12405 results for ""non-traditional+communal+storytelling+approach"+novel+segment+noted+in+critical+commentary"

in 49.13 milliseconds.

• Exome sequencing of DNA from pituitary neuroendocrine tumor (PitNET) and germline DNA from the same patient

  The goal of the project is to study tumor - normal DNA pairs from the PitNET patients. Total of 15 PitNET patients were recruited for the study to investigate sometic changes in the tumor compared to normal tissue. Illumina technology were used for sequencing and two data analysis pipelines employed for data analysis. Recurrent somatic variations were investigated and genomic disruption analysis from exome sequencing data attempted.

  Study EGAS00001004654

• Whole genome sequencing of patients affected by acute intermittent porphyria

  Acute intermittent porphyria (AIP) is an hereditary rare metabolic disorder of incomplete penetrance, affecting the biosynthesis of heme. IAP is an autosomal dominant disorder, resulting in a substantial reduction of the activity of the hydroxymethylbilane synthase coding gene (HMBS). Most HMBS mutation carriers are asymptomatic and only between 10% and 20% of patients present acute attacks of the associated symptoms. Here, we sequenced whole genomes of 16 AIP patients.

  Study EGAS00001004999

• scRNA_seq_of_circulatory_immune_cells_from_Crohn_s_disease_patient_blood

  Whole blood from Crohn's disease patients with active inflammation in the terminal ileum was depleted of red blood cells and partially depleted of granulocytes before single cell sequencing using 10X genomics 3'v3 kit followed by Illumina sequencing (HS4000 and NovaSeq) This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001004150

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• Genes___Health_imputed_genotype_dataset

  Genes & Health is a cohort of British Bangladeshi and British Pakistani individuals. In the Feb2020 data freeze, 28,022 individuals were genotyped on the Illumina Infinium Global Screening Array v3 chip (with the additional Multi-Disease variants). Imputation was performed using the Michigan Imputation Server with the GenomeAsia pilot reference panel, which contains 1,739 genomes and 642 from them are from South Asian groups. This dataset contains imputed SNPs with imputation accuracy >0.3 and MAF >0.1%.

  Study EGAS00001005373

• Targeted sequencing of paired tumour/blood of 34 T1 stage bladder cancer patients

  Stage T1 bladder cancer presents a high risk of progression and requires improved understanding. In continuation of our whole-exome sequencing study on this subtype of the disease, we carried out this targeted paired tumour/blood sequencing study including 34 T1 stage bladder cancer patients. Agilent’s SureDesign tool was used to design a 1.133 Mb SureSelect custom capture for all coding exons of the 140 selected candidate genes.

  Study EGAS00001005767

• BCR_repertoire_sequencing

  Isotype-specific B-cell receptor repertoire sequencing in six immune-mediated diseases at diagnosis and during therapy reveals an unexpectedly complex B-cell architecture, which may provide a platform for a better understanding of pathological mechanisms and treatment responses. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001003185

• Single-cell RNA sequencing of 6 follicular lymphoma tumors

  Follicular lymphoma (FL) is an indolent cancer of mature B-cells but carries increased risk of transformation to a more aggressive histology over time. We present here comprehensive profiling both tumor and immune compartments in 6 diagnostic FL biopsies by single-cell RNA sequencing. This confirmed results from 155 FL tumors characterized by mass cytometry (CyTOF) which revealed two distinct evolutionary trajectories with disparate risk of transformation and alternate biologies.

  Study EGAS00001005257

• UROMOL 2020 - SNP data

  The molecular landscape in non-muscle-invasive bladder cancer (NMIBC) is characterized by large biological heterogeneity with variable clinical outcomes. Here, we performed a large integrative multi-omics analysis of patients diagnosed with NMIBC (n=834). Transcriptomic analysis identifies four classes (1, 2a, 2b and 3) reflecting tumor biology and disease aggressiveness. Both transcriptome-based subtyping and the level of chromosomal instability provide independent prognostic value beyond established prognostic clinicopathological parameters.

  Study EGAS00001004862

• EXCEED Study

  EXCEED is a longitudinal population-based cohort which facilitates investigation of genetic, environmental and lifestyle-related determinants of a broad range of diseases and of multiple morbidity through data collected at baseline and via electronic healthcare record linkage. Recruitment has taken place in Leicester, Leicestershire and Rutland since 2013 and is ongoing, with approximately 10,000 participants aged 30-69 to date. The population of Leicester is diverse and additional recruitment from the local South Asian community is ongoing.

  Study EGAS00001003499

• Hereditary_Cerebellar_Ataxias___Whole_Genome_Sequencing___2021

  Looking to identify mutations in order to validate that lines we have classified as from Ataxia patients contain the disease relevant mutations. This will allow us to publish on the existance of these lines which are now commercially avalable. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001006234

• Whole blood transcriptomic analysis of ANCA-associated vasculitis

  Whole blood mRNA sequencing from 30 patients with AAV (granulomatosis with polyangiitis/GPA, n=22) and microscopic polyangiitis (MPA, n=8) combined with functional enrichment and network analysis for aberrant pathways. Key genes and pathways were validated in an independent cohort of 18 AAV patients. Co-expression network and hierarchical clustering analysis, identified molecular endotypes. Multi-level transcriptional overlap analysis to SLE was based on our published data from 142 patients.

  Study EGAS00001006704

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  We investigated 10 female and 14 male SARS-CoV-2 positive children (age range: 0.8 to 18 years). Based on the WHO guidelines, 15 patients were classified as having mild COVID-19, while 7 children were classified as moderate COVID-19 cases. Two children were asymptomatic. 8 female and 10 male SARS-CoV-2 negative children were included as controls (age range: 4 to 16). 12 SARS-CoV-2 positive female and 9 male adults were included ( age range: 27 - 76) together with 13 female and 10 male SARS-CoV-2 negative adult controls (age: 24 - 77). 10 adult COVID-19 patients had mild disease, while 12 had moderate COVID-19. We performed single-cell RNA sequencing experiments.

  Dataset EGAD00001007969

• RNA-seq of non-LPS treated (N), non-tolerized (NT), and tolerized (T) IFNg-primed macrophages pretreated with or without HDAC3i

  In this experiment we investigated the effect of HDAC3 inhibition on the transcriptome of IFNg-primed macrophages under different tolerization conditions. Peripheral blood mononuclear cells (PBMCs) were isolated from 3 healthy donors. PBMCs were isolated from whole blood of healthy donors using Ficoll gradient (Invitrogen). Monocytes (CD14+ cells) were positively selected from PBMCs using CD14 Microbeads according to the manufacturer’s instructions (Miltenyi Biotec). Monocytes were subsequently treated with or without 500 nM HDAC3i (ITF3100) for 30 minutes prior to overnight IFNg priming (50 ng/mL). Cells were then kept without LPS (non-LPS; N), treated with 10 ng/mL LPS once (non-tolerized; NT), or treated with LPS twice (tolerized; T; second LPS concentration: 100 ng/mL). In total, there were 18 samples included.

