19462 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins This is the best service ever..VBsp"

in 53.06 milliseconds.

• The BNT162b2 mRNA COVID-19 vaccine induces long-term effects on both adaptive and innate immune responses

  This dataset contains bulk RNA sequencing at different timepoints post-BNT162b2 mRNA COVID-19 vaccination. Stimulation experiments were performed at each of the timepoints (RPMI, Influenza, R848 and Influenza stimuli), resulting in 242 libraries distributed over 4 stimulations and 4 timepoints. Libraries were sequenced on the DBNSEQ platform.

  Dataset EGAD00001011042

• CATHeterization GENetics (CATHGEN)

  The CATHGEN biorepository consists of biological samples collected on 9334 sequential consenting individuals undergoing cardiac catheterization at Duke University Medical Center between 2001 and 2010 inclusive. The Institutional Review Board informed consent allowed for 50 mL of blood to be collected from fasting patients through the femoral arterial sheath during the catheterization procedure. Three 7.5 mL EDTA tubes for DNA extraction are stored at -80°C. The Duke Database for Cardiovascular Disease (DDCD) provides the bulk of the clinical data used for analysis. Follow-up includes mortality information gleaned from the National Death Index and Social Security Death Index plus follow-up phone calls and written questionnaires regarding MI, stroke, re-hospitalization, coronary re-vascularization procedures, smoking, exercise, and medication use.

  Study phs000703

• Whole exome and transcriptome sequencing of BPDCN

  This data set contains whole exome and transcriptome data from 47 case with BPDCN. For exome data, bam files are provided (mapped against GRCh38), for transcriptome raw fastq-files (paired-end data).

  Dataset EGAD00001008692

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• single cell transcriptomics fastq files from PBMC of long COVID patients

  This dataset consists of 8 patients' data fastq files. 4 in each LR1 and 4 in LR2. the dataset was generated using 10X genomics and novaseqX.

  Dataset EGAD50000001730

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Archive growth Statistics

  EGA Statistics Bibliography Growth Community Archive Distribution Catalogue In this section, we expose the overall volume of data available to download and the different archived file types. EGA Archive growth in size and number of files The below figure represents the EGA archive growth in size (TB) and number of files. EGA Archive Growth per year lineChart('ega-archive-growth', 'https://stats.ega-archive.org/growth/archive', ['Volume (TB)'], ['T']) Archive files The below figure represents on a initial level, the percentage of archived files by data technology. The second level, acessible by clicking in the required extension, displays the number of files by extension archived in the ega archive. Please click over the extension to learn more about the files. EGA Archived Files barChart('ega-archived-files', 'https://stats.ega-archive.org/extensions', false ,'', true)

  Documentation about/statistics/archive

• Measuring the level of relatedness between NGS datasets

  Sequencing technologies are providing increasingly detailed insight in genetic makeup are paving their way into molecular diagnostics. The field will benefit from rigorous and bias-free measures for the quality of sequence data and for the proper representation of the complexity of the original samples. While current methodologies rely on the availability of a well-characterized reference genome, we propose kMer profiling for alignment-free assessment of the quality, comparability, and complexity of sequencing datasets. We show that kMer detects technical artefacts such as high duplication rates, library chimaeras, and differences in library preparation protocols in whole-genome, whole-exome, and RNA sequencing data. Additionally, it successfully captures the complexity and diversity of microbiomes. Thus, kMer allows for a robust evaluation of the quality and complexity of sequencing data without relying on any prior information and opens the way to a more reliable biological reasoning.

  Study EGAS00001000600

• Whole-exome sequencing data from breast cancer recurrence, endometrial cancer, and colon tumor samples harboring a rare germline BARD1 variant

  This dataset comprises whole-exome sequencing data from tumor and matched blood samples of a patient with breast cancer recurrence and endometrial cancer carrying a germline BARD1 p.(Gly753Val) variant, as well as from the colon tumor of the proband's father

  Dataset EGAD50000002412

• Indigenous American Genomic Diversity Project (IAGDP).

  Here we present the Indigenous American Genomic Diversity Project (IAGDP), comprising 128 newly generated high-coverage (NGS; ~44X) whole genomes from Indigenous individuals across eight Latin American countries, representing 45 populations and 28 language families. This dataset expands Indigenous representation in genomics, with emphasis on geographically and linguistically diverse populations, particularly from the South American lowlands.

  Dataset EGAD50000002396

• Whole-genome sequencing data of metastatic salivary gland cancer

  This dataset contains whole-genome sequencing data of three patients with metastatic salivary gland cancer who underwent autopsy to harvest tumor biopsies from spatially separated metastatic sites and biopsies from healthy skin as a control. Two patients had the subtype adenoid cystic carcinoma (patients 1 and 4) and one patient had the subtype myoepithelial carcinoma.

  Dataset EGAD50000002056

• Targeted DNA sequencing of TTFields-treated glioblastoma, IDH wildtype

  This dataset contains raw paired-end FASTQ files from targeted DNA sequencing using the TruSight Oncology 500 panel in patients with glioblastoma, IDH wildtype, treated with surgery, standard chemoradiotherapy and Tumor Treating Fields at Charité – Universitätsmedizin Berlin. Tumour samples were collected at first surgery and are linked to pseudonymised clinical and molecular annotations described in the associated EGA study.

  Dataset EGAD50000002117

• Whole exome sequencing data of matched pairs of primary tumour and normal frozen tissue of seven osteosarcoma patients

  This dataset contains whole exome sequencing data of matched pairs of primary tumour and normal frozen tissue of seven osteosarcoma patients. Whole exome sequencing with a minimum coverage of 100x was performed using the Illumina Novaseq6000 platform and the Agilent SureSelect Human All Exon V7 kit.

  Dataset EGAD50000002264

• Total RNA sequencing of fibroblasts from an control individual

  Total RNA sequencing of fibroblasts from an individual with 30-55x GCC repeats in the FMR1 5'UTR. Libraries were prepared with total RNA with Ribo-Zero ribosomal RNA depletion (illumina), and sequenced paired-end, 75bp on a NextSeq 550 system. This dataset contains three RNA-sequencing replicates from the same cell line.

  Dataset EGAD50000000922

• Disease recurrence after pathologic response

  In this study we aim to gain insight into the mechanisms of immune evasion after initial pathologic response to neoadjuvant immune checkpoint inhibition in macroscopic stage III melanoma by pooling data of the neoadjuvant OpACIN, OpACIN-neo and PRADO trials. Therefore we analyzed in-depth paired baseline and recurrent tumor samples through a.o. DNA sequencing analyses.

  Dataset EGAD50000000699

• Gene panel sequencing of paired samples from primary and relapsed IDH-wt glioblastomas

  This dataset contains gene panel sequencing data from 43 sample pairs of primary and relapsed IDH-wt glioblastomas. The gene panel covers 50 glioma-associated genes. 14 of the sequenced sample pairs were sequenced with whole genome sequencing also and are accessible under EGAD00001004563.

