDNA-based protocols. In particular, a specific combination of methods revealed a population of ultrashort fragments, organized at ~50 bp. We observed significant differences in the relative abundance of these ultrashort DNA fragments in plasma from healthy individuals and cancer patients. Through shallow whole genome sequencing (sWGS, <0.5-fold coverage) and the analysis of somatic copy number aberrations (SCNA), we determined the landscape of genetic alterations in this newly identified population of cfDNA fragments. In addition, we studied their potential link with regulatory regions by investigating the genome-wide coverage patterns at transcription start sites (TSS). Furthermore, we demonstrated that the ultrashort cfDNA fragments map to regions associated with secondary DNA structures, G-quadruplexes (G4s).

  Study EGAS00001005093

• Convergent somatic mutations in effectors of insulin signalling in chronic liver disease

  Chronic liver disease is associated with metabolic dysregulation, liver failure and hepatocellular carcinoma. We analysed somatic mutations from 1202 genomes across 32 liver samples, including normal controls, alcohol-related and non-alcoholic fatty liver disease. Five of 27 patients with liver disease carried hotspot driver mutations in FOXO1, the major transcription factor downstream of insulin signalling. FOXO1 mutations were independently acquired by up to 5 distinct clones within the same patient’s sample, and impaired insulin-mediated nuclear export of FOXO1. GPAM, which produces storage triacylglycerol from dietary calories, also had significant excess of mutations, similarly exhibiting convergent evolution within biopsies. Telomeres were shorter in diseased than normal liver, with attrition more pronounced in larger clones. Multiple independent acquisitions of drivers within one small liver sample imply that such mutations could affect hundreds of grams of tissue across the whole organ, potentially contributing to systemic metabolic dysfunction.

  Dataset EGAD00001006255

• Integrative and comparative genomic analyses identify clinically relevant groups of pulmonary carcinoids and unveil the supra-carcinoids

  Multi-omic data for lung neuroendocrine neoplasms, including the first multi-omic sequencing data for the understudied lung atypical carcinoids. The data includes Whole-exomes, whole-genomes, RNA-seq, and EPIC 850K methylation array data.

  Study EGAS00001003699

• ATAC-Seq on OCIAML-22 Fractions

  The donor AML patient (unsorted) that was used to generate OCI-AML22 was expanded for 3-4 months, then sorted for the indicated fraction (CD34p: CD34+; CD34m: CD34-)

  Study EGAS00001006511

• The dataset for "Validation of cfDNA fragmentome analyses for early detection of liver cancer"

  The dataset for “Validation of cfDNA fragmentome analyses for early detection of liver cancer” includes 380 cram files from whole genome next-generation sequencing on the Illumina NovaSeq 6000 with 10x coverage. The samples analyzed include plasma samples from patients with cancer and liver disease.

  Dataset EGAD00001015538

• Next Generation Sequencing platform for targeted Personalized Therapy of Leukemia - Acute myeloid leukemia

  The advent of high-throughput next generation sequencing (NGS) technologies that are revolutionizing genomics and transcriptomics by providing a single base resolution tool for a unified deep analysis of diseases complexity allows a fast and cost-efficient fine-scale assessment of the genetic variability hidden within cohorts of patients affected by the same leukemia. That being so, by potentially highlighting inter-individual differences that may play a role in the differential success of diverse therapeutic interventions, they promise to be crucial for selecting the most appropriate medical treatments. The project aims at the identification of novel prognostic biomarkers for acute myeloid leukemia (AML) and studied the molecular differences between aneuploid and euploid AML.

  Study EGAS00001005464

• Collaborative Cohort of Cohorts for COVID-19 Research (C4R): Atherosclerosis Risk in Communities Study (ARIC)

  Cohort Description The Atherosclerosis Risk in Communities (ARIC) study began in the mid-1980s with the initial aims being to describe the presence of subclinical atherosclerosis, the progression of atherosclerosis to clinical cardiovascular disease (CVD), and the association of novel risk factors with CVD. ARIC recruited its cohort of men and women aged 45-64 in 1987-89 from four communities (Forsyth County, NC; Jackson, MS; suburban Minneapolis, MN; and Washington County, MD). As of 2025, ARIC counts over 4,000 participants.Data Submitted Wave 1 questionnaire data includes 356 variables for up to 5763 ARIC participants in C4R. Wave 2 questionnaire data includes 367 variables for up to 5000 ARIC participants in C4R. Wave 3 questionnaire data includes 81 variables for up to 3450 participants in C4R.Dried Blood Spot/Serosurvey data includes 8 variables for up to 2437 ARIC participants in C4R. Derived data includes 62 variables for up to 18765 observations. Phenotype data includes 163 variables for up to 5937 ARIC participants in C4R. Brain MRI data includes 13 variables for up to 2550 participants in C4R.HCU data includes 21 variable for up to 631 ARIC participants in C4R.Lung CT data includes 15 variables for 1329 ARIC participants in C4R.Neurocognitive data includes 16 variables and 49826 observations.Serosurvey data includes 20 variables for 1707 ARIC participants in C4R.