  Dataset EGAD00001005959

• Variant calls for "Quality of Whole Genome Sequencing from Blood versus Saliva Derived DNA in Cardiac Patients"

  Paired blood and saliva samples from five unrelated individuals were directly compared for quality of whole genome sequencing. Two (Sample Pairs 1 and 2) were female probands diagnosed with tetralogy of Fallot, a type of congenital heart disease, and three (Sample Pairs 3, 4 and 5) were male probands diagnosed with hypertrophic cardiomyopathy. WGS was performed using Illumina HiSeq X to a target average coverage depth of 30x and a read length of 150 bp. The resulting reads were not filtered for minimum quality in order to avoid losing possible contaminant reads. Sequencing read alignment was done using Isaac Aligner to human genome build hg19. Short variant i.e. single-nucleotide variant (SNV) and small insertion-deletion (indel) calling was performed using Isaac Variant Caller with default parameters.

  Dataset EGAD00001005772

• Single cell transcriptomic data of human gut macrophages

  Cellular suspensions (∼15000 cells, with expected recovery of ∼7500 cells) of sorted CD45+ HLA-DR+ CD14+ macrophages from colonic mucosa and muscularis propria were loaded on the 10X Chromium Controller instrument (10X Genomics) according to the manufacturer’s protocol using the 10X GEMCode proprietary technology. All samples from individual patients were loaded in one batch. The Chromium Single Cell 3´ v2 Reagent kit (10X Genomics) was used to generate the cDNA and prepare the libraries, according to the manufacturer’s protocol. The libraries were then equimolarly pooled and sequenced on an Illumina NextSeq500 using HighOutput flow cells v2.5. A coverage of 400M reads per sample was targeted, in order to obtain 50 000 reads per cell. The raw data were then demultiplexed and processed with the Cell Ranger software (10X Genomics) v2.1.1.

  Dataset EGAD00001007765

• Identification of immune mechanisms associated with the high rate of relapse in patient with visceral leishmaniasis and HIV co-infection

  RNA-seq transcriptomics of whole blood samples from longitudinal follow-up of a cohort of visceral leishmaniasis (VL) patients with and without HIV coinfection, from active disease through apparent cure and potential relapse. Analysis will identify potential correlates of relapse to identify immune mechanisms underlying the high rate of relapse in HIV/VL coinfection. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ .

  Dataset EGAD00001008361

• WGS and Avenio Surveillance Panel data to previously submitted data under study number EGAS00001004276 of ALK-rearranged lung cancer

  Some data was previously submitted data under study number EGAS00001004276. In this new dataset we provide additional WGS and Avenio Surveillance Panel data. We utilized 43 ALK+ NSCLC patients receiving targeted ALK therapy to evaluate ctDNA levels based on matched panel-based targeted next generation sequencing (tNGS) and untargeted shallow whole genome sequencing (sWGS). For the Avenio panel the sequencing was done on Illumina NextSeq 550 paired end 150 bp, for WGS the sequencing was done on Illumina HiSeq 4000, partly with KAPA_Hyper_Prep_Kit. In this dataset there are 132 WGS tumor samples and 134 panel sequencing data of plasma.

  Dataset EGAD00001007818

• Single nuclei sequencing of early, late-term, and early-onset pre-eclamptic decidua and villi.

  Hypertensive disorders in pregnancy, of which the multisystem syndrome pre-eclampsia is the most severe, leading to preterm delivery, maternal mortality, and life-long complications. To elucidate early disease dynamics, we present the first spatio-temporal study comparing single-nuclei transcriptomes of human preterm pre-eclamptic placentae and healthy controls, contextualizing this in a comprehensive study including early and late gestational placentae. This study includes early placentae samples from the fetal part (villi; n=10), maternal part (Decidua; n=3), late placentae samples from healthy pregnancies, villi (n=6), decidua (n=4), and late placentae samples from early-onset preeclamptic pregnancies, villi (n=5) and decidua (n=5).

  Dataset EGAD00001008273

• Disease specific alterations in the olfactory mucosa of patients with Alzheimer’s disease

  The sample AD_Library_1, AD_Library_2 and Control_Library were run on a Chromium Chip B with the Chromium Single Cell 3′ Library & Gel Bead Kit v3 kit (10x Genomics, CA, USA) . The 3’ gene expression libraries were sequenced at an approximate depth of 50,000 reads per cell using the NovaSeq 6000 S1 (Illumina, San Diego, CA, USA) flow cells. Cell Ranger v.3.0.2 was used to analyze the raw base call files. FASTQ files and raw gene-barcode matrices were generated and aligned human genome GRCh37 (hg19). The samples were integrated in R v.4.0.3 and generated Seurat objects, two related to AD samples and one to control samples, were analyzed using the Seurat package v.4.0.3 to perform downstream analysis, clustering of the cells and differential expression.

  Dataset EGAD00001008560

• Genomic Evolution of Breast Cancer Metastasis and Relapse

  Recurrent breast cancer is almost universally fatal. We characterize 170 patients locally relapsed or distant metastatic cancers using massively parallel sequencing. We identify that the relapse-seeding clone disseminates late from the primary tumor. TP53 and AKT1 appear to be enriched in ER-positive cancers predisposed to relapse. Mutation acquisition continues at relapse as the same mutation signatures continue to operate and new signatures, such as that caused by radiotherapy appear de novo. In 49% of cases we identify drivers mutations private to the relapse and these are sampled from a wider range of cancer genes, including SWI-SNF complex and JAK-STAT signaling.

  Dataset EGAD00001002696

• Myeloma Genome Project Targeted Sequencing Panel - Oxford Data

  This dataset comprises the BAM files from targeted genome sequencing of CD138+ selected myeloma tumour samples from 21 individuals. In 5 cases there is only one tumour sample, but in the other 16 cases there are sequential samples, spanning treatment relapses. There are denoted Tumor A, B C etc. Therefore there are a total of 48 myeloma tumour samples. For each individual there is also a germline control samples, obtained either from peripheral blood or from CD138-selected bone marrow cells.