  Dataset EGAD00001004565

• LBC1936 VCF

  LBC1921 and LBC1936 GVCFs called with GATK's HaplotypeCaller were combined and subject to variant quality score recalibration. This VCF contains the subset of samples (n = 1068) from the LBC1936 cohort.

  Dataset EGAD00001005478

• He et al. RNA-seq data

  This dataset are the bam files of RNA-seq data from the paper by He et al.

  Dataset EGAD00001007135

• Metastatic Pediatric Sclerosing Epithelioid Fibrosarcoma

  This dataset contains different samples from a single patient with SEF. The dataset contains whole genome, whole exome and RNAseq information. Two of the DNA sequencing samples also contain matched normals.

  Dataset EGAD00001007516

• Metastatic Pediatric Sclerosing Epithelioid Fibrosarcoma

  This dataset contains different samples from a single patient with SEF. The dataset contains whole genome, whole exome and RNAseq information. Two of the DNA sequencing samples also contain matched normals.

  Dataset EGAD00001007515

• Post Mortem brain data used in paper "Significant and pervasive effects of RNA degradation on Nanopore direct RNA sequencing"

  This dataset contains data used in the paper titled "Significant and pervasive effects of RNA degradation on Nanopore direct RNA sequencing. The data consists of one post mortem sample that was sequenced with direct RNA sequencing form Oxford Nanopore Technologies on a promethION flow cell.

  Dataset EGAD00001009308

• Collaborative Cohort of Cohorts for COVID-19 Research (C4R): Atherosclerosis Risk in Communities Study (ARIC)

  Cohort Description The Atherosclerosis Risk in Communities (ARIC) study began in the mid-1980s with the initial aims being to describe the presence of subclinical atherosclerosis, the progression of atherosclerosis to clinical cardiovascular disease (CVD), and the association of novel risk factors with CVD. ARIC recruited its cohort of men and women aged 45-64 in 1987-89 from four communities (Forsyth County, NC; Jackson, MS; suburban Minneapolis, MN; and Washington County, MD). As of 2025, ARIC counts over 4,000 participants.Data Submitted Wave 1 questionnaire data includes 356 variables for up to 5763 ARIC participants in C4R. Wave 2 questionnaire data includes 367 variables for up to 5000 ARIC participants in C4R. Wave 3 questionnaire data includes 81 variables for up to 3450 participants in C4R.Dried Blood Spot/Serosurvey data includes 8 variables for up to 2437 ARIC participants in C4R. Derived data includes 62 variables for up to 18765 observations. Phenotype data includes 163 variables for up to 5937 ARIC participants in C4R. Brain MRI data includes 13 variables for up to 2550 participants in C4R.HCU data includes 21 variable for up to 631 ARIC participants in C4R.Lung CT data includes 15 variables for 1329 ARIC participants in C4R.Neurocognitive data includes 16 variables and 49826 observations.Serosurvey data includes 20 variables for 1707 ARIC participants in C4R.

  Study phs002988

• Leukemia Data Access committee for the deposited data. The committee consists of the principal investigators for the data set.

  Dac EGAC00001003565

• Next Generation Sequencing platform for targeted Personalized Therapy of Leukemia - Acute myeloid leukemia

  The advent of high-throughput next generation sequencing (NGS) technologies that are revolutionizing genomics and transcriptomics by providing a single base resolution tool for a unified deep analysis of diseases complexity allows a fast and cost-efficient fine-scale assessment of the genetic variability hidden within cohorts of patients affected by the same leukemia. That being so, by potentially highlighting inter-individual differences that may play a role in the differential success of diverse therapeutic interventions, they promise to be crucial for selecting the most appropriate medical treatments. The project aims at the identification of novel prognostic biomarkers for acute myeloid leukemia (AML) and studied the molecular differences between aneuploid and euploid AML.

  Study EGAS00001005464

• The characterization of gene expression pattern of anticancer agent-resistant cancer stem cells using RNA sequencing analysis.

  Slow cycling cancer stem cells persist and contribute to tumor regrowth after chemotherapy.To investigate this mechanism, we developed stemness- and cell cycle-visualized colon cancer organoids from patient tissues, and perfomed comparative transcriptome analysis using sorted rapid cycling stem cells (LGR5+p27-) and slow cycling stem cells (LGR5+p27+). In addition, we analyzed the changes in the gene expression patterns in the slow cycling stem cells and all of tumor cells after chemotherapy (camptothecin) treatment. Gene ontology analysis and gene set enrichment analysis using these transcriptome data revealed cell adhesion signal and YAP siganling pathway were important to maintain the dormancy and resume propagation after chemotherapy. In each experiments, total RNA was extracted from organoids and sequenced with HiSeq X Ten (Illumina).

  Study JGAS000350

• Integrative and comparative genomic analyses identify clinically relevant groups of pulmonary carcinoids and unveil the supra-carcinoids

  Multi-omic data for lung neuroendocrine neoplasms, including the first multi-omic sequencing data for the understudied lung atypical carcinoids. The data includes Whole-exomes, whole-genomes, RNA-seq, and EPIC 850K methylation array data.

  Study EGAS00001003699

• Understanding human fetal pancreas development using subpopulation sorting and RNA sequencing

  To decipher the populations of cells present in the human fetal pancreas and their lineage relationships, we developed strategies to isolate pancreatic progenitors, endocrine progenitors and endocrine cells. Transcriptome analysis of the individual populationsrevealed a large degree of conservation among vertebrates in the drivers of gene expression changes occurring at different steps of differentiation, althoughnotably, sometimes, different members of the same gene family are expressed. The transcriptome analysis establishes a resource to identify novel genes and pathways involved in human pancreas development. Single cell profiling further captured intermediate stages ofdifferentiation and enabled us to decipher the sequence of transcriptional events occurring during human endocrine differentiation. Furthermore, we evaluate how well individual pancreatic cells derived in vitro from human pluripotent stem cells mirror the natural processoccurring in human fetuses. This comparison uncovers a few differences at the progenitor steps, a convergence at the steps of endocrine induction and the current inability to fully resolve endocrine cell subtypes in vitro.

  Study EGAS00001003127

• Metatranscriptomic Sequencing of Pulmonary Fluid in Immunocompromised Children

  Despite improved diagnostics, pulmonary pathogens in immunocompromised children frequently evade detection, leading to significant mortality. In version 1.0 of this study, we performed RNA-based next generation sequencing (mNGS) on 41 lower respiratory samples collected from 34 children. We identified a rich cross-domain pulmonary microbiome containing bacteria, fungi, RNA viruses, and DNA viruses in each patient. Potentially pathogenic bacteria were ubiquitous among samples but could be distinguished as possible causes of disease by parsing for outlier organisms. Potential pathogens were detected in half of samples previously negative by clinical diagnostics. In version 2.0, we included an addition 278 samples from 229 pediatric stem cell transplant patients with pulmonary disease.