  Study phs002988

• Genotype variables of the 61 COVID-19 patient cohort used in the main project of data integration

  We selected SNPs with a minor allele frequency (MAF) higher than 10% in the Caucasian population from the Ensembl database. Specifically, we selected ACE2 (rs2285666), MX1 (rs469390), and TMPRSS2 (rs2070788) for the present analysis. For more information, please refer to:

  Study EGAS50000000589

• Clinical activity and molecular correlates of response to atezolizumab alone or in combination with bevacizumab versus sunitinib in renal cell carcinoma

  We examined pre-treatment tumors from participants of the IMmotion150 trial. Biomarker analyses indicate that high angiogenesis gene expression was associated with improved PFS within the sunitinib arm, and high T-effector/IFNγ response (Teff) gene expression with longer PFS in atezolizumab + bevacizumab vs sunitinib patients. In high Teff tumors, concomitant high myeloid inflammation was associated with worse PFS in the atezolizumab monotherapy arm; adding bevacizumab to atezolizumab in this subgroup improved PFS vs atezolizumab. Molecular profiles suggest that prediction of outcomes with VEGF inhibitors and immunotherapy may be possible in mRCC, and bevacizumab may overcome myeloid inflammation-associated atezolizumab resistance.

  Study EGAS00001002928

• Synchronous patterning of hiPSC-derived CNS progenitors generates comprehensive axial spinal cord organoids (CASCOs) containing diverse motor neuron population

  Advancements in human induced pluripotent stem cell (hiPSC) culture have enabled the generation of spinal cord organoids (SCOs), though achieving distinct axial identities in spinal motor neurons (spMNs) along the rostro-caudal (RC) axis remains a challenge. By optimizing the timing and sequence of patterning factors, we developed a mixed stem cell model of rostral neural stem cells (NSCs) and caudal neuromesodermal progenitors (NMPs) to generate SCOs with enhanced spMN heterogeneity, including a wide range of axial identities and benchmarked this against commonly used protocols. Our approach, termed CASO (Comprehensive Axial Spinal Organoids), also incorporates endothelial networks and skeletal muscle to improve organoid complexity and health, offering a novel method to study spMN axial specification and model neurodegenerative diseases.

  Study EGAS50000000891

• SNP arrays for chemotherapy response project

  In this study, a total of 300 patients with MIBC receiving chemotherapy were included; 62 received NAC before cystectomy and 245 received first-line chemotherapy upon detection of locally-advanced (T4b) or metastatic disease. Treatment response, defined as pathological downstaging (< pTa,CIS,N0) after NAC or complete or partial response after first-line treatment (RECIST criteria). Illumina SNP arrays (760k markers) were performed using DNA from 49 tumors and associated germline DNA (49x median coverage). Data provided here consist of 98 files.

  Study EGAS00001004519

• Unraveling the heterogeneity of multiple myeloma identifies therapy resistant subpopulation with vulnerability to the splicing pathway intervention

  Intra-tumor heterogeneity underlies the therapy resistance of multiple myeloma (MM). However, its details remain unknown. Here, we performed single-cell RNA sequencing coupled with VDJ targeted sequencing on highly purified bone marrow lineage marker-negative CD38+ MM cells from patients at diagnosis and in remission. This approach successfully subdivided MM cells into distinct clusters, unraveling their heterogeneity and plasticity on the axis of cell surface CD138 expression. Notably, unique clusters were identified in the minor CD138-negative population that resisted therapies. CRISPR/Cas9 screening of upregulated genes in the resistant population identified their vulnerability to the splicing pathway inhibition, among which RNA-binding protein 39 (RBM39) appeared to be overexpressed in the resistant population and involved in aberrant splicing. Genetic and pharmacological inhibition of RBM39 exerted a profound synthetic lethal effect on them. Our results unveil an uncharacterized subpopulation associated with therapy resistance and provide a novel therapeutic strategy targeting the splicing pathway in MM.