  Dataset EGAD00001008735

• WGS/WES analysis refines molecular subtypes of hepatocellular carcinoma

  This work aims to identify homogeneous and robust molecular subtypes in HCC based on a large, homogenous and well-annotated cohort. We performed whole genome/exome sequencing (WGS/WES) on 529 HCC from 461 patients collected mainly in France. Based on the genomic data, we identified 9 robust HCC subtypes primarily driven by key mutations. We further characterized these subtypes using genomic and clinicopathological features. Among the 9 subtypes, 5 belonged to chromosome instable tumors, while 3 belonged to chromosome stable tumors. Our subtypes were associated with prognosis and showed distinct distributions across features like etiology and gender. This study offers a comprehensive molecular classification of HCC, enhancing our understanding of hepatocarcinogenesis and supporting the development of genome-based precision medicine for liver cancer.

  Dataset EGAD00001015428

• MultiOMICS study of a pair of infant monozygotic twins with concordant B-cell ALL (WGS)

  B-cell acute lymphoblastic leukemia (B-cell ALL) is the most common cancer in childhood. Studying identical twins with B-cell ALL provides a unique and tractable model for deciphering the developmental timing of pre- and post-natal mutations contributing to clonal evolution. To date, this has mainly focused on major cytogenetic subgroups of childhood B-cell ALL, including MLL fusions, ETV6-RUNX1, hyperdiploidy, and BCR-ABL1. However, formal demonstration of the prenatal origin and “backtracking” the natural history of the leukemia remains understudied in “B-other”/Normal Karyotype (NK) B-cell ALL. To characterize the genetic landscape of this particular leukemia subtype, we performed whole genome DNA- and B-cell receptor (BCR)- on a pair of 8-month-old monozygotic twins diagnosed with concordant “B-other”/NK B-cell ALL.

  Dataset EGAD00001005017

• Genomic characterisation of SDH deficient renal cell carcinoma - WGS

  SDH deficient renal cell carcinomas are a rare and recently defined subtype of kidney cancer, often associated with an inherited mutation in one of the SDH gene subunits. This dataset sought to understand the genomic events that underpin tumour formation, from putative cell of origin, characterisation of the tumour microenvironment, to the genomic evolution of these rare tumours. We performed whole genome and RNA sequencing of 4 patients with SDH deficient renal cell carcinomas, including one patient who had an additional paraganglioma. An addition patient in this cohort had the initial diagnosis revised to a clear cell renal cell carcinoma.

  Dataset EGAD00001008469

• RNAseq data of polyA+ RNA from Leukocytes from 624 individuals of the ProgeNIA cohort.

  We sequenced the polyA+ fraction of the RNA of the leukocytes from 624 sardinian individuals with RNAseq. Prior to library preparation we added either ERCC ExFold RNA Spike-In. An average of 60M reads per samples with 51 bp paired-end reads were generated on a HiSeq 2000 (Illumina). Sequencing reads were then aligned using STAR-2.2.0c2 to the h37d5 reference genome supplemented with the ERCC spike-ins sequences. We further provided an exon-exon junction database that we generated from the GENCODE v14 annotation. In order to remove a contamination from a parallel experiment, we discarded any reads that mapped to the genomic regions of CBLB (chr3:105370773-105592330) and BCL11A (chr2:60672555-60784156). Filtered aligned reads (bam format) are shared.

  Dataset EGAD00001003102

• Variant calling analysis of cfDNA whole exome sequencing in neuroblastoma

  This dataset contains VCF files from a variant calling analysis of 19 neuroblastoma patients. WES or WGS data of the primary tumor were compared to WES cfDNA analysis at the time of diagnosis and at a 2nd timepoint (complete remission, partial remission, disease progression or relapse). For 4 patients, WGS of germline, tumor at diagnosis and tumor at relapse DNA was performed on Illumina HiSeq2500, with 100-bp paired-end reads. For the other patients, WES was performed using either an AgilentSureSelect Human All Exon v5 or a Roche Nimblegen SeqCap EZ Exome V3 kit on Illumina HiSeq2000, with 100-bp paired-end reads. SNVs observed in any of the primary tumors or cfDNA samples studied by WES were targeted using a capture sequencing panel at all intermediate time points.

  Dataset EGAD00001003803

• Shallow whole genome sequencing

  This dataset contains a collection of tumour samples from high grade serous ovarian carcinoma patients with recurrent disease collected near the point of diagnosis as well as tumour samples collected after patient relapse upon or some time after study entry. The majority of diagnosis samples were preserved in neutral buffered formalin whereas the majority of post-relapse samples were preserved in universal molecular fixative (UMFIX, Sakura Finetek USA, Inc). DNA was extracted and whole genome sequencing libraries were prepared either using the TruSeq DNA Nano kit (Illumina) or the ThruPLEX DNA-Seq Kit (Takara Bio), which were respectively sequenced at low depth (~0.1-0.5X) on illumina HiSeq 2500 and HiSeq 4000 sequencing platforms. Sequenced reads were aligned to the GRCh37 reference genome (release hs37d5).

  Dataset EGAD00001011049

• single-cell RNA-seq Case-Control study of children progressing to Type1 diabetes

  It was a single-cell RNA sequencing study on the PBMC samples from four Finnish children at risk of developing Type 1 diabetes and their gender age and HLA matched control children. All four Case children were positive for multiple islet specific autoantibodies and two of them also progressed to clinical disease during the follow up whereas the control children remain negative for all autoantibodies. Single-cell analysis confirmed some of the signatures obtained from the bulk data. It identified that high IL32 in case samples in the bulk RNA-seq was contributed mainly by activated T cells and NK cells. Trajectory analysis of the scRNA-seq data suggested that IL32 expression increased as the T cells moved towards activated state.

  Dataset EGAD00001005768

• A non-canonical lymphoblast in refractory childhood T cell leukaemia

  Refractory cancers may arise either through the acquisition of resistance mechanisms by cancer cells or represent distinct diseases. The origin of childhood T-cell acute lymphoblastic leukaemia (T-ALL) that does not respond to initial treatment, i.e. refractory disease, is unknown. Refractory T-ALL carries a poor prognosis and cannot be predicted at diagnosis. Here, we performed single cell mRNA sequencing of T-ALL from children who did or did not respond to initial treatment. We identified a transcriptionally distinctive blast population, exhibiting features of innate-like lymphocytes, as the major source of refractory disease. Evidence of such blasts at diagnosis heralded refractory disease across independent datasets and was associated with survival in a large, contemporary trial cohort. Our findings portray refractory T-ALL as a distinct disease. They may have immediate clinical utility.