  Study phs001684

• RNA-Seq for SF3B1 splicing signature

  This dataset includes exome-captured RNA-Seq made with exome v8 (Agilent) - library preparation on a MAGNIS XT-HS2 starting from 100ng of RNA. RNA has been extracted from lymphocytes cultures from 2 probands with SF3B1 mutations and 14 controls. All 16 RNA-Seq were sequenced on a single HighOutput flowcell 2x75bp (NextSeq550). Raw fastq files have between 20 and 30M paired-reads.

  Dataset EGAD50000002121

• DNA methylation changes associated with hyperglycemia in type 1 diabetes

  This dataset includes DNA methylation profiles from 112 young with Type 1 Diabetes (T1D) at T1D diagnosis, who were longitudinally monitored for hyperglycemia over an average duration of 3 years. These datasets were generated using whole-genome bisulfite sequencing. It includes 1872 fastq files (i.e. 936 paired-end fastq files) generated through 150 bp paired-end sequencing on Illumina HiSeqX.

  Dataset EGAD50000000545

• WES and RNAseq dataset

  This dataset includes WES and RNAseq for 7 patients with metastatic melanoma (4), non-small cell lung adenocarcnioma (1), cervix adenocarcinoma (1), and Epidermoid nasophaeyngeal carcinoma (1), enrolled in phase I clinical trials (NCT03475134m NCT04643574 and NCT05195619). WES was performed on matched cancer and healthy tissues, whereas RNAseq was performed on cancer tissues, using Illumina HiSeq 4000/6000 and Illumina NextSeq 500/550 systems.

  Dataset EGAD50000000337

• Transcriptome sequencing of myelodysplasia

  Transcriptome sequencing was performed on 214 patients with myelodysplasia in this study. RNA was obtained from bone marrow CD34+ cells (n=100) and/or bone marrow mononuclear cells (n=165). Transcriptome sequencing was performed for both cell fractions in 51 patients. A total of 211 patients were genotyped by targeted deep sequencing. We also studied bone marrow CD34+ cells and bone marrow mononuclear cells obtained from three healthy adults each.

  Dataset EGAD00001003891

• RNAseq of neuroblastoma PDX and cell lines

  This dataset contains 72 RNAseq (BAM and Fastq files are available for each sample).

  Dataset EGAD00001006558

• OCCAMS_Oesophageal Cancer Organoids_1

  ***THIS DATA CAN ONLY BE USED FOR NON-COMMERCIAL CANCER RESEARCH*** Sequencing of organoid cell lines derived from oesophageal tumour sections taken from patients diagnosed with primary oesophageal cancer who underwent tumour resection surgery.

  Dataset EGAD00001001889

• ATAC-Seq on OCIAML-22 Fractions

  The donor AML patient (unsorted) that was used to generate OCI-AML22 was expanded for 3-4 months, then sorted for the indicated fraction (CD34p: CD34+; CD34m: CD34-)

  Study EGAS00001006511

• The dataset for "Validation of cfDNA fragmentome analyses for early detection of liver cancer"

  The dataset for “Validation of cfDNA fragmentome analyses for early detection of liver cancer” includes 380 cram files from whole genome next-generation sequencing on the Illumina NovaSeq 6000 with 10x coverage. The samples analyzed include plasma samples from patients with cancer and liver disease.

  Dataset EGAD00001015538

• Genotype variables of the 61 COVID-19 patient cohort used in the main project of data integration

  We selected SNPs with a minor allele frequency (MAF) higher than 10% in the Caucasian population from the Ensembl database. Specifically, we selected ACE2 (rs2285666), MX1 (rs469390), and TMPRSS2 (rs2070788) for the present analysis. For more information, please refer to:

  Study EGAS50000000589

• Childhood Cancer Data Initiative (CCDI): Texas Pediatric Patient Derived Xenograft 

  The DNA/RNA samples of patients for which PDX models were developed were from a population of children, adolescents, and young adults from South Texas. Consent was obtained for collection of malignant and non-malignant tissue samples for genetic analysis and for the development of models to study new ways to treat cancer. For additional details, please refer to these publications: PMID: 37915590; PMID: 37990009.

  Study phs003215

• DAC: LUMC NeuroD AON off target analysis

  In this study, we used three different splice-switching AONs targeting three different human transcripts to study their transcriptome-wide, hybridization-dependent off-target effects with short read RNAseq. Using the computational tools rMATS and Whippet, in control human induced pluripotent stem cells

  Dac EGAC50000000726

• Whole genome sequence of Primary-recurrent HCC study

  This dataset contains whole genome sequence data from 24 samples, including 16 tumors and 8 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005451

• BIOCLOCK Phenotype Information Dataset

  This dataset contains phenotypic metadata from participants in the BIOCLOCK endurance exercise intervention and epigenetic aging study. It includes intervention status, cardiorespiratory fitness (VO2 max), body composition, estimated leukocyte proportions, and other relevant traits linked to epigenetic aging outcomes.

  Dataset EGAD00001015799

• cfMethyl-seq data (cfSort study) from serial plasma samples of NSCLC patients

  The cfMethyl-Seq libraries of the serial plasma cfDNA samples from the four NSCLC patients were constructed following the standard protocol. 10 ng of cfDNA in the volume of 25 µl was used as input material. 5’-end dephosphorylation was done with 3 µl 10xCutSmart buffer and 2 µl quick CIP from NEB (Ipswich, MA) at 37 oC for 30 min then heat-inactivated at 80 oC for 5 min. The 3’-end blocking was done with 0.5 µl 10xCutSmart buffer, 3 µl 2.5 mM CoCl2, 1 µl terminal transferase (all from NEB), and 0.5 µl 1 mM ddGTP at 37 oC for 2 h followed by 75 oC for 20 min. The mixture was then purified with 2x AmpureXP beads (Beckman Coulter, Indianapolis, IN) and eluted in 21.5 µl RT-PCR grade water (Thermo-Fisher, Waltham, MA). Restriction digestion was done with 2.5 µl 10xCutSmart buffer and 1 µl MspI (NEB) for 18 h at 37  oC and 20 min at 65 oC . 0.5 µl 10xCutSmart buffer, 0.3 µl dACGTP mixture (100 mM dATP, 10 mM dCTP, 10 mM dGTP), 1 µl Klenow (exo-, 5U/µl, NEB) and 2.6 µl RT-PCR water, 0.6 µl 50 mM DTT (ThermoFisher) was added to the mixture for end repair and A-overhang addition with the program 30  oC for 20 min, 37 oC for 1 h and 75 oC for 20 min. Adapter ligation was then performed with 1 µl 10xThermoFisher HC T4 ligase buffer, 0.4 µl 100 mM ATP (ThermoFisher), 0.2 µl 50 mM DTT, 1 µl ThermoFisher HC T4 DNA ligase (30 Weiss Unit/µl), 5 ng home-made duplex UMI adapter with all the cytosines methylated (protocol adopted from Kennedy et al.) at 16 oC for 20 h and 65 oC for 20 min. Bisulfite conversion of the adapter-ligated product was carried out with QIAGEN EpiTect plus DNA bisulfite kit following their protocol for two rounds of conversion. The converted product was purified with Qiagen MinElute spin column and eluted with 20 µl RT-PCR water. PCR amplification was done using the NEBNext Multiplex Oligos for Illumina (2.5 µl of universal and index primer each) and 25 µl KAPA HiFi HotStart Uracil+ ReadyMix (Roche) with the following cycling conditions: 98  oC for 45 s, 15 cycles of 98  oC for 15 s, 60  oC for 30 s and 72  oC for 30 s, followed by a final extension at 72  oC for 5 min. The PCR product was purified with 1x AmpureXP beads and eluted with 30 µl EB buffer. DNA concentration was measured by Qubit 1xdsDNA HS assay. 5% TBE-UREA PAGE and bioanalyzer assay was performed as quality control on each library before sequencing.