  Study JGAS000723

• Multiome_HB

  Hepatoblastoma (HB) cells display strong phenotypic heterogeneity with a major impact on drug response, but the underlying mechanisms are poorly understood. Here, we use a single-cell multi-omic strategy to unravel the molecular determinants of this plasticity. HB display a continuum of single-cell states between hepatocytic (scH), liver progenitor (scLP) and mesenchymal (scM) differentiation poles, with an intermediate scH/LP population bordering scLP and scH areas in spatial transcriptomics. Chromatin accessibility landscapes reveal the gene regulatory networks of each differentiation pole, and the sequence of transcription factor activation underlying cell state transitions. Single-cell mapping of somatic alterations reveals the clonal architecture of each tumor, showing that each genetic subclone displays its own range of cellular plasticity across differentiation poles. The most scLP subclones, overexpressing stem cell and DNA repair genes, proliferate faster after neo-adjuvant chemotherapy. These results highlight how the interplay of clonal evolution and epigenetic plasticity shapes the potential of HB subclones to respond to chemotherapy.

  Study EGAS00001006932

• Project for Development of Innovative Research on Cancer Therapeutics; Identifiying the predictive factors for response to chemoherapy in ovarian cancer

  To identify novel predictive biomarkers of response to chemotherapy for clear cell carcinoma of the ovary

  Study JGAS000076

• Childhood Cancer Data Initiative (CCDI): Texas Pediatric Patient Derived Xenograft 

  The DNA/RNA samples of patients for which PDX models were developed were from a population of children, adolescents, and young adults from South Texas. Consent was obtained for collection of malignant and non-malignant tissue samples for genetic analysis and for the development of models to study new ways to treat cancer. For additional details, please refer to these publications: PMID: 37915590; PMID: 37990009.

  Study phs003215

• Spatial transcriptomics

  This dataset contains raw sequencing and processed data of spatially resolved transcriptomes. The data were generated with 10x Visium probe-based assay on FFPE tissues of 30 ST-EPN tumour resections. Raw data contain two-lane fastq files of the sequencing. Processed data contain aligned and filtered .h5 counts matrices as well as positional files as generated by 10x SpaceRanger.

  Dataset EGAD50000001876

• Raw sequencing data from low-input chromosome conformation capture in CD4+ T cells

  This dataset contains raw sequencing data from low-input PCHi-C in human primary CD4+ T cells isolated from healthy donors. The data are released as paired-end Illumina FASTQ files. Promoter Capture Hi-C used DpnII digestion and Tn5-based low-input library preparation, followed by targeted capture with custom-designed biotinylated RNA probes targeting most of the annotated gene promoters.

  Dataset EGAD50000001873

• Whole exome sequence of human XXY fibroblasts

  This dataset contains Whole exome sequence generated using human skin fibroblast sample (ID 419281) from Klinefelter XXY syndrome patient fibroblasts. These fibroblasts were used to generate autosomally isogenic human iPSCs. The sample DNA was collected using commercial kit and Human All Exon v5 capture paired library was sequenced using Illumina HiSeq device. The fastq file (ID 493224) and analysis (ID 3209) bam files have been deposited.

  Dataset EGAD50000001362

• RNA-seq dataset of lung adenocarcinomas

  This dataset includes the RNA-seq data from a study entitled "Tracing Oncogene Rearrangements in the Mutational History of Lung Adenocarcinoma". PolyA tails were captured by Oligo-dT beads, and sequencing run was made in HiSeq 2500 machines. Paired-end FASTQ files are provided in our dataset.

