16766 results for "sec+and+unspecified+malignant+neoplasm"

in 104.22 milliseconds.

• CUTRUN files for Klco-NUP98 data

  CUTRUN files for paper titled "Fusion oncoproteins and cooperating mutations define disease phenotypes in NUP98-rearranged leukemia"

  Dataset EGAD00001015478

• Dataset for transcriptome sequencing of chordoma cells

  This dataset contains transcriptome sequencing for 15 samples from chordoma cells. The sequencing was performed on Illumina HiSeq 4000 and Illumina NovaSeq 6000. The sequencing was always paired.

  Dataset EGAD00001015642

• MASS_Pilot: Muscle and Ageing Science Study - Collaboration with Wellcome Sanger Institute to characterise skeletal muscle ageing using Human Cell Atlas approaches (2025-07-31)

  Transcriptomic analysis of skeletal muscle, to understand the mechanisms of muscle ageing. . This dataset contains all the data available for this study on 2025-07-31.

  Dataset EGAD00001015670

• Additional RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 33 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 using NEBNext Single Cell and Low Input RNA Library Prep Kit for Illumina.

  Dataset EGAD00001015678

• RNA sequencing data from the lungNENomics project

  Raw RNA-seq data from the lungNENomics cohort, comprising 319 pairs of FASTQ files from 179 individuals. This dataset also includes a gene count matrix, gene TPM matrix and gene expression VST matrix from 244 samples.

  Dataset EGAD00001015524

• Thymic epithelial transplantation for complete DiGeorge syndrome Spatial (2026-01-19)

  Spatial transcriptome analysis of thymic cells from children with syndromic diseases such as Trisomy 21 and inflammatory/autoimmune diseases such as myasthenia gravis. . This dataset contains all the data available for this study on 2026-01-19.

  Dataset EGAD00001015798

• Dataset for "Characterizing the cfDNA fragmentome in patients with hepatocellular carcinoma"

  The dataset includes 63 BAM files from Oxford Nanopore PromethION whole-genome sequencing, generated by base calling POD5 files with Dorado (super-accurate, modified base model v5.0.0_5mCG_5hmCG@v3) and aligning reads to the hg19 reference genome.

  Dataset EGAD00001015823

• Raw data of Visium Spatial Transcriptomics

  Raw fastq files of 24 samples underlying the spatial transcriptomics analysis of "Human microglial transitions at the Aβ–Tau inflection point associate with divergent pathways to dementia and resilience" using the 10X Visium Spatial Transcriptomics platform

  Dataset EGAD50000002431

• multiple-region preneoplasia lung adenocarcinoma

  multi-region exome sequencing of 116 pulmonary nodules including lung preneoplasia atypical adenomatous hyperplasia (AAH, N=22), adenocarcinoma in situ (AIS, N=27), minimally invasive adenocarcinoma (MIA, N=54) and invasive lung adenocarcinoma (ADC, N=13).

  Dataset EGAD00001004960

• Sequence data of 28 Samples (19 chronic lymphocytic leukemia, 9 control)

  Sequence data of 28 Samples (19 chronic lymphocytic leukemia, 9 control) Including RNA-Seq and ChIP-Seq of following histone modifications: H3, H3K4me1, H3K4me3, H3K9ac, H3K9me3, H3K27ac, H3K27me3, H3K36me3 Project see: http://www.cancerepisys.org/

  Dataset EGAD00001003421

• Whole exome sequencing of SU- DIPG-XIII from different sites

  Whole exome sequencing of diffuse intrinsic pontine glioma (DIPG) cells isolated from the pons and from a sub-ventricular zone site of spread within the frontal lobe from the same individual (SU- DIPG-XIII)

  Dataset EGAD00001003563

• RRBS - MBD4-deficient AML

  Reduced Representation Bisulfite Sequencing for WEHI-AML-1 and WEHI-AML-2. RRBS libraries were made with the NuGEN Ovation RRBS Methyl-Seq System. Bisulfite conversion was performed with the Qiagen Epitect kit. Sequencing was performed on an Illumina HiSeq2500.