  Dataset EGAD00001015381

• Direct transcriptional consequences of somatic mutation in breast cancer

  The disordered transcriptomes of cancer encompass direct effects of somatic mutation on transcription; co-ordinated secondary alterations in transcriptional pathways; and increased transcriptional noise. To catalogue the rules governing how somatic mutation Overall, 59% of 6980 exonic substitutions were expressed. Compared to other classes, nonsense mutations showed lower expression levels than expected with patterns characteristic of nonsense-mediated decay. 14% of 4234 genomic rearrangements caused transcriptional abnormalities, including exon skips, exon reusage, fusion transcripts and premature poly-adenylation. We found productive, stable transcription from sense-to-antisense gene fusions and gene-to-intergenic rearrangements, suggesting that these mutation classes may drive more transcriptional disruption than previously suspected. Systematic integration of transcriptome with genome data therefore reveals the rules by which transcriptional machinery interprets somatic mutation.

  Dataset EGAD00001002236

• Massive parallel RNA sequencing of highly purified mesenchymal cells derived from bone marrow specimens of 10 healthy donors

  Highly purified mesenchymal cells (CD45-/7AAD-/CD235a-/CD31-/CD271+/CD105+) were prospectively FACS-isolated from bone marrow specimens of 10 healthy donors (HDs). This data set is used as a baseline control to observe the differences between gene expression profiles (GEPs) of pre-leukemia cases (45 low-risk myelodysplastic syndrome, 4 Shwachman-Diamond and 3 Diamond-Blackfan anemia patients) and gene expression patterns observed in a normal, healthy context. Through differential expression and gene set enrichment analysis we determined that inflammatory signaling pathways are significantly more active in mesenchymal cells of pre-leukemia cases compared to their healthy counterparts. Finally, we determined through statistical modelling of healthy donor's GEPs which pre-leukemia cases have significantly more active inflammatory signaling and demonstrated a strong relation to survival statistics.

  Dataset EGAD00001002659

• MultiOMICS study of a pair of infant monozygotic twins with concordant B-cell ALL (WGBS)

  B-cell acute lymphoblastic leukemia (B-cell ALL) is the most common cancer in childhood. Studying identical twins with B-cell ALL provides a unique and tractable model for deciphering the developmental timing of pre- and post-natal mutations contributing to clonal evolution. To date, this has mainly focused on major cytogenetic subgroups of childhood B-cell ALL, including MLL fusions, ETV6-RUNX1, hyperdiploidy, and BCR-ABL1. However, formal demonstration of the prenatal origin and “backtracking” the natural history of the leukemia remains understudied in “B-other”/Normal Karyotype (NK) B-cell ALL. To characterize the epigenetic landscape of this particular leukemia subtype, we performed DNA bisulfite-sequencing on a pair of 8-month-old monozygotic twins diagnosed with concordant “B-other”/NK B-cell ALL.

  Dataset EGAD00001005018

• Shot-gun stool metagenomics and colorectal cancer risk.

  This study aims to identify metagenomics biomarkers in colorectal cancer (CRC). The study includes 156 samples of shot-gun stool metagenomics, corresponding to 51 patients with CRC, 54 patients with high-risk adenoma, and 51 healthy controls. The sequencing libraries were prepared with 2 µg of total DNA using the Nextera XT DN Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing was performed at 150 nucleotides, paired-end, using an Illumina HiSeq 4000 platform.

  Study EGAS00001007025

• sWGS of Pap test smears from healthy donors and HGSOC patients and matched tumor tissue

  Shallow whole genome sequencing was performed on Pap test smears considering at least 10 M reads per sample. The cohort consists of 77 samples from healthy women, i.e. no tumor diagnosis, and 65 samples from women with a diagnosis of high-grade serous ovarian cancer (HGSOC) taken months or years before diagnosis. 44 primary tumor samples matched to the respective HGSOC patients were sequenced in the same manner as the Pap test smears.

  Study EGAS00001007084

• The genomic landscape of recurrent ovarian high grade serous carcinoma: the BriTROC-1 study

  The BriTROC-1 study, spanning 15 centres across the United Kingdom, is a prospective observational project investigating putative causes of relapse in high-grade serous carcinoma (HGSC). Potential genomic changes associated with disease recurrence are examined by studying paired tumour samples collected from patients at diagnosis and after relapse after receiving platinum based chemotherapy. Shallow whole genome sequencing and targeted amplicon sequencing are used to identify copy number aberrations and short variants respectively.

  Study EGAS00001007292

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• Genome-wide DNA Methylation Data from Illumina HumanMethylationEPIC arrays for whole blood samples from 403 healthy individuals

  Genome-wide DNA Methylation Data from Illumina HumanMethylationEPIC arrays for whole blood samples from 403 healthy individuals. Additional associated phenotype information is available for all individuals included in this study directly from CIBMTR. Data are available under controlled access release upon reasonable request and execution of a data use agreement. Requests should be submitted to CIBMTR at info-request@mcw.edu and include the study reference IB17-04.

  Study EGAS00001006033

• The Gut Microbiome of liver transplant recipients – Cross-sectional + Longitudinal (renal and liver)

  TransplantLines is designed as a single-center, prospective cohort study and biobank including all different types of solid organ transplant recipients as well as living organ donors. In the TransplantLines gut microbiome study the gut microbiome of solid organ transplant recipients is characterized and linked to clinical phenotypes. This batch contains the cross-sectional data from liver transplant recipients and longitudinal data from renal and liver transplant recipients.

  Study EGAS00001006258

• A Phase I/II Trial of Sirolimus (Rapamune®) and Cyclosporine in Patients with Refractory Aplastic Anemia

  The most successful treatment for aplastic anemia is bone marrow transplantation. However, few patients are eligible for this procedure. For others, treatment usually consists of immunosuppressive agents, such as antithymocyte globulin (ATG) and cyclosporine. Unfortunately, even with immunosuppressive therapy, relapse is common. New combinations of medications may offer alternative and more effective treatment options. Sirolimus and cyclosporine are two drugs routinely used to suppress the immune system and prevent rejection in patients who have received organ transplants. While cyclosporine has been proven effective for treating aplastic anemia, sirolimus has not been tested for this disease. This study will evaluate the safety and efficacy of sirolimus in combination with cyclosporine for treating individuals with aplastic anemia that have not responded to other treatments. This study will last at least 6 months. Participants will first be screened to verify diagnosis of aplastic anemia. The screening will include a physical examination, blood test, bone marrow biopsy from the pelvic bone, and review of medications and medical history. Individuals who are eligible will then start the first treatment period. Participants will receive two medications: cyclosporine will be taken twice a day and sirolimus will be taken once a day. Depending on side effects, the dose of either drug may be temporarily stopped or lowered. On Day 1, blood will be drawn and females will undergo a pregnancy test. Subsequent study visits will occur weekly for the first month, every 2 weeks for 2 months, and then once a month for the remainder of the study. Each visit will include a physical examination, vital sign assessment, and review of side effects and medications. Blood tests will be performed weekly for the first 3 weeks, and then every 2 weeks. After 6 months of treatment, if a participant has shown improvements in disease status without major side effects, the treatment will continue. Over time the doses may be lowered. If a participant has not improved while on the study medication, treatment will stop at 6 months. Whenever treatment is discontinued, the participant will again undergo a physical examination, blood tests, and bone marrow biopsy.