  Dataset EGAD00001004794

• cfMethyl-seq data (cfSort study) from serial plasma samples of NSCLC patients

  The cfMethyl-Seq libraries of the serial plasma cfDNA samples from the four NSCLC patients were constructed following the standard protocol. 10 ng of cfDNA in the volume of 25 µl was used as input material. 5’-end dephosphorylation was done with 3 µl 10xCutSmart buffer and 2 µl quick CIP from NEB (Ipswich, MA) at 37 oC for 30 min then heat-inactivated at 80 oC for 5 min. The 3’-end blocking was done with 0.5 µl 10xCutSmart buffer, 3 µl 2.5 mM CoCl2, 1 µl terminal transferase (all from NEB), and 0.5 µl 1 mM ddGTP at 37 oC for 2 h followed by 75 oC for 20 min. The mixture was then purified with 2x AmpureXP beads (Beckman Coulter, Indianapolis, IN) and eluted in 21.5 µl RT-PCR grade water (Thermo-Fisher, Waltham, MA). Restriction digestion was done with 2.5 µl 10xCutSmart buffer and 1 µl MspI (NEB) for 18 h at 37  oC and 20 min at 65 oC . 0.5 µl 10xCutSmart buffer, 0.3 µl dACGTP mixture (100 mM dATP, 10 mM dCTP, 10 mM dGTP), 1 µl Klenow (exo-, 5U/µl, NEB) and 2.6 µl RT-PCR water, 0.6 µl 50 mM DTT (ThermoFisher) was added to the mixture for end repair and A-overhang addition with the program 30  oC for 20 min, 37 oC for 1 h and 75 oC for 20 min. Adapter ligation was then performed with 1 µl 10xThermoFisher HC T4 ligase buffer, 0.4 µl 100 mM ATP (ThermoFisher), 0.2 µl 50 mM DTT, 1 µl ThermoFisher HC T4 DNA ligase (30 Weiss Unit/µl), 5 ng home-made duplex UMI adapter with all the cytosines methylated (protocol adopted from Kennedy et al.) at 16 oC for 20 h and 65 oC for 20 min. Bisulfite conversion of the adapter-ligated product was carried out with QIAGEN EpiTect plus DNA bisulfite kit following their protocol for two rounds of conversion. The converted product was purified with Qiagen MinElute spin column and eluted with 20 µl RT-PCR water. PCR amplification was done using the NEBNext Multiplex Oligos for Illumina (2.5 µl of universal and index primer each) and 25 µl KAPA HiFi HotStart Uracil+ ReadyMix (Roche) with the following cycling conditions: 98  oC for 45 s, 15 cycles of 98  oC for 15 s, 60  oC for 30 s and 72  oC for 30 s, followed by a final extension at 72  oC for 5 min. The PCR product was purified with 1x AmpureXP beads and eluted with 30 µl EB buffer. DNA concentration was measured by Qubit 1xdsDNA HS assay. 5% TBE-UREA PAGE and bioanalyzer assay was performed as quality control on each library before sequencing.

  Dataset EGAD00001010881

• Detection of low-frequency DNA variants by targeted sequencing of the Watson and Crick strands

  Identification and quantification of low-frequency mutations remain challenging despite improvements in the baseline error rate of next-generation sequencing technologies. Here, we describe a method, termed SaferSeqS, that addresses this challenge by (1) efficiently introducing identical molecular barcodes in the Watson and Crick strands of template molecules and (2) enriching target sequences with strand-specific PCR. The method achieves high sensitivity and specificity and detects variants at frequencies below 1 in 100,000 DNA template molecules with a background mutation rate of <5 × 10-7 mutants per base pair (bp). We demonstrate that it can evaluate mutations in a single amplicon or simultaneously in multiple amplicons, assess limited quantities of cell-free DNA with high recovery of both strands and reduce the error rate of existing PCR-based molecular barcoding approaches by >100-fold.

  Study EGAS00001005048

• Transcriptional and Epigenetic Profiles of Male Breast Cancer at Single-Cell Resolution Nominate Salient Cancer Specific Enhancers

  We performed matched single-cell RNA sequencing (scRNA-seq) and single-cell chromatin accessibility sequencing (scATAC-seq) for two fresh human tumors collected from male breast cancer patients. The integration of these datasets revealed the intratumoral heterogeneity in both transcription and chromatin accessibility for each male breast cancer patient and allowed for comparisons to be made between male and female breast cancer. We hope these data will be a useful reference in the field of breast oncology, specifically for the treatment of males, as few studies have explored male breast cancer genetics.

  Study phs003006

• PETAL Network: Outcomes Related to COVID-19 Treated With Hydroxychloroquine Among Inpatients With Symptomatic Disease (ORCHID) Trial

  ORCHID was a multicenter, blinded, placebo-controlled randomized trial conducted at 34 hospitals in the US between April 2 and June 19, 2020. Adults hospitalized with respiratory symptoms from severe acute respiratory syndrome coronavirus 2 infection were enrolled, with the last outcome assessment on July 17, 2020. The planned sample size was 510 patients with five interim analyses; however, the trial was stopped at the fourth interim analysis for futility with a sample size of 479 patients.The distribution of the day 14 clinical status score (measured using a 7-category ordinal scale) was not significantly different for patients randomized to receive hydroxychloroquine compared with placebo.Instructions for requesting individual-level data are available on BioData Catalyst at https://biodatacatalyst.nhlbi.nih.gov/resources/data/. Apply for data access in dbGaP. Upon approval, users may begin accessing requested data in BioData Catalyst. For questions about availability, you may contact the BioData Catalyst team at https://biodatacatalyst.nhlbi.nih.gov/contact.

  Study phs002299

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Dataset with WGBS data of CRC and colon tissue

  This dataset contains WGBS data from 20 samples, which are either from colorectal cancer or control colon tissue. Sequencing was performed on either Illumina HiSeq 2000 or HiSeq X and the sequences are paired.

  Dataset EGAD50000000772

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Exome Sequencing of 44 subjects with very severe or fatal COVID-19

  In this study, the DNA of 44 subjects with severe COVID-19 have been sequenced in order to explore rare genetic variants.