  Dataset EGAD00001010881

• Project for Development of Innovative Research on Cancer Therapeutics; Identifiying the predictive factors for response to chemoherapy in ovarian cancer

  To identify novel predictive biomarkers of response to chemotherapy for clear cell carcinoma of the ovary

  Study JGAS000076

• Transcriptional and Epigenetic Profiles of Male Breast Cancer at Single-Cell Resolution Nominate Salient Cancer Specific Enhancers

  We performed matched single-cell RNA sequencing (scRNA-seq) and single-cell chromatin accessibility sequencing (scATAC-seq) for two fresh human tumors collected from male breast cancer patients. The integration of these datasets revealed the intratumoral heterogeneity in both transcription and chromatin accessibility for each male breast cancer patient and allowed for comparisons to be made between male and female breast cancer. We hope these data will be a useful reference in the field of breast oncology, specifically for the treatment of males, as few studies have explored male breast cancer genetics.

  Study phs003006

• DNA-Sequencing of Baseline Plasma From the Phase III Alliance A031201 Trial

  Liquid biopsy assays tailored for metastatic castration-resistant prostate cancer (mCRPC) patients are needed to identify molecular alterations and predict survival in the context of androgen receptor (AR) inhibitors. We developed a novel plasma cell-free DNA (cfDNA) sequencing assay to detect circulating tumor DNA (ctDNA) and alterations in key mCRPC driver genes, and tested associations with clinical features and survival outcomes in a phase III trial. cfDNA was isolated from evaluable baseline plasma specimens of untreated mCRPC patients (n=790) enrolled in the Alliance A031201 randomized phase III trial (NCT01949337) prior to enzalutamide therapy with or without abiraterone acetate and prednisone. A customized targeted cfDNA sequencing assay was used to detect AR and non-AR alterations in mCRPC. For this, DNA-seq libraries were constructed from cfDNA using Takara ThruPLEX Tag-Seq or Plasma-Seq kits, and subjected to hybridization enrichment using a custom-designed Agilent SureSelect bait panel. Post-capture DNA-seq libraries were pooled and sequenced on an Illumina HiSeq 2500 using 2x150 bp settings. ctDNA positivity was defined as >20% ctDNA using an aneuploidy-based estimate derived from ichorCNA (Group 1) or a novel definition of ≤20% ctDNA, but with detection of any alteration in AR, or gain of MYC and/or MYCN (Group 2). cfDNA sequencing data was obtained from 776 patients. There were 480/776 (62%) ctDNA-positive patients, with 324 (42%) in Group 1 and an additional 156 (20%) in Group 2 with AR or MYC/MYCN alterations detected. ctDNA-positive patients in Groups 1 and 2 had similarly poor median overall survival (OS) of 25.4 months (95% CI: 21.8-29.0) and 29.7 months (95% CI: 27.3-35.5), respectively, as compared to ctDNA-negative patients who had a median OS of 49.1 months (95% CI: 42.3-53.5). Relative to ctDNA-negative patients, OS was inferior in ctDNA-positive patients in Group 1 (HR 2.3, 95% CI: 1.9-2.9, P AR inhibitors in a contemporary phase III trial.

  Study phs003325

• PETAL Network: Outcomes Related to COVID-19 Treated With Hydroxychloroquine Among Inpatients With Symptomatic Disease (ORCHID) Trial

  ORCHID was a multicenter, blinded, placebo-controlled randomized trial conducted at 34 hospitals in the US between April 2 and June 19, 2020. Adults hospitalized with respiratory symptoms from severe acute respiratory syndrome coronavirus 2 infection were enrolled, with the last outcome assessment on July 17, 2020. The planned sample size was 510 patients with five interim analyses; however, the trial was stopped at the fourth interim analysis for futility with a sample size of 479 patients.The distribution of the day 14 clinical status score (measured using a 7-category ordinal scale) was not significantly different for patients randomized to receive hydroxychloroquine compared with placebo.Instructions for requesting individual-level data are available on BioData Catalyst at https://biodatacatalyst.nhlbi.nih.gov/resources/data/. Apply for data access in dbGaP. Upon approval, users may begin accessing requested data in BioData Catalyst. For questions about availability, you may contact the BioData Catalyst team at https://biodatacatalyst.nhlbi.nih.gov/contact.

  Study phs002299

• BAM files of Dorado base-called Oxford Nanopore whole-genome sequencing data from sporadic PD cases and non-PD controls

  This dataset contains whole genome sequencing data from 16 colon tissue samples, including 5 Parkinson’s disease (PD) cases and 11 non-PD controls. Sequencing was performed on the Oxford Nanopore PromethION platform using R10.4.1 flow cells. Raw pod5 files were processed with the public NanoWGS pipeline (https://github.com/AlexanRNA/nanowgs), which includes base calling using ONT Dorado v0.3.2 with modified bases detected using the --modified-bases 5mCG_5hmCG option. The processed data are provided as one BAM file per sample.

  Dataset EGAD50000002424

• RNAseq data from 112 samples of benign or malignant ovarian tumours

  This dataset contains ~1.2 TB RNA sequencing data in fastq format from 112 samples of fresh-frozen ovarian tumours from a total of 111 women, two samples being replicates. The samples were collected from the U-CAN collection at Uppsala Biobank and include both benign (n = 18) and malignant (n = 94) tumours. The RNA sequencing samples were sequenced using paired-end sequencing (2x150 bp) on an Illumina NovaSeq 6000 instrument at the SciLifeLab National Genomics Infrastructure (NGI) in Uppsala.

  Dataset EGAD50000001521

• Phase II Trial with Correlative Genomic Analysis of Durvalumab plus Pazopanib Combination in Patients with Advanced Soft Tissue Sarcomas

  This study includes an open-label, phase 2 study to determine the activity of the anti-VEGF receptor tyrosine-kinase inhibitor, pazopanib, combined with the anti-PD-L1 immune checkpoint inhibitor, durvalumab, in unselected advanced sarcomas. We conducted whole exome and transcriptomic sequencing with pre-treatment tissue biopsy to correlate clinical outcomes with molecular and genomic biomarkers to identify patients who would most likely benefit from the combination treatment.