  Study phs000695

• Discovering the Genetic Basis of Human Neuroblastoma: A Gabriella Miller Kids First Pediatric Research Program (Kids First) Project

  The Gabriella Miller Kids First Pediatric Research Program (Kids First) is a trans-NIH effort initiated in response to the 2014 Gabriella Miller Kids First Research Act and supported by the NIH Common Fund. This program focuses on gene discovery in pediatric cancers and structural birth defects and the development of the Gabriella Miller Kids First Pediatric Data Resource (Kids First Data Resource). All of the WGS and phenotypic data from this study are accessible through dbGaP and kidsfirstdrc.org, where other Kids First datasets can also be accessed. Children with disseminated neuroblastoma have a very high risk of treatment failure and death despite receiving intensified chemotherapy, radiation therapy and immunotherapy. The long-term goal of our research program is to ultimately improve neuroblastoma cure rates by first comprehensively defining the genetic basis of the disease. The central hypothesis to be tested here is that neuroblastoma arises largely due to the epistatic interaction of common and rare heritable DNA variation. Here we will perform a comprehensive whole genome sequencing of 563 quartets of neuroblastoma patient germline and diagnostic tumor DNAs and germline DNAs from both parents. The case series was recently collected through a Children's Oncology Group epidemiology clinical trial and is robustly annotated with complete demographic (age, sex, race, ethnicity), clinical (e.g. age at diagnosis, stage, risk group), epidemiologic (parental dietary and exposure questionnaire) and biological (e.g. tumor MYCN status and multiple other tumor genomic measures) co-variates. Subjects were consented for genetic research and DNA is immediately available for shipment for sequencing. We propose Illumina-based whole genome sequencing in the 593 "trio" germline samples (Aim 1; due to missing parent: 487 full neuroblastoma triads, 106 child-single parent dyads = 1673 whole genome sequences) and matched diagnostic tumor DNA (Aim 2; N=366) at 30x sequencing depth (N=2039 whole genome sequences). Also in Aim 2 we will perform whole exome (100x) and RNA sequencing on the 366 tumor DNA and 228 tumor RNA samples from this cohort. Finally, we propose a pilot study of structural variation using long-range sequencing in 10 non-overlapping tumor samples chosen based on potentially relevant chromosomal alterations discovered with conventional NGS. Thus, a total of 2277 individual samples and 2655 sequences will be generated. We will use our established analytic pipeline that is currently being used to study the germline genomes of all cases sequenced through the NCI supported Therapeutically Applicable Research to Generate Effective Treatments program. We plan a three-stage analytic approach, first focusing on classic de novo and inherited Mendelian damaging alterations. We will next integrate our extensive epigenomic data from human neuroblastoma cell lines and genome-wide association study data (N=5,703 neuroblastoma cases to date) to guide a comprehensive assessment of noncoding variants that influence tumor initiation with a recently established analytic pipeline. Finally, we will utilize the tumor DNA analyses to inform relevance via somatic gain or loss of function effects at the sequence and/or copy number levels. All data generated in this project will be immediately placed into the Genomic Data Commons (GDC) and we will compute within this environment by importing our analytic pipelines into the GDC. These data will be fully integrated into the Kids First Data Resource and freely shared with all academically qualified petitioners. This comprehensive data set derived from a large and richly phenotyped series of neuroblastoma DNA quartets will be integrated with existing germline and/or tumor genomic data from over 6,000 neuroblastoma subjects (but none with matched patient-parent germline sequencing data) to provide an unparalleled opportunity to comprehensively discover the genetic basis of neuroblastoma.

  Study phs001436

• How to use EGA Webin?