  Dataset EGAD00001008993

• Phenotypic characterisation of LRRN4CL over-expression

  This study aims to use RNAseq to identify differentially expressed transcripts in human melanoma cells that over-express the cell surface protein, LRRN4CL, relative to empty-vector control cells, to provide mechanistic insight into how LRRN4CL over-expression confers enhanced pulmonary metastatic colonisation abilities.

  Dataset EGAD00001006249

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Single-cell transcriptional mapping reveals genetic and hierarchy-based determinants of aberrant differentiation in AML

  Therapeutic targeting of acute myeloid leukemia (AML) has in part been hampered by profound cell state heterogeneity among leukemia cells. To develop a more precise understanding of leukemia cell states in AML, we constructed a reference atlas of human hematopoiesis from 263,519 single cell transcriptomes spanning 55 cellular states. Using this atlas, we mapped over 1.2 million single-cell transcriptomes spanning 318 myeloid leukemia samples. This uncovered twelve recurrent patterns of aberrant differentiation in AML and additional leukemia cell states involving lymphoid and erythroid progenitors. Systematic mapping of genotype-to-phenotype associations revealed specific differentiation landscapes associated with >45 genetic drivers. Importantly, AML samples sharing common genetic driver alterations can have distinct cellular origins which inform the cellular identity of their disease-sustaining leukemia stem cell (LSC). Further, distinct LSC-driven hierarchies can co-exist within individual patients. Thus, precise mapping of malignant cell states provides insights into leukemogenesis, refines disease classification, and informs therapy development.

  Study EGAS50000000918

• Gene expression adaptation of metastases to their host tissue

  The adaptation of metastatic cells to their host tissue critically determines the pathogenicity of a cancer and therefore patient survival. Yet, it remains elusive to what extent the host environment drives gene expression programs in metastatic cells. Here we identify adaptive mechanisms that enable metastases to establish themselves in a novel tissue context. We performed single-cell RNA-sequencing on malignant and benign tissue samples from untreated donors with colorectal adenocarcinoma and liver metastasis to deduce tissue adaptive expression patterns. A novel computational approach identified genes and pathways that consistently adapted to the host tissue at the transition from the primary tumor to the paired metastasis across donors. This analysis revealed that the majority of expression changes in the metastasis reflect an expression signature reminiscent of benign liver epithelial cells. Cellular processes adapting to the liver environment include basic cellular functions such as energy metabolism, as well as tissue-specific pathways such as the regulation of lipid metabolism by PPAR-α. These adaptations potentially increase the pathogenicity of the metastatic cells and may provide new therapeutic strategies.

  Study EGAS50000000817

• Genome-wide quantification of rare somatic mutations in normal human tissues using massively parallel sequencing

  We present Bottleneck Sequencing System (BotSeqS), a nextgeneration sequencing method that simultaneously quantifies rare somatic point mutations across the mitochondrial and nuclear genomes. BotSeqS combines molecular barcoding with a simple dilution step immediately prior to library amplification. We use BotSeqS to show age and tissue-dependent accumulations of rare mutations and demonstrate that somatic mutational burden in normal tissues can vary by several orders of magnitude, depending on biologic and environmental factors. We further show major differences between the mutational patterns of the mitochondrial and nuclear genomes in normal tissues. Lastly, the mutation spectra of normal tissues were different from each other, but similar to those of the cancers that arose in them. This technology can provide insights into the number and nature of genetic alterations in normal tissues and can be used to address a variety of fundamental questions about the genomes of diseased tissues.

  Study EGAS00001001838

• iCope fastq files

  The data set contains the fastq files of the single cell RNAseq study associated with the iCope manuscript. There are fastq files for gene expression and for tcr enrichment for each sample.

  Dataset EGAD50000001645

• Predictive value of chromosome 18q11.2-q12.1 loss for benefit from bevacizumab in metastatic colorectal cancer; a post-hoc analysis of the randomized controlled trial AGITG-MAX

  Patients and methods: We analyzed tumor samples of 256 patients enrolled in the AGITG-MAX 3-arm randomized controlled trial (RCT) who were randomly assigned to receive either capecitabine, or capecitabine and bevacizumab with- or without mitomycin. Chromosome 18q11.2-q12.1 copy number status was measured and correlated with PFS according to a predefined analysis plan with marker-treatment interaction as the primary end-point.Results: Chromosome 18q11.2-q12.1 losses were detected in 71% of patients (181/256) characteristic for mCRC. Consistent with the non-randomized study, significant PFS benefit of bevacizumab was observed in chromosome 18q11.2-q12.1 loss patients (P=0.009), and not in 18q no-loss patients (P=0.67). Although significance for marker-treatment interaction was not reached (Pinteraction = 0.28), hazard ratio and 95% confidence interval (HRinteraction 0.72, CI 0.39 - 1.32) show striking overlap with the non-randomized study cohorts (HRinteraction 0.41, CI 0.32 - 0.8) supported by a non-significant Cochrane chi-squared (P=0.11) for heterogeneity. Conclusions: PFS characteristics for marker positive- and negative patients randomized for treatment with- or without bevacizumab were consistent with those of the non-randomized discovery study, though the number of AGITG-MAX samples fell short to reach significance for marker-treatment interaction. Post-hoc analysis of the AGITG-MAX RCT provides supportive evidence for chromosome 18q11.2-q12.1 as a clinically relevant predictive marker for mCRC patients.