  Dataset EGAD00001003567

• In vitro mutational load

  Clonally expanded human pluripotent and adult (liver + intestine) stem cell clones were subjected to whole genome sequencing to determine the mutational impact of in vitro culture

  Dataset EGAD00001004104

• Exome sequencing of patients with acute promyelocytic leukemia

  The dataset consists in 64 fastq files from 23 patients with acute promyelocytic leukemia. Exome sequencing was conducted on several stages (Diagnosis, Remission, Relapse) for each patient. For 5 patients, only Diagnosis and Relapse samples are available.

  Dataset EGAD00001004043

• Rapid multiplex small DNA sequencing on the MinION nanopore sequencing platform

  Ultra low coverage sequencing results from the project 'Rapid multiplex small DNA sequencing on the MinION nanopore sequencing platform'. Sequencing data of sample NA12877 and NA12878 generated from 3 nanopore sequencing runs are included in this dataset.

  Dataset EGAD00001004052

• Whole genome sequence of hepatocellular carcinoma (BCM)

  Exome fastq files of 98 hepatocellular carcinoma and matched nomral (BCM, HCC-JP)

  Dataset EGAD00001003804

• RNA-Seq files for SJHGG study

  RNA-Seq files accompanying the paper titled "Somatic Histone H3 Mutations in Diffuse Intrinsic Pontine Gliomas and Non-Brainstem Paediatric Glioblastomas".

  Dataset EGAD00001003905

• Exome sequencing files for "Minimal functional driver gene heterogeneity among untreated metastases"

  Files from whole exome sequencing of 14 tumors from two cancer patients (endometrial and lung cancer) along with a matched normal tissue per patient.

  Dataset EGAD00001004212

• Strand-specific RNA sequencing of 16 pairs of primary and relapsed IDH-wt glioblastomas

  This dataset contains strand-specific RNA sequencing data from 16 primary/relapsed sample pairs of IDH-wt glioblastomas

  Dataset EGAD00001004564

• Whole-genome sequencing of Epstein-Barr virus in hematological malignancy

  Capture-based whole-genome sequencing of Epstein-Barr virus (EBV) was performed in hematological malignancies such as EBV-positive diffuse large B-cell lymphoma, extranodal NK/T-cell lymphoma, and chronic active EBV infection.

  Dataset EGAD00001004298

• Noncoding Mutational Analysis of DLBCL Genomes

  146 DNA samples obtained from 73 DLBCL patients (matching tumor and normal) were sequenced with PCR free 1.0 genome shotgun sequencing. All files are in bam format.

  Dataset EGAD00001004142

• macIDR validation data

  RNA-seq of 24 M-CSF differentiated human peripheral monocyte-derived macrophages (MDMs) activated with short exposure (3hours) to LPS, or long exposure (24 hours) to LPS, LPS with IFNγ, IFNγ, IL-4, IL-10, and dexamethasone.

  Dataset EGAD00001004584

• WGS on patients 1-4, study of metastatic prostate cancer

  Data from the study of subclonal metastatic expansion in prostate cancer. Whole genome shotgun sequencing of fifteen samples, tumour and whole blood, from the four initial patients.

  Dataset EGAD00001001343

• RNA-seq on patients 1-4, study of metastatic prostate cancer

  Data from the study of subclonal metastatic expansion in prostate cancer. RNA-seq of twelve samples, tumour and benign tissue, from the four initial patients.

  Dataset EGAD00001001345

• TCS validation of 11 lung adenos

  This is the targeted capture deep sequencing (TCS) data for validation of the mutations discovered in the WES step. There are 58 bam files of TCS data including 48 tumor samples and 10 peripheral blood WBC samples.

  Dataset EGAD00001000985

• Genentech gastric cell line sequencing

  RNAseq and exome sequencing data of gastric cancer cell lines.

  Dataset EGAD00001001013

• Whole Genome (WG) sequencing data files for H_NO-JB001

  DNA was derived from the primary tumour, lung metastasis, and peri-aortic lymph node metastasis. DNA from the spleen was used as a normal control.WG sequencing produced ~30-fold (primary tumour, spleen normal)-50-fold (lung metastasis) coverage

  Dataset EGAD00001001253

• RNA sequencing of adult T-cell leukemia/lymphoma

  RNA sequencing of 57 tumor samples of adult T-cell leukemia/lymphoma as well as 3 samples of HTLV-1 carrier and 3 samples of healthy volunteers.

  Dataset EGAD00001001411

• Validation for human early embryonic substitutions (2015_09_03)

  PCR and MiSeq validation for early embryonic substitution candidates from 400 Breast cancer patients. This dataset contains all the data available for this study on 2015-09-03.