  Dataset EGAD50000000114

• RNA-Seq data from tumor samples collected from 12 UTSW translocation renal cell carcinoma (tRCC) patients.

  This study investigates differentially expressed genes associated with the progression of translocation renal cell carcinoma (tRCC) by analyzing RNA-Seq data from 23 tumor samples obtained from 12 patients. The samples were collected from affiliated hospitals of the University of Texas Southwestern Medical Center (UTSW), including Parkland Hospital and Children’s Medical Center. RNA isolated from tumor samples was sequenced using the Illumina platform.

  Dataset EGAD50000000172

• Whole Mitochondrial DNA sequencing of Gingivo-buccal Cancer : ICGC-India Project

  This dataset pertains to mitochondrial DNA amplicon sequencing of paired DNA samples from gingivo-buccal oral cancer patients. DNA was isolated from the tumor and blood tissues of 89 patients (178 samples). The sequencing libraries were prepared from whole mitochondrial amplicons using Nextera XT DNA Library Preparation Kit (Illumina) and sequenced in Illumina HiSeq platform. The uploaded BAM files are generated by aligning paired-end reads to the mitochondrial reference sequence (rCRS) using BWA-MEM.

  Dataset EGAD00001004987

• SNP arrays for chemotherapy response project

  In this study, a total of 300 patients with MIBC receiving chemotherapy were included; 62 received NAC before cystectomy and 245 received first-line chemotherapy upon detection of locally-advanced (T4b) or metastatic disease. Treatment response, defined as pathological downstaging (< pTa,CIS,N0) after NAC or complete or partial response after first-line treatment (RECIST criteria). Illumina SNP arrays (760k markers) were performed using DNA from 49 tumors and associated germline DNA (49x median coverage). Data provided here consist of 98 files.

  Study EGAS00001004519

• Genetic Diseases of Immune Homeostasis and Autoimmunity Caused by GIMAP Deficiency

  We investigated 17 affected individuals in 9 kindreds with lymphopenia, splenomegaly, liver disease, thrombocytopenia, lymphadenopathy, severe recurrent lung infections, skin diseases, and lymphoma. Whole-exome sequencing of the cohort revealed mutations in GIMAP5. We also found another patient from one kindred with a unique mutation in the gene GIMAP6, discovered by whole-exome sequencing. A comprehensive investigation of this gene mutation through in vivo and in vitro experiments revealed that GIMAP6 deficiency results in defects in autophagy in patient T cells and interruption of GIMAP7 and GABARAPL2 interactions. GIMAP6 deficiency leads to affected patients to present with clinical phenotypes such as recurrent infections, lymphoproliferation, autoimmunity, and inflammation.

  Study phs002816

• Lysosomal Disease Network (LDN6719) Immune Response to Intrathecal Enzyme Therapy in Mucopolysaccharidosis 1 Patients

  In this study we characterized the immune response to intrathecal (IT) recombinant human alpha-L-iduronidase (rhIDU) in mucopolysaccharidosis I (MPS I) subjects with spinal cord compression who had been previously treated with intravenous rhIDU. Concentrations of specific antibodies and cytokines were measured in serum and cerebrospinal fluid (CSF) collected before monthly IT rhIDU infusions. These serologic findings were compared with clinical adverse event (AE) reports to establish temporal correlations with clinical symptoms. We found that IT rhIDU was generally well tolerated in the subjects studied although one subject had moderate to severe clinical symptoms and serologic abnormalities consistent with an immune response.

  Study phs000862

• Transcriptomic Profiling after B-Cell Depletion Reveals Central and Peripheral Immune Cell Changes in Multiple Sclerosis

  We investigated the immunological effects of B cell depletion therapy using ocrelizumab in treatment-naïve relapsing-remitting multiple sclerosis (RRMS) patients. Our primary aim was to delineate transcriptomic alterations in immune cell populations in peripheral blood before and after therapy, using single-cell RNA sequencing (scRNAseq). This study included 18 newly diagnosed, treatment-naïve RRMS patients who provided matched pre- and 6-month post-treatment peripheral blood mononuclear cells (PBMCs). A secondary cohort of five patients also contributed paired cerebrospinal fluid (CSF) samples. All RRMS patients were treated with ocrelizumab, except one patient in the CSF cohort who received rituximab.

  Study phs003938

• TruSight Oncology 500 ctDNA targeted sequencing data from endometrial cancer patients

  This dataset contains targeted sequencing data generated using the TruSight Oncology 500 ctDNA v2 assay from plasma-derived cell-free DNA of dMMR endometrial cancer patients, at baseline and C3D1 of immunotherapy. Sequencing was performed on Illumina NovaSeq600. Dataset includes aligned sequencing files in BAM format generated using the DRAGEN TruSight Oncology 500 ctDNA v2.6.0 analysis pipeline.

  Dataset EGAD50000002262

• Purified vs unpurified stem cell-islets

  A scRNAseq dataset consisting of stem cell-derived islets treated with gradient separation (HUES8_Pure_Islets) and unpurified control (HUES8_control_islets). scRNAseq was done on cryopreserved stage 7 stem cell (HUES8 cell line)-derived islets. Details about stem cell differentiation and sequencing can be found on the publication by Rajaei et al. (2025, Science Translational Medicine). This dataset correspond to Fig 4 of the publication.

  Dataset EGAD50000001396

• Whole genome sequencing of circulating cell-free DNA on Illumina and Ultima platforms

  The dataset includes Illumina (n=1) and Ultima (n=92) sequencing of circulating cell-free DNA. The dataset was generated through standard whole genome sequencing (Illumina n=1 & Ultima n = 15) and using a duplex unique molecular identifier whole genome sequencing workflow (Ultima, n=77). This dataset includes cancer samples and cancer-free control samples.

  Dataset EGAD50000001234

• Whole-genome sequencing with complement C1s deficiency linked to systemic lupus erythematosus

  This dataset includes two FASTQ files (R1 and R2) from an Illumina germline nuclear DNA whole-genome sequencing run of a single sample. The sample corresponds to a 34-year-old male with a rare deficiency in complement component C1s, linked to systemic lupus erythematosus (SLE). Genomic analysis revealed two novel mutations in the C1S gene.

  Dataset EGAD50000000988

• RNA-Seq profiles from the CheckMate-649 Clinical Trial

  This dataset contains RNA sequencing (RNAseq) data of 814 patients from the CheckMate 649 clinical trial whose ICF allows data deposition into a public repository. Gene expression profiling was performed retrospectively using RNAseq on a subset of baseline tumor samples. Paired-end FASTQ files were processed on Seven Bridges platform (Seven Bridges Genomics).