  Study EGAS00001005453

• Molecular profiling of tissue autopsies and ctDNA

  The dataset contains high-throughput sequencing data derived from a cancer autopsy series of 10 patients. As part of this study, whole-exome sequencing and RNA-seq were performed for spatially distinct tissue biopsies from the patients. In addition, plasma samples from the patients were sequenced using a custom panelt to profile ctDNA. There are 106 files containing whole-exome sequencing data, 107 files containing RNA-seq data, and 9 files containing plasma sequencing data.

  Dataset EGAD00001007040

• Peter Van Loo MPNST phase 1

  We comprehensively profile a primary malignant peripheral nerve sheath tumour (MPNST) and its recurrence with a multi-omic and spatial approach at single-cell resolution. Leveraging the extensive heterogeneity in copy number aberrations (CNAs) as a native barcoding system, we fully resolve the evolutionary tree of this tumour revealing multi-furcations suggestive of ongoing chromosomal instability. We show gene dosage effects contribute to phenotypic diversity and are predominantly linear. Using laser capture microdissection, we performed spatial lineage tracing in a human tumour, elucidating the relationship between local expansions and interactions between tumour cells and the microenvironment.

  Dac EGAC50000000904

• Mate pair whole genome sequencing of 98 AML samples

  This dataset contains bam-files from Mate-pair whole genome sequencing of 98 AML samples. DNA was extracted from either bone marow or peripheral blood from primary AML samples. The libraries were prepared using Illumina Nextera mate pair library preparation kit, generating long-insert (2-8 kb) paired end libraries. These were sequenced on an Illumina NextSeq 500 using 2x76bp paired end chemistry. The fastq files generated by sequencing were aligned to the human hg19 reference genome (ucsc.hg19.fasta from the GATK resource bundle) using bwa (0.7.15-r1140) and duplicate reads were identified using samblaster (0.1.24).

  Dataset EGAD50000001574

• Analysis of Cell-Free DNA to Predict Outcome to Bevacizumab Combination Therapy in Metastatic Colorectal Cancer Patients

  This dataset includes FASTQ files of low coverage whole genome sequencing of normal tissue (n = 8), tumor tissue (n = 55) and cell free DNA from plasma samples (n=101) from patients with metastatic colorectal cancer treated with bevacizumab. A total of 164 samples are present from two different cohorts. The first batch of samples (n = 139, sample names sAPD302T until sAPD502_P0) were collected from the AC-Angiopredict Phase 2 trial (NCT01822444), the second batch of samples (n = 25m, sample names sAPD503_P0 until sAPD527_P0) were collected from the UMM cohort.

  Dataset EGAD50000000176

• Single-cell RNA and DNA sequencing data obtained after genome-and-transcriptome separation.

  This dataset contains single-cell RNA and DNA sequencing data (fastq, n=928) obtained after genome-and-transcriptome separation. The RNA-seq data was obtained by Smart-seq2 amplification and Nextera XT library preparation. The DNA-seq data was obtained either by Gtag library preparation and amplification or by PicoPlex whole-genome amplification followed by Nextera XT library preparation. The single cells originate from a human PDX melanoma model and from HCC38 and HCC38 BL cell lines. The sequencing libraries were sequenced with Illumina instruments.