  Dataset EGAD00001001600

• GENCORD2_GENOTYPES

  204 individuals were genotyped with the Illumina 2.5M Omni chip. Filtered genotypes were imputed into the 1000 genomes project European panel SNPs. Beagle R2 is indicated in VCF files for further filtering. See Materials and Methods in publication for details.

  Dataset EGAD00001000428

• Hepatocellular adenomas samples

  Whole exome sequencing data from 30 donors (46 tumors and 30 non-tumoral whole exome sequencing, paired-end, HiSeq 2000, Illumina) collected by the Inserm U674, PI Jessica Zucman-Rossi - Institut National du Cancer (INCa), PI Fabien Calvo, France.

  Dataset EGAD00001000737

• Creatine in Huntington's Disease (HD) (CREST-E)

  This is a multi-center, randomized, double-blind, placebo-controlled trial of creatine monohydrate involving 553 ambulatory subjects with HD who are not requiring skilled care or institutionalization. Eligible subjects were randomized to receive up to 40 grams daily of creatine monohydrate or matching placebo. Randomization will be followed by a Titration Phase, a Maintenance Phase, an Optional Extended Maintenance Phase, and Washout. During the Titration Phase, which may last up to six months, study drug will be initially escalated in 5-gram increments starting at 5 g/day until the 40 g/day target dose is reached. Should subjects be unable to reach or stay at the maximum dose during the Titration Phase, they will remain on the highest tolerated dose (HTD) for which they have no significant side effects. During the Maintenance Phase, subjects will be followed prospectively and systematically. Subjects completing 36 months of follow-up on study drug will be eligible to continue in the study for an additional twelve months of follow-up in the Extended Maintenance Phase. The primary measure of efficacy is the annualized rate of change in TFC. The primary hypothesis of the study is that chronic treatment of early-stage HD subjects with creatine monohydrate will slow the progressive functional decline of HD.

  Study phs001488

• Swarm Learning to identify COVID-19, tuberculosis and leukemia patients based on blood transcriptomes

  Identification of patients with life-threatening diseases including leukemias or infections such as tuberculosis or COVID-19 is an important goal of modern precision medicine. However, there is an increasing divide between what is technically possible and what is allowed because of privacy legislation. We have recently illustrated that classical machine learning can identify leukemia patients based on their blood transcriptomes. To facilitate integration of any omics data from any data owner world-wide without violating privacy laws, we here introduce Swarm Learning (SL), a decentralized machine learning approach uniting edge computing, artificial intelligence (AI), blockchain and privacy protection without the need for a central coordinator thereby going beyond federated learning. To illustrate its feasibility, using more than 12,000 transcriptomes from peripheral blood mononuclear cells and more than 2,000 peripheral blood transcriptomes we demonstrate that SL of omics data distributed across different individual sites leads to disease classifiers that outperform those developed at individual sites. Yet, SL completely protects local privacy regulations by design. We propose this approach to noticeably accelerate the introduction of precision medicine.

  Dataset EGAD00001006231

• Ethiopia_Genome_Project__high_coverage_

  The Ethiopian area stands among the most ancient ones ever occupied by human populations and their ancestors. Particularly, according to archaeological evidences, it is possible to trace back the presence of Hominids up to at least 3 million years ago. Furthermore, the present day human populations show a great cultural, linguistic and historic diversity which makes them essential candidate to investigate a considerable part of the African variability. Following the typing of 300 Ethiopian samples on Illumina Omni 1M (see Human Variability in Ethiopia project, previously approved by the Genotyping committee) we now have a clearer idea on which populations living in the area include the most of the diversity.This project therefore aims to sequence the whole genome of 300 individuals at low (4-8x) depth belonging to the six most representative populations of the Ethiopian area to produce a unique catalogue of variants peculiar of the North East Africa. Furthermore 6 samples (one from each population) will also be sequenced at high (30x) depth to ensure full coverage of the diversity spectrum.The retrieved variants will be of great help in evaluating the demographic dynamics of those populations as well as shedding light on the migrations out of Africa.