  EGA Webin EGA Webin serves as a platform for registering metadata for array based submissions, large scale sequence submission as well as for legacy EGA submission accounts (ega-box-XXXX). For large scale submitters of sequence data you have also the option to submit metadata via XMLS programmatic submission, while new submitters are advised to utilise the Submitter Portal for their submissions. You can request a legacy EGA submission account (ega-box-XXXX) by populating this form. Please, allow two business days for our Helpdesk team to contact you after populating this form. WEBIN actions: Register metadata for a sequence submission Register study, samples, experiments, runs, DAC, policy and dataset/s after file upload. Register components for your array-based metadata submission Register study, samples, DAC or policy before uploading files. Edit existing submission metadata Change or update previously submitted metadata. Register metadata for a sequence submission Ensure that all sequence files have been encrypted before uploading them to your submission account using the EgaCryptor. Go to the EGA Webin and log in using your submission account name (ega-box-XXX) and password. Register components of your metadata submission Study Samples Data Access Committee (DAC) Data access policy Dataset For array-base submissions: Study, Samples, Data Access Committee (DAC) and Data access policy may all be registered BEFORE file upload and dataset registration through the array-base template. Register your Study Go to the “Studies (Projects)” box Click on “Register Study” and fill in the information related to your study. Click on “Submit”, this will save the information and generate an EGA study ID. To use the study accession number in a publication, the study has to be previously released on the EGA website, we suggest the following format: "Sequence data has been deposited at the European Genome-phenome Archive (EGA), which is hosted by the EBI and the CRG, under accession number EGASXXXXXXXXXXX.Further information about EGA can be found on https://ega-archive.org and “The European Genome-phenome Archive in 202 "(10.1093/nar/gkab1059)" Register your Samples Go to the “Samples” box Click on “Register Samples” Select “Download spreadsheet to register samples” and customise your template, there is a default EGA template (EGA default checklist) but more attributes can be added if required. For the EGA default checklist, there are mandatory,recommended and optional attributes. As well custom fields which can be added if required. Mandatory attributes Field Name Description tax_id Taxonomy ID of the organism as in the NCBI Taxonomy database. Entries in the NCBI Taxonomy database have integer taxon IDs. See our tips for sample taxonomy here scientific_name Scientific name of the organism as in the NCBI Taxonomy database. Scientific names typically follow the binomial nomenclature. For example, the scientific name for humans is Homo sapiens. sample_alias Unique name of the sample. If not selected system will auto generate an unique alias sample_title Title of the sample sample_description Description of the sample phenotype *** Where possible, please use the Experimental Factor Ontology (EFO) to describe your phenotypes. Recommended attributes Field Name Description subject_id Identifier for the subject where the sample has been derived from gender * Sex Optional attributes Field Name Description sex sex of the organism from which the sample was obtained disease_site Affected organ sample type Affected organ donor_id ** Identifier of the donor where the sample has been derived from *Gender should be described as 'male', 'female' or 'unknown'. If 'unknown' due to a known sex chromosome aneuploidy, please create a user defined attribute called 'Sex chromosome karyotype' and add the appropriate value, for example, 'XXY'. **Donor id (Subject id) should be a de-identified subject handle. If unknown, please add 'unknown' to the field. ***Phenotypes should, where possible, be an Experimental Factor Ontology accession. If a term cannot be found to describe your phenotype please use free text. All sample phenotypes considered important for further analysis of the data should be provided (for example, tumour type), additional phenotype attributes can be created by defining your own attributes; use the notion 'phenotype2', 'phenotype3', etc. After you have customised the fields for the sample submission, download the template and fill in the information. Example of the sample template: Finally upload the sample template to get the EGA accession IDs for the samples. Register your Data Access Committee (DAC) Further information on the role of your DAC Go to the “Data Access” box Click on “Register Dacs” Input the information about the DAC and register at least one main DAC contact. Register your Data Access Policy Your Data Access Policy provides the terms and conditions of data use, this is also referred to as the Data Access Agreement (DAA). Completion of a DAA by the applicant/s should form part of the application process to the Data Access Committee (DAC). Go to the “Data Access” box Click on “Register Policies” Select the DAC to which this policy will be linked to and fill in the policy information. Submitting your Runs and Analyses This section is only for sequence data submission, for array-based submission it can be skipped. Please refer to our Submitting array based metadata Runs Registration Go to the “Raw Reads (Experiments and Runs)” box Click on “Submit Reads” Select “Download spreadsheet template for Read submission” Select the template corresponding to your submission type For the templates you have the option to customise the optional fields. To check their description click on “Show Description “ Download the template and fill in the required information. Example of the runs template: We recommend that Fastq, BAM, and CRAM read files are submitted using Webin-CLI When using this interface instead of Webin-CLI, raw sequences must be uploaded in one of the supported data formats before they can be submitted. The files can be uploaded using FTP or Aspera. The study and the sequenced samples must be pre-registered before the raw reads are submitted. Please note that each individual study and sample should be registered only once. You will be asked to provide information about the sequencing libraries and instruments. Submitting your Dataset This section is only for sequence data submissions, for array based submissions it can be skipped. Please refer to our Submitting array based metadata The dataset describes the data files, defined by the run (EGARXXXXXXXXXXX) and analysis (EGAZXXXXXXXXXXX) accessions that make up the dataset and links the collection of data files to a specified Data Access Committee and Data Access Policy. As a result, you must have registered your Reads and experiments, Data Access Committee (DAC) and Data access policy before submitting your Dataset. Please consider the number of datasets that your submission consists of, for example, a case control study is likely to consist of at least two datasets. In addition, we suggest that multiple datasets should be described for studies using the same samples but different sequence technologies. Please contact EGA Helpdesk for further assistance. Go to the “Data Access” box Click on “Register Dataset” Select the Data Access Committee (DAC) and Data access policy Register your dataset After submitting your dataset you should contact the EGA Helpdesk to provide a release date for your dataset. Datasets are automatically held (i.e. not released) unless they are affiliated to a study that has already been released. Edit/update existing submission metadata Go to the “Report” section of the object you would like to edit. Locate the object and click on the arrow under action. An option menu will be displayed. Objects can be edited through their XML or with the WEBIN menu. After an object has been edited, changes would be available on the website until the submission is released again. Please contact the EGA Helpdesk if you require further assistance.

  Documentation submission/metadata/submission/EGA_webin

• Korea Epigenome Project(KEP), Korea National Research Institute of Health(KNIH)

  The KEP was launched in 2012 to produce 50 epigenomic sets on Korean chronic diseases related target cells with the participation on Internationsl Human Epigenome Consortium(IHEC) of which focus is constructing 1000 reference epigenome map on 250 human cell type. The objective of the KEP was to provide a comprehensive epigenomic map of Korean chronic disease-related target tissues. Single cells were isolated from the pancreas, fat and kidney. Islet, ductal, acinar, and beta cells from the pancreas were purified into a single homogenous cell type using flow-assisted cell sorting technique. Adipocytes and pre-adipocytes were purified from fat, using Percoll gradient centrifugation technique. Mesangial, distal tubule, proximal tubule, podocytes, and collecting duct cells from the kidney were collected using mechanical sieving and immunostaining methods. Each cell type was derived from normal tissue or those with diabetes, obesity, or chronic kidney disease. Sixty reference epigenome datasets of pancreatic, fat, kidney cells were produced. Cell types such as the islets, and beta from the pancreas, adipocytes, pre-adipocytes from fat tissue, podocyte, mesangial, tubules from kidney were used for primary target to produce a Korean metabolic reference epigenome. And the bisulfite converted-whole genome sequencing, Infinium 450k DNA methylation bead array, mRNA, miRNA-Sequencing were performed to produce a comprehensive epigenomic map. The aim of roadmap reports is preparation of Long-term and Mid-term Technology Roadmaps for Korean Human Epigenome Project towards a competitive execution of International Epigenome Project and successful expansion of the research outcomes. Roadmap reports reviewed on recent technological development of DNA methylation and histone modification analysis, emerging new trends in epigenome medicine, plans for hardware and software analysis systems aimed to epigenome analysis, medical expert opinion on target cells and isolation scheme, bioinformatics expert opinion on analytical tools, new ideas for a putative epigenome studies, trends in single cell epigenome analysis. In conclusion, roadmap report suggested several projects for the future KNIH epigenome research in collaboration with epigenome research group. These are including refocusing the goals of KNIH-driven research in identification of disease mechanism, development of new studies on GWAS-EWA, higher priority on the epigenomic studies of human primary cells, establishment of collaborative relationship with tissue banking centers, establishment of mapping centers and data analysis portals, establishment of Korean Epigenome Research Consortium, establishment of steering committee governing both research and funding, launching of additional funding for epigenomic researches.

  Study EGAS00001001774

• EGAD00010000628

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000628

• EGAD00010000630

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000630

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• DNAmet

  DNAmet analysis of olfactory mucosa (OM) cells derived from cognitively healthy and individuals with AD exposed to traffic-related ultrafine particles (UFPs) for 72h in submerged cultures. The UFPs used for exposures were: A0 and A20. Exposures were compared to the corresponding blank samples.

  Dataset EGAD50000001531

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• snRNAseq prostate cancer

  single-nucleus RNA seq characterization of human fresh frozen prostate cancer samples and non-malignant controls for the same patients. Biopsies were sectioned in 100 micron thick sections, adjacent to those used for spatial transcriptomics.