  Dataset EGAD50000001105

• Total RNA sequencing of fibroblasts from an individual with fragile X syndrome

  Total RNA sequencing of fibroblasts from an individual with a methylated CGG repeat >200x in the FMR1 5'UTR. Libraries were prepared with total RNA with Ribo-Zero ribosomal RNA depletion (illumina), and sequenced paired-end, 75bp on a NextSeq 550 system. This dataset contains three RNA-sequencing replicates from the same cell line.

  Dataset EGAD50000000920

• Pediatric CNS tumor classification by DNA-methylation dataset

  In this study nanopore sequencing was applied to obtain sparse DNA methylation profiles from pediatric CNS tumor samples. A neural network was used to classify the tumor based on the obtained methylation profile.

  Dataset EGAD00010002599

• Whole genome sequencing of metastatic cutaneous squamous cell carcinoma

  This dataset includes somatic small variant calling files derived from fifteen metastatic samples from cutaneous squamous cell carcinoma matched to normal blood samples. These samples were whole-genome sequenced by HiSeq X Ten and the resulting reads were mapped against the human genome (hg37) using BWA-MEM 0.7.10-r789. Somatic variant calling was then performed using strelka 1 (version 2.0.17).

  Dataset EGAD00001004530

• Whole-genome sequencing of paired tumor and blood samples from 65 bladder cancer patients

  65 paired tumor and normal whole-genome sequencing samples from urothelial bladder carcinomas (UBC, the most common type of bladder cancer) are used to uncover the whole-genome mutational landscape of UBC. Recurrent mutations in noncoding regions affecting gene regulatory elements and structural variations leading to gene disruptions are prevalent in this type of cancer.

  Dataset EGAD00001004545

• Ultra-fast deep-learned pediatric CNS tumor classification.

  In this study nanopore sequencing was applied to obtain sparse DNA methylation profiles from pediatric CNS tumor samples. A neural network was used to classify the tumor based on the obtained methylation profile.

  Dataset EGAD00001011303

• PacBio Rare Disease Study

  This study leverages PacBio HiFi long-read sequencing technology to comprehensively analyze the genomic architecture of rare diseases. By generating highly accurate, long-read sequences, we aim to resolve complex structural variants, repeat expansions, and other genomic features that are often missed by short-read sequencing. Our approach facilitates improved variant detection and interpretation, advancing the understanding of rare disease etiology and enabling more precise genetic diagnoses.

  Dataset EGAD00001015611

• Predictive value of chromosome 18q11.2-q12.1 loss for benefit from bevacizumab in metastatic colorectal cancer; a post-hoc analysis of the randomized controlled trial AGITG-MAX

  Patients and methods: We analyzed tumor samples of 256 patients enrolled in the AGITG-MAX 3-arm randomized controlled trial (RCT) who were randomly assigned to receive either capecitabine, or capecitabine and bevacizumab with- or without mitomycin. Chromosome 18q11.2-q12.1 copy number status was measured and correlated with PFS according to a predefined analysis plan with marker-treatment interaction as the primary end-point.Results: Chromosome 18q11.2-q12.1 losses were detected in 71% of patients (181/256) characteristic for mCRC. Consistent with the non-randomized study, significant PFS benefit of bevacizumab was observed in chromosome 18q11.2-q12.1 loss patients (P=0.009), and not in 18q no-loss patients (P=0.67). Although significance for marker-treatment interaction was not reached (Pinteraction = 0.28), hazard ratio and 95% confidence interval (HRinteraction 0.72, CI 0.39 - 1.32) show striking overlap with the non-randomized study cohorts (HRinteraction 0.41, CI 0.32 - 0.8) supported by a non-significant Cochrane chi-squared (P=0.11) for heterogeneity. Conclusions: PFS characteristics for marker positive- and negative patients randomized for treatment with- or without bevacizumab were consistent with those of the non-randomized discovery study, though the number of AGITG-MAX samples fell short to reach significance for marker-treatment interaction. Post-hoc analysis of the AGITG-MAX RCT provides supportive evidence for chromosome 18q11.2-q12.1 as a clinically relevant predictive marker for mCRC patients.

  Study EGAS00001005453

• Molecular profiling of tissue autopsies and ctDNA

  The dataset contains high-throughput sequencing data derived from a cancer autopsy series of 10 patients. As part of this study, whole-exome sequencing and RNA-seq were performed for spatially distinct tissue biopsies from the patients. In addition, plasma samples from the patients were sequenced using a custom panelt to profile ctDNA. There are 106 files containing whole-exome sequencing data, 107 files containing RNA-seq data, and 9 files containing plasma sequencing data.

  Dataset EGAD00001007040

• Clonal Evolution and Transcriptional Plasticity Shape Metastatic Dissemination Routes in Prostate Cancer

  This study provides comprehensive insights into the genetic and transcriptomic landscape of prostate cancer, highlighting significant clonal heterogeneity, transcriptional plasticity, and metastatic spread patterns. We examined the clonal evolution and metastatic dissemination of prostate cancer by integrating single-nuclei RNA sequencing (snRNA-seq) and low-pass whole-genome sequencing (WGS) data from 43 spatially distinct tumour samples in five patients with locally advanced disease. By reconstructing the evolutionary trajectories of each tumour, we identified distinct patterns of tumour evolution, including both monophyletic and polyphyletic metastatic dissemination, as well as ongoing primary tumour clonal evolution after metastatic spread. We observed converging changes leading to metastatic potential, such as androgen receptor independence and increased activity in the estrogen, WNT, and JAK/STAT pathways in identified seeding areas. These findings enhance our understanding of the disease's progression and may inform future therapeutic strategies.

  Study EGAS50000000927

• TenK10K Phase 1:  Single Cell

  Understanding the genetic basis of gene expression can shed light on the regulatory mechanisms underlying complex traits and diseases. Single-cell resolved measures of RNA levels and single-cell expression quantitative trait loci (sc-eQTLs) have revealed genetic regulation that drives sub-tissue cell states and types across diverse human tissues. Here, we describe the first phase of TenK10K, the largest- to-date dataset of matched whole-genome sequencing (WGS) and single-cell RNA-sequencing (scRNA-seq). We leverage scRNA-seq data from over 5 million cells across 28 immune cell types and matched WGS from 1,925 individuals. This provides power to detect associations between rare and low-frequency genetic variants that have largely been uncharacterised in their impact on cell-specific gene expression. We map the effects of both common and rare variants in a cell type specific manner using SAIGE-QTL.