  Dataset EGAD00001010096

• DNA-Sequencing of Baseline Plasma From the Phase III Alliance A031201 Trial

  Liquid biopsy assays tailored for metastatic castration-resistant prostate cancer (mCRPC) patients are needed to identify molecular alterations and predict survival in the context of androgen receptor (AR) inhibitors. We developed a novel plasma cell-free DNA (cfDNA) sequencing assay to detect circulating tumor DNA (ctDNA) and alterations in key mCRPC driver genes, and tested associations with clinical features and survival outcomes in a phase III trial. cfDNA was isolated from evaluable baseline plasma specimens of untreated mCRPC patients (n=790) enrolled in the Alliance A031201 randomized phase III trial (NCT01949337) prior to enzalutamide therapy with or without abiraterone acetate and prednisone. A customized targeted cfDNA sequencing assay was used to detect AR and non-AR alterations in mCRPC. For this, DNA-seq libraries were constructed from cfDNA using Takara ThruPLEX Tag-Seq or Plasma-Seq kits, and subjected to hybridization enrichment using a custom-designed Agilent SureSelect bait panel. Post-capture DNA-seq libraries were pooled and sequenced on an Illumina HiSeq 2500 using 2x150 bp settings. ctDNA positivity was defined as >20% ctDNA using an aneuploidy-based estimate derived from ichorCNA (Group 1) or a novel definition of ≤20% ctDNA, but with detection of any alteration in AR, or gain of MYC and/or MYCN (Group 2). cfDNA sequencing data was obtained from 776 patients. There were 480/776 (62%) ctDNA-positive patients, with 324 (42%) in Group 1 and an additional 156 (20%) in Group 2 with AR or MYC/MYCN alterations detected. ctDNA-positive patients in Groups 1 and 2 had similarly poor median overall survival (OS) of 25.4 months (95% CI: 21.8-29.0) and 29.7 months (95% CI: 27.3-35.5), respectively, as compared to ctDNA-negative patients who had a median OS of 49.1 months (95% CI: 42.3-53.5). Relative to ctDNA-negative patients, OS was inferior in ctDNA-positive patients in Group 1 (HR 2.3, 95% CI: 1.9-2.9, P AR inhibitors in a contemporary phase III trial.

  Study phs003325

• Immune Cell Atlas of Environmental and Ancestral Diversity in Indonesia [scRNAseq]

  This dataset contains single-cell RNA, individually reference-aligned data from 203 individuals representing four Indonesian populations: the general urban population of Denpasar and the traditional community of Pedawa Village in Bali, as well as the traditional community of Yoboi Village (in Lake Sentani) and Sereh Village (individuals from highland Papua residing near Lake Sentani) in Papua. The dataset was produced as part of the Immune Cell Atlas of Environmental and Ancestral Diversity in Indonesia, a study aimed at characterizing how genetic background and environmental context shape immune cell states across diverse Indonesian communities.

  Dataset EGAD50000002385

• Immune Cell Atlas of Environmental and Ancestral Diversity in Indonesia [TCR]

  This dataset contains single-cell TCR, individually reference-aligned data from 203 individuals representing four Indonesian populations: the general urban population of Denpasar and the traditional community of Pedawa Village in Bali, as well as the traditional community of Yoboi Village (in Lake Sentani) and Sereh Village (individuals from highland Papua residing near Lake Sentani) in Papua. The dataset was produced as part of the Immune Cell Atlas of Environmental and Ancestral Diversity in Indonesia, a study aimed at characterizing how genetic background and environmental context shape immune cell states across diverse Indonesian communities.

  Dataset EGAD50000002383

• Whole exome sequencing data from 120 AML samples

  This dataset contains bam-files from whole exome sequencing of 120 paired tumor-normal pairs from AML. Tumor DNA was extracted from either bone marow or peripheral blood from primary AML samples. Normal DNA was extracted from cultured skin fibroblast samples. The libraries were prepared using the Nextera rapid capture exome kit and sequenced on an Illumina NextSeq 500 using 2x151bp paired end chemistry. The fastq files generated by sequencing were aligned to the human hg19 reference genome (ucsc.hg19.fasta from the GATK resource bundle) using bwa (0.7.9a-r786 or 0.7.15-r1140) and duplicate reads were identified using samblaster (0.1.24).

  Dataset EGAD50000001575

• Lactobacillus rhamnosus GG ATCC (LGG) as an immune adjuvant for influenza vaccination in the elderly