  Dataset EGAD50000001633

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267

• Multi-omics characterisation of immune cells in Long Covid

  We generated 10X Multiomics (paired RNA+ATAC) for Long Covid patients with up to 14 months follow-up.

  Study EGAS50000000142

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Nanopore Telomere Sequencing of II.3, II.4, and III.4

  This datasets contains the putative telomeric sequences isolated by TARPON in ubam format after using a Duplex Capture Based Enrichment Protocol for patients II.2, II.4, and III.4.

  Dataset EGAD50000002363

• Triple-negative breast cancer sequencing data

  Single-cell RNA sequencing and spatial transcriptomic sequencing data associated with manuscript 'Ectopic NMDAR expression in cancer unmasks germline-encoded autoimmunity'

  Dataset EGAD50000002266

• Analysis of the lung gene expression profile in COPD

  Samples obtained from patients with COPD and from controls by bronchoscopy from the lung were subjected to RNA seq.

  Study EGAS00001001472

• Therapeutic vulnerabilities in the DNA damage response for the treatment of ATRX mutant neuroblastoma

  Whole genome sequencing of ATRX / TP53 knockdown clones of the neuroblastoma cell line SK-N-SH

  Study EGAS00001004550

• Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina

  Study the sub-continental origins of African, European and Native American genetic ancestries of Argentinean populations.

  Study EGAS00001004492

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Dataset contains Exome-seq and RNA-seq from 2 GBM patients, as well as RNA-seq from the derived cultured cells (GNS).

  Dataset EGAD00001001359

• Exploring the extracellular transcriptome in seminal plasma for non-invasive prostate cancer diagnosis

  mRNA capture sequencing data of 57 seminal plasma samples.

  Dataset EGAD00001007688

• analysis of T cell receptor repertoirs

  Full information about the T cell receptor (CR) variable regions found in the sequences of the vdj region. Columns: barcode is_cell contig_id high_confidence length chain v_gene d_gene j_gene c_gene full_length productive cdr3 cdr3_nt reads umis raw_clonotype_id raw_consensus_id

  Dataset EGAD00001008109

• Dataset for synovial_sarcoma-WHOLE_GENOME

  Rare cancer sequencing data of 6 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008899

• FFPE CPA Accreditation Study

  FFPE CPA accreditation of genome-scale sequencing in routinely collected formalin-fixed paraffin-embedded (FFPE) cancer specimens versus matched fresh-frozen samples using targeted pulldown capture prior to Illumina sequencing.

  Dataset EGAD00001000678

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Biological and Therapeutic Implications of a Unique Subtype of NPM1 Mutated AML (RNAseq Data)

  This dataset contains 91 RNAseq paired reads, in fastq format. Samples were collected from fresh bone marrow and peripheral blood sample from AML patients.

  Dataset EGAD00001006669

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• Epilepsy related sudden death (2019-08-21)

  These samples include exome sequences of samples from patients who suffered Sudden Unexplained Death in Epilepsy. They all are of European descent. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005276

• HSP90 inhibitor resistant K562 cells

  K562 cell line has been treated with two different HSP90 inhibtors. After resistance clones emerged, they have been genetically characterized using WES in comparison to the parental K562 cell line.

  Dataset EGAD00001009051

• Chondromyxoid fibroma

  Chondromxoid fibroma is a benign tumour of bone with unknown underlying pathogenesis. To determine pathognomic genomic event in chondromyxoid fibroma whole genome sequencing will be undertaken to reconstruct rearrangements and find underlying mutations.

  Dataset EGAD00001001063

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Deep Sequencing of somatic cancer mutations

  We enriched a panel of cancer associated genes using the Custom Sure Select Target Enrichment Kit. Identified mutations were validated with deep sequencing in order to assess mutated allele frequencies more accurately.

  Dataset EGAD00001001313

• Single-cell colony targeted DNAseq

  Targeted DNA sequencing was applied to colonies grown from single-cells of patient A.6. The protocol followed is described in https://doi.org/10.1038/s41467-021-21650-1 and the methods of the manuscript

  Dataset EGAD00001010193

• Single-cell RNA-Seq (Chromium Next GEM Single Cell 3' Reagent Kits v3.1 from 10X Genomics )

  Human data for transcriptome (scRNA-Seq) in CD34+ B cell precursors.

  Dataset EGAD00001010907

• scRNA-seq

  This dataset gather scRNAseq data performed for MM.1S cell line in control and dex conditions at 4h and 24h

  Dataset EGAD00001011139

• RNA-seq dataset of CD34+ HSPCs from LRMDS patients

  To profile transcriptional alterations of HSPCs in LR-MDS patients, 7AAD−CD45+Lin-CD235a−CD34+ cells were isolated from healthy donors and LR-MDS patients for RNA sequencing.

  Dataset EGAD00001015771

• Aggressive genomic features in clinically indolent primary HHV8-negative effusion-based lymphoma

  Genomic profiling of effusion-based fluid samples from 8 HHV8-negative effusion-based lymphoma patients.

  Dataset EGAD00001008364

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• NGS based viability screening using haploid cell line

  Identification of human deubiquitylating enzymes whose knock out result in hypersensitivity to DNA damaging agents, by comparing the sequence reads of 'barcode region' from mixed cell culture.

  Dataset EGAD00001001428

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• sWGS for genome-wide copy number profiling

  Shallow whole-genome sequencing (sWGS) data for the identification of somatic copy number alterations (SCNA) and the estimation of tumor fractions in plasma DNA of metastatic colorectal cancer patients (mCRC).

  Dataset EGAD00001006384

• Transcriptome profiling of desmoplastic small round cell tumors (DSRCTs)

  RNA sequencing of frozen resected specimens of desmoplastic small round cell tumors (DSRCTs). Four patients have specimens from multiple tissue sites included in this dataset.

  Dataset EGAD00001006388

• The Chromatin Landscape of Pathogenic Transcriptional Cell States in Rheumatoid Arthritis

  In this study, we characterized 24 rheumatoid arthritis (RA) synovial tissue chromatin classes (i.e., cell states defined by chromatin accessibility) across 5 cell types (T, B/plasma, myeloid, stromal, and endothelial). We also investigated the transcription factors that may regulate these chromatin classes, their connections to transcriptional cell states in a proposed superstate model, and their interplay with RA pathology through associations with histological parameters and risk variants.As part of the Accelerating Medicines Partnership (AMP) network, we obtained 18 synovial tissue samples from 14 RA and 4 osteoarthritis (OA) patients for this study. Samples were collected from 7 clinical sites. We performed a 10x single cell ATAC-seq experiment on each sample.We further collected synovial tissue samples from 11 RA patients and 1 OA patient from 2 clinical sites; each sample was used for a 10x single cell multimodal ATAC and Gene Expression experiment.For additional support of the proposed superstate model, we also collected peripheral blood mononuclear cells (PBMCs) from 4 RA patients, sorted for 4 populations (CD4+CD127-CD25hi Tregs, CD4+CD127-CD25int Tregs, CD4+CD25-PD1+CXCR5- TPH, CD4+CD25-PD1+CXCR5+ TFH), tagged each population with a hashing antibody, and pooled populations for one multimodal sequencing run.The FASTQ files are available for controlled access via dbGaP. Additional data can be found on Synapse.The presence of pooled subjects inflates the automatically-generated subject count; the actual consented subject count for this data is 34.