  Study EGAS50000001653

• Conserved interferon-gamma signaling and decreased immune exclusion programs in responses to immune checkpoint blockade therapy

  We analyzed baseline and on-therapy tumor biopsies from 101 patients with advanced melanoma treated with nivolumab (anti-PD-1) alone or combined with ipilimumab (anti-CTLA-4). Analysis of whole transcriptome data showed that T cell infiltration and interferon-gamma signaling signatures corresponded most highly with clinical response to therapy, with a reciprocal decrease in cell cycle and WNT signaling pathways in responding biopsies. Clinical outcome differences were likely not due to differential melanoma cell responses to interferon-gamma, as 57 human melanoma cell lines exposed in vitro to this cytokine showed a conserved interferon-gamma transcriptome response unless they had mutations that precluded signaling from the interferon-gamma receptor. Therefore, the magnitude of the antitumor T cell response and the corresponding downstream interferon-gamma signaling are the main drivers of clinical response or resistance to immune checkpoint blockade therapy.

  Study EGAS00001004545

• single-stranded DNA study

  A ssDNA library protocol was applied to cfDNA from plasma samples obtained from different DNA extraction methods and revealed significant differences in DNA fragmentation patterns in comparison to dsDNA-based protocols. In particular, a specific combination of methods revealed a population of ultrashort fragments, organized at ~50 bp. We observed significant differences in the relative abundance of these ultrashort DNA fragments in plasma from healthy individuals and cancer patients. Through shallow whole genome sequencing (sWGS, <0.5-fold coverage) and the analysis of somatic copy number aberrations (SCNA), we determined the landscape of genetic alterations in this newly identified population of cfDNA fragments. In addition, we studied their potential link with regulatory regions by investigating the genome-wide coverage patterns at transcription start sites (TSS). Furthermore, we demonstrated that the ultrashort cfDNA fragments map to regions associated with secondary DNA structures, G-quadruplexes (G4s).

  Study EGAS00001005093

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Genetic Effects on miRNA Expression During Mid-Gestation Neocortical Development

  In this study we aimed to find common genetic variants that influence miRNA expression during mid-gestation neocortical development. Small RNA-sequencing from 212 fetal cortical tissue samples between 14 and 21 weeks gestation were used to profile miRNA expression. Combined with donor genotypes, we were able to find miRNA-eQTLs during neocortical development. The dataset provided here includes 212 Small RNA-sequencing files in FASTQ format from cortical wall samples. Also provided here are 212 donor genotypes in PLINK format (hg19).

  Study phs003106

• Transcriptomic Profiling of an Anti-PD-L1 Treated Cohort of Newly Diagnosed GBM Patients

  Checkpoint inhibitor therapy has limited efficacy in glioblastoma patient outcomes. This study involves RNA sequencing (RNA-seq) of newly diagnosed GBM patients treated with concurrent atezolizumab, radiation therapy, and temozolomide. By analyzing RNA-seq data from 39 tumors, the study aims to explore tumor transcriptomic features, including immune-based transcriptomic programs and immune infiltration, to understand their influence on PD-L1 blockade treatment efficacy and to identify which patients may benefit more from such therapy.

  Study EGAS50000000784

• scRNA-seq of CD4+ T cells from blood, lymph nodes and tumors of NSCLC patients

  This study explore the CD4+ T cells diversity in paired blood, lymph nodes and tumors of 5 different NSCLC patients. After FACS-sorted of Tregs (DAPI- CD45+ CD4+ CD25hi CD127lo) and Tconvs (DAPI- CD45+ CD4+CD25lo CD127lo/hi), cells were mixed in equal proportion (fifty/fifty ratio) and processed with 10X Chromium (10X Genomics) gene expression kit (3 bloods, 2 lymph nodes and 2 tumors) or immunoprofiling kit (2 bloods, 4 lymph nodes and 3 tumors) and sequenced using Illumina platforms.

  Study EGAS50000000293

• TERT rearrangements are frequent in neuroblastoma and identify aggressive tumors

  Whole genome sequencing detected structural rearrangements of TERT in 17/75 high stage neuroblastoma with 5 cases resulting from chromothripsis. Rearrangements were associated with increased TERT expression and targeted immediate up- and down-stream regions of TERT, placing in 7 cases a super-enhancer close to the breakpoints. TERT rearrangements (23%), ATRX deletions (11%) and MYCN amplifications (37%) identify three almost non-overlapping groups of high stage neuroblastoma, each associated with very poor prognosis. This submission contains all newly sequenced samples only.

  Study EGAS00001001479

• Evolutionary Genome Analysis of Transformation into Small Cell Carcinomas from Lung Adenocarcinomas

  Anecdotal case have been reported lung adenocarcinoma could occasionally transform into small cell carcinoma. Most of the reported cases were EGFR-mutant lung adenocarcinomas that transform into small cell carcinoma during EGFR tyrosine kinase inhibitor treatment. However, some cases also indicate lung adenocarcinomas without EGFR mutation could also transform into small cell carcinomas. Here we investigate this transformation process by whole genome sequencing of transformed small cell carcinomas as well as serially acquired samples of lung adenocarcinoma into small cell carcinomas.

  Study EGAS00001001757

• Relapse series of two Pediatric ALL patients

  In this proof of principle study, we performed whole genome sequencing of two cases with multiple relapses in order to investigate whether groups of mutations separated in time show distinct mutational signatures. In patient 1, who experienced two relapses, the analysis unraveled a continuous interplay of aberrant AID/APOBEC-associated activities. Patient 2 had three relapses. We identified episodic mutational processes at diagnosis and first relapse leading to mutations resembling UV light-driven DNA damage, and thiopurine-associated damage at first relapse.

  Study EGAS00001005001

• Circulating mRNA and miRNA signatures predicting response to lifestyle intervention in pediatric obesity

  This study aims to identify circulating transcriptomic biomarkers predictive of response to lifestyle intervention in pediatric obesity. Peripheral blood whole-transcriptome RNA sequencing and microRNA sequencing were performed in a subset of children and adolescents with obesity participating in a prospective 12-month multicenter lifestyle modification program. The generated data are linked to detailed demographic, clinical, anthropometric, biochemical, and treatment outcome variables. These resources support investigations of molecular pathways underlying obesity, treatment responsiveness, and precision medicine approaches in pediatric obesity management.

  Study EGAS50000001901

• WGS of cfDNA in PDAC Breast Cancer and Matched Controls

  This dataset contains WGS data derived from plasma cfDNA. The cohort includes PDAC and breast cancer patients alongside matched controls. These data are intended to support research into ctDNA and genomic fragmentation patterns.

  Dataset EGAD50000002323

• Active-Seq of CRC patients

  This dataset contains 48 fastq files of samples derived from CRC patients, including colorectal cancer tissue, normal adjacent tissue and cfDNA samples, processed with the Illumina platform NovaSeq6000.