  Double blind Randomized Controlled trial to evaluate the safety of Lactobacillus rhamnosus GG ATCC 53103 (LGG) vs placebo in elderly receiving Trivalent Inactivated Influenza Vaccine (TIV) (study 1) or Double blind Randomized Controlled trial to evaluate the safety of Lactobacillus rhamnosus GG ATCC 53103 (LGG) vs. placebo in elderly subjects receiving Live Attenuated Influenza vaccine (LAIV) (study 2). Healthy elderly volunteers, ages 65-80 were enrolled as outpatients in two clinical studies in which they received the TIV vaccine (study 1, n=28) or the LAIV vaccine (study 2, n=30). In each of the 2 studies, subjects were randomized to receive either LGG capsules containing 1 x 1010 CFU, twice daily for 28 days, or matching placebo capsules twice daily for the same period of time. The study subjects completed a daily diary, telephone calls, and study visits at the Massachusetts General Hospital Clinical Research Centers at baseline, days 21, 28 and 56 and month 5 for the TIV study and baseline, days 21, 28, and 56 for the LAIV study. During each visit, the subject diary, interim history, potential adverse effects and concomitant medications were reviewed and vital signs and a physical examination were performed. Routine blood tests were obtained to monitor for safety during visits and nasopharyngeal and stool samples were collected for microbiome analysis. Volunteers in both studies who were interested in participating in the effect of LGG probiotic on the Human whole Blood Transcriptome substudy also had blood drawn for DNA and RNA extraction, after signing the substudy consent form. The main objectives of the TIV and LAIV studies were to assess the safety and tolerability of 2 x 1010 CFU LGG administered orally to elderly subjects for 28 days after administration of TIV (study 1) or LAIV (study 2). Secondary objectives were to evaluate the richness and microbial diversity in nasopharyngeal and stool specimens using pyrosequencing, and to compare cytokine production in response to bacterial stimulation by following the kinetics of mRNA expression of pro and anti-inflammatory genes and different signaling pathways, in relation to changes in stool Bifidobacterium and Lactobacillus spp. The studies were reviewed and approved by the Partners Human Research Committee (TIV study IRB # 2010p001694 and LAIV study IRB # 2011p002849) and were registered at ClinicalTrials.gov (NCT01368029 and NCT01545349, respectively).

  Study phs000981

• Oncogenic chimeric transcription factors drive tumor-specific transcription, processing, and translation of silent genomic regions

  Many cancers are characterized by gene fusions encoding oncogenic chimeric transcription factors (TFs) such as EWS::FLI1 in Ewing sarcoma (EwS). Here, we find that EWS::FLI1 induces the robust expression of a specific set of novel spliced and polyadenylated transcripts within otherwise transcriptionally silent regions of the genome. These neogenes (NGs) are virtually undetectable in large collections of normal tissues or non-EwS tumors and can be silenced by CRISPR interference at regulatory EWS::FLI1-bound microsatellites. Ribosome profiling and proteomics further show that some NGs are translated into highly EwS-specific peptides. More generally, we show that hundreds of NGs can be detected in diverse cancers characterized by chimeric TFs. Altogether, this study identifies the transcription, processing, and translation of novel, specific, highly expressed multi-exonic transcripts from otherwise silent regions of the genome as a new activity of aberrant TFs in cancer.

  Study EGAS00001006293

• Japanese Alzheimer's disease neuroimaging initiative

  Japanese ADNI aims to establish imaging and biofluid markers that can predict and monitor the progression of changes in the brains of elderly individuals with AD, mild cognitive impairment (MCI) or normal cognition, and eventually be used as a surrogate markers for the clinical trials of DMDs for AD.

  Study JGAS000051

• RNA-Seq on OCIAML-22 Fractions

  The donor AML patient (unsorted) that was used to generate OCI-AML22 was expanded for the indicated number of days (Donor: 0 day, 12d: 12 days, 2m: 2 months, 3m: 3 months), then sorted for the indicated fraction (CD34p: CD34+; CD34m: CD34-, CD38m: CD38-, CD38m: CD38-).

  Study EGAS00001006512

• DNA methylation (RRBS) data for the validation the glioblastoma progression study (GBMatch).

  Genome-wide profiling of DNA methylation levels by RRBS in 150 glioblastoma tumor samples. Patients were selected to represent the general population of glioblastoma patients based on Austrian Brain Tumor Registry. These DNA methylation profiles were created for the validation of the glioblastoma progression study (GBMatch) and consist of 106 profiles from FFPE samples and 44 profiles from fresh-frozen samples. For the 44 fresh-frozen samples also WGS data (43 genomes) and RNA-seq data (37 transcriptomes) have been produced for validation purposes.

  Dataset EGAD00001004074

• Digital tEchnology For Lung Cancer Treatment

  DEFLeCT metadata: 1) A table containing the mutational profile for all human genes across the cohort of the 81 PROMOLE lung cancer samples. 2) A table containing the expression levels for all human genes across the cohort of the 81 PROMOLE lung cancer samples. 3) A table containing the clinical, histology data and follow-ups of the cohort of 81 PROMOLE lung cancer patients.

  Dataset EGAD00001010838

• RNAseq of human intestinal epithelial cell layers cultured in OGM, ENR, and ENRRT

  This dataset contains RNA sequencing data in fastq and bam format from 24 samples of human jejunum organoids grown in 3D configuration or as 2D monolayers on anodisc imaging chambers (AICs) in medium formulations OGM, ENR, and ENRRT. The RNA sequencing samples were sequenced using paired-end sequencing (2x150 bp) on an Illumina NovaSeq 6000 instrument at the SciLifeLab National Genomics Infrastructure (NGI) in Uppsala.

  Dataset EGAD50000001766

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179