  Study phs003417

• RNA Transcriptomic and DNA Methylation Landscape in FTLD-TDP and Controls

  Frontotemporal lobar degeneration (FTLD) is one of the leading causes of dementia in individuals younger than 65 years, with the aggregation of TDP-43 as one of the most common forms of FTLD. FTLD-TDP is clinically, genetically and pathologically heterogeneous, with GRN and C9orf72 as the most common genetic forms (although more than 50% of the cases are genetically unexplained), and A, B and C as the most common pathological subtypes. To investigate the molecular differences between the different forms of FTLD-TDP, we performed bulk RNA sequencing (RNAseq) and reduced representation bisulfite sequencing (RRBS) from different brain regions of FTLD-TDP patients and controls. The RNAseq dataset includes samples from the frontal cortex of 149 individuals, comprising 127 FTLD-TDP cases (genetically unexplained types A (27), B (20) and C (22), 24 GRN mutation carriers, and 34 C9orf72 expansion carriers) and 22 controls. The RRBS dataset includes samples from the frontal cortex of 158 individuals —119 FTLD-TDP cases (genetically unexplained types A (25), B (24), and C (25), 20 GRN mutation carriers, and 25 C9orf72 expansion carriers) and 39 controls; and from the cerebellum of 151 individuals —113 FTLD-TDP cases (genetically unexplained types A (24), B (21), and C (23), 20 GRN mutation carriers, and 25 C9orf72 expansion carriers) and 38 controls. In total, the study consists of data from 183 unique individuals, with some overlap across the different datasets.

  Study phs004075

• Space Associated Stem Cell Hallmarks of Aging in Astronauts

  This study examined the effects of the stress of space, specifically low earth orbit, on hematopoietic stem and progenitor cells (HSPCs) that maintain lifelong hematopoiesis and immune responses. Enriched CD34+ HSPCs were derived from 7 astronauts before, during and after 10 and 21-day ISS missions on the International Space Station. The samples were used as input to whole transcriptome sequencing by bulk RNA-Seq performed at The Scripps Research Institute Next Generation Sequencing Core on Illumina NextSeq 2000 sequencer and single cell RNA-Seq performed at The Salk Institute for Biological Studies on Illumina NovaSeq X Plus sequencer. Subsequent expression, RNA editing, and retrotransposon analyses were performed to assess HSPC and immune subpopulation survival dynamics. Overall, these analyses revealed space-associated stem cell hallmarks of aging (SASHA), including spaceflight dependent alterations in HSPC survival and self-renewal, ADAR1, telomere maintenance, mobilization and cell cycle gene expression, combined with space-induced clonal hematopoietic mutations, APOBEC3C activation and retrotransposon deregulation to warrant countermeasure development to enable long-duration spaceflight. Post-spaceflight analysis revealed increased C-to-T and clonal hematopoiesis-associated mutations, repetitive element and base deaminase deregulation, decreased telomere maintenance gene expression, and decreased self-renewal capacity compared to ground controls. These results demonstrate the space-associated aging effects in HSPCs after month-long exposure to LEO, providing insights into utilizing the LEO environment to model space-accelerated aging and other age-related malignancies.

  Study phs004267

• Genomic Alterations in Gingivo-buccal Cancer: ICGC-India Project_YR01

  As a part of the ICGC, India has undertaken genomic studies on gingivobuccal cancer of the oral cavity, which is the most prevalent form of cancer among men in India. There are various known environmental (life-style) correlates of this cancer, the most important of which are tobacco chewing and HPV infection. Paired DNA samples – isolated from the tumor tissue and from the blood of fifty patients – have been analyzed to catalog germline and somatic mutations. Association between each observed genomic alteration and exposure to environmental risk factors is being explored.Detailed clinical characterization of the patients, collection of data on demographic and environmental exposures, and isolation of DNA samples from blood and tumor tissues collected from each patient are being done at the Advanced Centre for Research, Treatment and Education on Cancer, Mumbai. Exome capture and deep resequencing are being performed at the National Institute of Biomedical Genomics, Kalyani. We have analyzed the exomes of paired blood and tumor DNA samples using two orthogonal platforms – exome capture by Roche-Nimblegen SeqCap Ez kit followed by sequencing on Roche-454 GS FLX, and exome capture by Illumina TrueSeq Exome Enrichment kit followed by sequencing on Illumina HiSeq-2000. Each exome is being sequenced at a mean depth of 30x. In addition, we have used Illumina Omni Quad SNP-chips to generate genotype data at 1.14 million genomic markers. The average concordance between SNP-chip and sequence data is 99.8%.

  Study EGAS00001000249

• Probabilistic cell type assignment of single-cell transcriptomic data reveals spatiotemporal microenvironment dynamics in human cancers

  Single-cell RNA sequencing (scRNA-seq) has transformed biomedical research, enabling decomposition of complex tissues into disaggregated, functionally distinct cell types. For many applications, investigators wish to identify cell types with known marker genes. Typically, such cell type assignments are performed through unsupervised clustering followed by manual annotation based on these marker genes, or via "mapping" procedures to existing data. However, the manual interpretation required in the former case scales poorly to large datasets, which are also often prone to batch effects, while existing data for purified cell types must be available for the latter. Furthermore, unsupervised clustering can be error-prone, leading to under- and over- clustering of the cell types of interest. To overcome these issues we present CellAssign, a probabilistic model that leverages prior knowledge of cell type marker genes to annotate scRNA-seq data into pre-defined and de novo cell types. CellAssign automates the process of assigning cells in a highly scalable manner across large datasets while simultaneously controlling for batch and patient effects. We demonstrate the analytical advantages of CellAssign through extensive simulations and exemplify real-world utility to profile the spatial dynamics of high-grade serous ovarian cancer and the temporal dynamics of follicular lymphoma. Our analysis reveals subclonal malignant phenotypes and points towards an evolutionary interplay between immune and cancer cell populations with cancer cells escaping immune recognition.

  Study EGAS00001003452