  Study EGAS00001000237

• Ethiopia_Genome_Project__low_coverage_

  The Ethiopian area stands among the most ancient ones ever occupied by human populations and their ancestors. Particularly, according to archaeological evidences, it is possible to trace back the presence of Hominids up to at least 3 million years ago. Furthermore, the present day human populations show a great cultural, linguistic and historic diversity which makes them essential candidate to investigate a considerable part of the African variability. Following the typing of 300 Ethiopian samples on Illumina Omni 1M (see Human Variability in Ethiopia project, previously approved by the Genotyping committee) we now have a clearer idea on which populations living in the area include the most of the diversity.This project therefore aims to sequence the whole genome of 300 individuals at low (4-8x) depth belonging to the six most representative populations of the Ethiopian area to produce a unique catalogue of variants peculiar of the North East Africa. Furthermore 6 samples (one from each population) will also be sequenced at high (30x) depth to ensure full coverage of the diversity spectrum.The retrieved variants will be of great help in evaluating the demographic dynamics of those populations as well as shedding light on the migrations out of Africa.

  Study EGAS00001000238

• Identification of biomarkers of response to preoperative talazoparib monotherapy in treatment naïve gBRCA+ breast cancers

  Germline mutations in BRCA1 or BRCA2 exist in ~2-7% of breast cancer patients, which has led to the approval of PARP inhibitors in the advanced setting. We have previously reported a phase II neoadjuvant trial of single agent talazoparib for patients with germline BRCA pathogenic variants with a pathologic complete response (pCR) rate of 53%. As nearly half of the patients treated did not have pCR, better strategies are needed to overcome treatment resistance. To this end, we conducted multi-omic analysis of 13 treatment naïve breast cancer tumors from patients that went on to receive single-agent neoadjuvant talazoparib. We looked for biomarkers that were predictive of response (assessed by residual cancer burden) after 6 months of therapy. We found that all resistant tumors exhibited either the loss of SHLD2, expression of a hypoxia signature, or expression of a stem cell signature. These results indicate that the deep analysis of pre-treatment tumors can identify biomarkers that are predictive of response to talazoparib and potentially other PARP inhibitors, and provides a framework that will allow for better selection of patients for treatment, as well as a roadmap for the development of novel combination therapies to prevent emergence of resistance.

  Study EGAS00001005676

• Detection of cancers three years prior to diagnosis using plasma cell-free DNA

  A major goal of early cancer detection is to identify subclinical disease when the tumor burden is low, so that treatments are more effective. But how early can cancers be detected prior to clinical signs or symptoms? This question can be answered only through the evaluation of participants whose clinical course has not been altered by the study itself. We here describe such an evaluation, performed on prospectively collected plasma samples from the Atherosclerosis Risk in Communities (ARIC) study, including 26 participants diagnosed with cancer and 26 matched controls. At the index time point, eight of these 52 participants scored positively with a multicancer early detection (MCED) blood test. All eight of these participants were diagnosed with cancer within 4 months after blood collection. In six of these 8 participants, we were able to assess an earlier plasma sample collected 3.1 to 3.5 years prior to clinical diagnosis. In four of these six participants, the same mutations detected by the MCED test could be identified, but at 8.6 to 79-fold lower levels. These results demonstrate that it is possible to detect circulating tumor DNA (ctDNA) more than three years prior to clinical diagnosis, and provide benchmark sensitivities required for the success of ctDNA-based tests for this purpose.

  Study EGAS00001008068

• A Tumour Organoid Biobank for Mapping Cancer Cell Vulnerabilities - WGS

  Whole genome sequencing data from cancer patient-derived organoids and their matched tumour tissue samples. Part of a study to include genomic and transcriptomic sequencing data, along with CRISPR screening data from cancer patient-derived organoids and matched tumour tissues. Some organoids were developed as part of the Human Cancer Models Initiative (HCMI) in collaboration with Cancer Research UK (CRUK). The study includes organoids derived from colorectal, oesophageal, ovarian, pancreatic, and stomach cancer samples.

  Dataset EGAD00001015469

• AmsterdamUMC Data Access Committee for the study "Multi-omic analysis of thyroid dysfunction in Down Syndrome"

  The current data access committee reviews and assesses data requests of researchers that seek to gain access to data acquired as part of the "Multi-omic analysis of thyroid dysfunction in Down Syndrome" study as performed at the AmsterdamUMC, Amsterdam, Netherlands.