  Dataset EGAD50000001746

• Single-cell somatic copy number variants in brain using different amplification methods and reference genomes

  This dataset contains 224 paired fastq files (112 single cells) from the following samples: brains from two Multiple System Atrophy patients and one control, and non-brain controls (fibroblasts, NA12878)

  Dataset EGAD50000000030

• Plasma cell-free H3K4me3 chromatin immunoprecipitation sequencing

  This dataset contains plasma cell-free nucleosome H3K4me3 chromatin immunoprecipitation sequencing (cfChIP-seq) from metastatic breast cancer patients and healthy individuals. Sequencing was performed on Illumina platforms and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002525

• 200PT : WG Aligned Sequence (bam)

  200PT : WG Aligned Sequence (bam)/ Aligned WG sequence data in this dataset are from CPCGene Tumour/Normal Pairs used in the 200PT Study

  Dataset EGAD00001004061

• Proteogenomic Landscape of Curable Prostate Cancer

  Aligned RNA-seq sequences in this dataset are from the Proteogenomic Landscape of Curable Prostate Cancer study

  Dataset EGAD00001004875

• MGRB dataset. GATK joint called variants of 2570 phase 2 samples.

  This dataset comprises a 2572 sample joint called vcf from the Medical Genome Reference Bank.

  Dataset EGAD00001005228

• Whole genome sequence of intratumor heterogeneity study

  This dataset contains whole genome sequence data from 12 samples from 1 patient, including 8 tumor sectors and 4 normal samples. All the experiments were performed on Illumina HiSeq platform with raw reads stored in fastq format.

  Dataset EGAD00001005452

• Matched FF and FFPE WGS from a metastatic prostate tumor

  This dataset contains three bam files. One normal blood sample and two matched FF and FFPE samples from the same metastatic prostate tumor.

  Dataset EGAD00001006180

• 5hmC enrichment in human monocyte differentiation

  This dataset consists of 5hmC capture-seq data from human monocytes, monocyte-derived dendritic cells. It includes two biological replicates and three time points. Including controls, the dataset comprises 10 samples in total.

  Dataset EGAD00001006603

• Cam_121 RNA-Seq data

  This dataset contains RNA-Seq data from 204 primary melanomas and 177 regional lymph nodes. More details can be found in the manuscript: "Tumour gene expression signature in primary melanoma predicts long-term outcomes: A prospective multicentre study"

  Dataset EGAD00001006401

• 9 samples variant calling data

  This dataset comprise results of mutect2 variant calling in vcf format on 9 samples of rosette forming brain tumors (5 with paired normal tissue and 4 without). Only variants specific to the tumor where kept to comply with patients consent.

  Dataset EGAD00001009266

• Exome and transcriptome sequencing of CDS and ES tumor samples

  This dataset contains WES and RNASeq data of 31 CDS and ES tumor and control samples. Sequencing was performed on Illumina NovaSeq 6000. The sequencing was performed paired in bulk.

  Dataset EGAD00001015608

• iCope fastq files

  The data set contains the fastq files of the single cell RNAseq study associated with the iCope manuscript. There are fastq files for gene expression and for tcr enrichment for each sample.

  Dataset EGAD50000001645

• Lactobacillus rhamnosus GG ATCC (LGG) as an immune adjuvant for influenza vaccination in the elderly

  Double blind Randomized Controlled trial to evaluate the safety of Lactobacillus rhamnosus GG ATCC 53103 (LGG) vs placebo in elderly receiving Trivalent Inactivated Influenza Vaccine (TIV) (study 1) or Double blind Randomized Controlled trial to evaluate the safety of Lactobacillus rhamnosus GG ATCC 53103 (LGG) vs. placebo in elderly subjects receiving Live Attenuated Influenza vaccine (LAIV) (study 2). Healthy elderly volunteers, ages 65-80 were enrolled as outpatients in two clinical studies in which they received the TIV vaccine (study 1, n=28) or the LAIV vaccine (study 2, n=30). In each of the 2 studies, subjects were randomized to receive either LGG capsules containing 1 x 1010 CFU, twice daily for 28 days, or matching placebo capsules twice daily for the same period of time. The study subjects completed a daily diary, telephone calls, and study visits at the Massachusetts General Hospital Clinical Research Centers at baseline, days 21, 28 and 56 and month 5 for the TIV study and baseline, days 21, 28, and 56 for the LAIV study. During each visit, the subject diary, interim history, potential adverse effects and concomitant medications were reviewed and vital signs and a physical examination were performed. Routine blood tests were obtained to monitor for safety during visits and nasopharyngeal and stool samples were collected for microbiome analysis. Volunteers in both studies who were interested in participating in the effect of LGG probiotic on the Human whole Blood Transcriptome substudy also had blood drawn for DNA and RNA extraction, after signing the substudy consent form. The main objectives of the TIV and LAIV studies were to assess the safety and tolerability of 2 x 1010 CFU LGG administered orally to elderly subjects for 28 days after administration of TIV (study 1) or LAIV (study 2). Secondary objectives were to evaluate the richness and microbial diversity in nasopharyngeal and stool specimens using pyrosequencing, and to compare cytokine production in response to bacterial stimulation by following the kinetics of mRNA expression of pro and anti-inflammatory genes and different signaling pathways, in relation to changes in stool Bifidobacterium and Lactobacillus spp. The studies were reviewed and approved by the Partners Human Research Committee (TIV study IRB # 2010p001694 and LAIV study IRB # 2011p002849) and were registered at ClinicalTrials.gov (NCT01368029 and NCT01545349, respectively).

  Study phs000981

• Synchronous patterning of hiPSC-derived CNS progenitors generates comprehensive axial spinal cord organoids (CASCOs) containing diverse motor neuron population

  Advancements in human induced pluripotent stem cell (hiPSC) culture have enabled the generation of spinal cord organoids (SCOs), though achieving distinct axial identities in spinal motor neurons (spMNs) along the rostro-caudal (RC) axis remains a challenge. By optimizing the timing and sequence of patterning factors, we developed a mixed stem cell model of rostral neural stem cells (NSCs) and caudal neuromesodermal progenitors (NMPs) to generate SCOs with enhanced spMN heterogeneity, including a wide range of axial identities and benchmarked this against commonly used protocols. Our approach, termed CASO (Comprehensive Axial Spinal Organoids), also incorporates endothelial networks and skeletal muscle to improve organoid complexity and health, offering a novel method to study spMN axial specification and model neurodegenerative diseases.

  Study EGAS50000000891

• Clinical activity and molecular correlates of response to atezolizumab alone or in combination with bevacizumab versus sunitinib in renal cell carcinoma

  We examined pre-treatment tumors from participants of the IMmotion150 trial. Biomarker analyses indicate that high angiogenesis gene expression was associated with improved PFS within the sunitinib arm, and high T-effector/IFNγ response (Teff) gene expression with longer PFS in atezolizumab + bevacizumab vs sunitinib patients. In high Teff tumors, concomitant high myeloid inflammation was associated with worse PFS in the atezolizumab monotherapy arm; adding bevacizumab to atezolizumab in this subgroup improved PFS vs atezolizumab. Molecular profiles suggest that prediction of outcomes with VEGF inhibitors and immunotherapy may be possible in mRCC, and bevacizumab may overcome myeloid inflammation-associated atezolizumab resistance.

  Study EGAS00001002928