  Dac EGAC50000000186

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• RNA Dataset

  The RNA dataset includes 5 samples analyzed with the Oncomine Comprehensive Assay (OCA) panel. After library preparation, sequencing was performed on the Ion Torrent S5 System, generating FASTQ files. The analysis captures gene fusions and splice variants relevant to oncogenic processes. (idem)

  Dataset EGAD50000002502

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• mFAST-SeqS

  mFAST‑SeqS, or modified Fast Aneuploidy Screening Test‑Sequencing System, is a streamlined and cost-effective approach to estimate the fraction of ctDNA in blood samples by detecting genome-wide aneuploidy in cfDNA

  Dataset EGAD50000001670

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• This dataset contains the cram files from the whole Exome sequencing

  Exome Sequencing of Healthy and M. Heamophilum Infected Participants

  Dataset EGAD50000001565

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• TRACERx NSCLC - whole genome sequencing for ctDNA study

  Data used in "An ultra-sensitive and specific ctDNA assay provides novel pre-operative disease stratification in early stage lung adenocarcinoma"

  Dataset EGAD50000000452

• WES data for genomic determinants of response and resistance to inotuzumab in B-ALL

  Whole exome sequencing data for 69 samples with B-cell acute lymphoblastic leukemia

  Dataset EGAD50000000097

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• Exome sequencing for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome

  Exome sequencing was performed for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome. Tumor DNA was extracted from adrenocortical adenomas and normal DNA was extracted from adjacent adrenal tissues or periphral blood.

  Dataset EGAD00001000715

• BLUEPRINT DNA methylation profiles of human hematopoietic progenitors

  DNA methylation was analyzed for stem/progenitor cell types and terminally differentiated cell types of the human blood lineage (HSC, MPP, CMP, MEP, GMP, CLP, MLP0, MLP1, MLP2, MLP3, MK, CD4+ Tcell, CD8+ Tcell, Bcell, NK, Neut, Mono).

  Dataset EGAD00001002732

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• EGAS00001003405 combined RNA, WES, WGS data of 16 gastrointestinal tumor patients

  50 samples of 16 individuals with Gastrointestinal Tumor. Patients were sequenced in various combinations of WGS, Exome and RNA sequencing.

  Dataset EGAD00001005113

• Exome sequencing of 7-member healthy family (father, mother, their three biological daughters and monozygotic twin sons)

  The dataset contains exome sequencing data of seven healthy family members, all in FASTQ format. The samples were taken from peripheral blood mononuclear cells. Furthermore, corresponding proteomics data are available as well.

  Dataset EGAD00001004949

• Targeted deep sequencing

  T200 caner panel sequencing on primary and metastatic sites from highly clinically annotated HGSC samples. Samples were obtained pre-treatment based on a laparoscopic triage algorithm from patients who underwent R0 tumor debulking, or received neoadjuvant chemotherapy (NACT) with excellent (ER) or poor response (PR).

  Dataset EGAD00001005239

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• EFFORT occupationally exposed human stool metagenomes (148 samples)

  Metagenomes of stool samples from 54 pig farmers, 24 broiler farmers and 70 slaughter line workers. Note: Access to the data will only be granted for antibiotic resistance studies in accordance with the EFFORT consents issued by the participants.

  Dataset EGAD00001005444

• GRAIL Metadata

  Metadata summarizes participants (n=198), samples (n=396), basic clinical information, and analysis. analysis1: raw sequencing reference alignment files (bam/bai) analysis2: error-corrected sequencing reference alignment files (bam/bai) analysis3: variant calling using error-corrected sequencing reference alignment (vcf)

  Dataset EGAD00001005302

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• RNA-seq of SMARCA2/4 knock-down prostate cancer cell lines

  RNA-seq of SMARCA2/4 knock-down prostate cancer cell lines (LNCaP and 22Rv1, 15 samples altogether). Dataset contains BAM files from RNA-seq performed using Illumina HiSeq 2500.

  Dataset EGAD00001005800

• Blood plasma and paired genomic DNA from neuroblastoma patients

  The dataset is comprised of 3 blood plasma samples (Patient 1-3_plasma_cfDNA) paired with genomic DNA (Patient 1-3_tumor gDNA) from the corresponding primary neuroblastoma from three patients. For all these samples whole-exome sequencing (WES) data have been generated.

  Dataset EGAD00001006012

• 20201006_EGA_MELA_CRKL_RNA

  Illumina RNASeq sequencing of tumour samples from 53 cases of cutaneous melanoma and 61 cases of acral melanoma

  Dataset EGAD00001006439

• WGBS data for EGAS00001004660

  WGBS data for EGAS00001004660, "Aggressive PDACs show hypomethylation of repetitive elements and the execution of an intrinsic IFN program linked to a ductal cell-of-origin"

  Dataset EGAD00001006538

• RNA data for EGAS00001004660

  RNA data for EGAS00001004660, "Aggressive PDACs show hypomethylation of repetitive elements and the execution of an intrinsic IFN program linked to a ductal cell-of-origin"

  Dataset EGAD00001006539

• ChIPseq data for Glioblastoma (EGAS00001003953, H016)

  ChIPseq data for human glioblastoma patients, EGAS00001003953. Mix of input, H3K27ac, H3K27me1, H3K27me3, H3K36me3, H3K4me1, H3K4me3, H3K9me3 and BRD, 20 human samples, 2 cell lines (LN229, ZH487).

  Dataset EGAD00001006548

• Chromatin accessibility in human monocyte differentiation

  This dataset consists of ATAC-seq data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 26 samples.

  Dataset EGAD00001006601

• Transcription factor binding in human monocyte differentiation

  This dataset consists of ChIP-seq data data from human monocytes, monocyte-derived dendritic cells as well as monocyte-derived cells that were subjected to mRNA transfection for PU.1, IRF4, and EGR2. In total, it the data set includes 18 samples.

  Dataset EGAD00001006602

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Leiomyosarcoma RNA-Seq

  RNA was extracted from fresh frozen LMS material for 29 untreated tumors (24 primary tumors, 5 metastatic12 relapses) and 13 tumors treated with radiation(7 primaries, 6 metastatic relapses). RNA-Seq sequencing was performed using established protocols on Illumina HiSeq 2500

  Dataset EGAD00001006628

• High-throughput sequencing data for study of molecular drivers of resistance to castration in localised prostate cancer

  Aligned whole-genome sequencing and RNA-seq of localised prostate cancer for study 'Loss of SNAI2 in prostate cancer correlates with clinical response to androgen deprivation therapy'.

  Dataset EGAD00001006640

• Fecal 16S rRNA gene sequencing

  Human fecal 16S rRNA gene sequencing data from patients treated with combined anti-CTLA-4 and anti-PD-1 immunotherapy for advanced melanoma.

  Dataset EGAD00001006735

• CASCADE Metastatic Melanoma Rapid Autopsy sequencing data

  Sequence data (paired-end FASTQ format) for 209 samples from 73 sample sites, from 7 individuals. Samples include primary melanomas, metastatic tumours and ctDNA

  Dataset EGAD00001006867

• SMRT-seq

  In this study, we enhanced 5mC detection using SMRT sequencing by holistically analyzing kinetic signals of a DNA polymerase and sequence context for every base within a measurement window. We employed a convolutional neural network to train a methylation classification model.

  Dataset EGAD00001006875

• Prognostic markers of DNA methylation and NGS sequencing in progressive glioblastoma from the EORTC-26101 trial

  These dataset contains NGS data from 380 samples from the EORTC-26101 clinical trial for patients with progressive glioblastoma.

  Study EGAS00001007421

• MDS primary and xenografted samples

  This dataset contains bam files mapped to hg19 that either were primary bone marrow cells or sorted human cells after long term engraftment in NSG mice.

  Dataset EGAD00001007760

• Human placenta microRNA sequencing dataset

  Human placenta samples from 52: 5 first trimester , 7 second trimester, and 40 term placenta. Data is uploaded as BAM files.

  Dataset EGAD00001007766

• Ampliseq library database

  This database contains 46 samples for early stage ovarian high grade serous carcinoma project. Amplicon sequencing on 37 tumour samples from early stage ovarian high grade serous carcinoma as well as 5 adjacent normal tissue samples and 4 whole blood samples.

  Dataset EGAD00001008587

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• TCRab sequencing of T-LGLL patients

  TCRab sequencing was performed on viably frozen cells from 11 T-LGLL samples from 9 T-LGLL patients and 6 age-matched healthy samples. The raw data is available as fastq files.

  Dataset EGAD00001008691

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700