14977 results for "cancer studies using rna-seq"

in 40.33 milliseconds.

• A benchmark of DNA methylation deconvolution methods for tumoral fraction estimation using DecoNFlow

  In cancer patients, circulating cell-free DNA (cfDNA) originates from both healthy and cancer cells, and the proportion of tumor-derived cfDNA serves as a surrogate marker of tumor burden. Tumoral cfDNA can be identified using patient-specific mutations or more general tumor-specific DNA methylation patterns that are preserved in cfDNA, enabling non-invasive cancer detection and monitoring. Accurately estimating tumor fractions remains challenging due to the heterogeneous mixture of cfDNA sources in body fluids. Computational DNA methylation deconvolution methods can address this by estimating tumoral fraction with or without reference methylomes. Here, we benchmarked 10 reference-based and 2 reference-free DNAm deconvolution tools and provide the data generated for this benchmarking, consisting of 10 neuroblastoma cell lines and one healthy cfDNA sample (pooled from 15 healthy cfDNA samples), profiled using cfRRBS.

  Study EGAS50000001529

• Integration of T Cell Repertoire, CyTOF, genotyping and symptomatology data reveals subphenotypic variability in COVID-19 Patients

  A total of 61 patients (33 mild and 28 severe) with a median age of 51 years who recovered from COVID-19 were included in this study (Table 1). All collected samples were confirmed in diagnosis of COVID-19 by RT-PCR and positive IgG serolog. For the 61 patients, TCR-seq, CyTOF, and genotyping data were generated and analyzed in separate studies, as part of larger cohorts. In total, there are 143 variables, with 129 being quantitative (TCRseq and CyTOF metrics) and 13 being qualitative (symptomatology and genotyping). For more information about cohort characteristics, data adquisition an pre-processing, please visit PMID: 39227859, 36969980 and 37287057.

  Dataset EGAD50000000840

• Title: Divergent levels of CD112 and INKA1 define a distinct subset of human long-term hematopoietic stem cells

  The data provided here was critical in establishing that human long-term hematopoietic stem cells (LT-HSC), previously described as the most primitive HSC population, is actually composed of distinct subsets that can be prospectively isolated. Via mechanistic studies centering around the Rho-GTPase effector kinase PAK4 and its inhibitor INKA1, we identified the immune checkpoint ligand CD112 as a marker for hematopoietic stem and progenitor cells, that is highest expressed on LT-HSC. More importantly, CD112 can be used to stratify functionally distinct subsets within LT-HSC: In response to regeneration-mediated stress, the CD112low subset exhibits a transient restraint (termed latency) before contributing to hematopoietic reconstitution, while the CD112high subset is primed to respond rapidly. High resolution RNA-seq of the CD112 surface expression spectrum within rare LT-HSC subsets (human umbilical cord blood) demonstrated that more genes are differentially upregulated in the deeper quiescent and less metabolic active subset. Genes enriched in this subset centre around cell adhesion and Rho-GTPase signaling. This is in agreement with the scRNAseq data from human G-CSF mobilized peripheral blood (mPB) generated here that was used as an model of in vivo activation/priming revealing via RNA-velocity and pseudo-time analysis that INKA1high versus PAK4high, CDK6high and CD112high enrichment are either detected early or late in diffusion pseudotime indicative of quiescent versus primed cell status, respectively. RNAseq following INKA1 overexpression in LT-HSC and ST-HSC revealed by GSEA an overall stemness preserving phenotype and particularly in LT-HSC, but not in short-term HSC (ST-HSC), suppression of transcriptional programs linked to activation. Collectively, our data decipher the molecular intricacies underlying HSC heterogeneity and self-renewal regulation and point to latency as an orchestrated physiological response that integrates quiescence control with HSC fate choices to preserve a stem cell reservoir.

  Dataset EGAD00001006541

• The patterns and dynamics of genomic instability in metastatic pancreatic cancer

  Pancreatic cancer is an aggressive malignancy with a five-year mortality of 97–98%, usually due to widespread metastatic disease. Previous studies indicate that this disease has a complex genomic landscape, with frequent copy number changes and point mutations, but genomic rearrangements have not been characterized in detail. Despite the clinical importance of metastasis, there remain fundamental questions about the clonal structures of metastatic tumours, including phylogenetic relationships among metastases, the scale of ongoing parallel evolution in metastatic and primary sites, and how the tumour disseminates. Here we harness advances in DNA sequencing to annotate genomic rearrangements in 13 patients with pancreatic cancer and explore clonal relationships among metastases. We find that pancreatic cancer acquires rearrangements indicative of telomere dysfunction and abnormal cell-cycle control, namely dysregulated G1-to-S-phase transition with intact G2–M checkpoint. These initiate amplification of cancer genes and occur predominantly in early cancer development rather than the later stages of the disease. Genomic instability frequently persists after cancer dissemination, resulting in ongoing, parallel and even convergent evolution among different metastases. We find evidence that there is genetic heterogeneity among metastasis-initiating cells, that seeding metastasis may require driver mutations beyond those required for primary tumours, and that phylogenetic trees across metastases show organ-specific branches. These data attest to the richness of genetic variation in cancer, brought about by the tandem forces of genomic instability and evolutionary selection.

  Study EGAS00000000064

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• Onco-exaptation of an Endogenous Retroviral LTR Drives IRF5 Expression in Hodgkin Lymphoma

  The transcription factor interferon regulatory factor 5 (IRF5) is upregulated in Hodgkin lymphoma (HL) and a key regulator of the aberrant transcriptome characteristic of this disease. Here we show that IRF5 upregulation in HL is driven by transcriptional activation of a normally dormant endogenous retroviral LOR1a long terminal repeat (LTR) upstream of IRF5. Specifically, through screening of RNA-seq libraries, we detected LTR-IRF5 chimeric transcripts in multiple HL cell lines but not in normal B-cell controls. In HL, the LTR was in an open and hypomethylated epigenetic state and we further show the LTR is the site of transcriptional initiation. Among HL cell lines, usage of the LTR promoter strongly correlates with overall levels of IRF5 mRNA and protein, indicating that LTR transcriptional awakening is a major contributor to IRF5 upregulation in HL. Taken together, oncogenic IRF5 overexpression in HL is the result of a specific LTR transcriptional activation. We propose that such LTR derepression is a distinct mechanism of oncogene activation (“onco-exaptation”) and that such a mechanism warrants further investigation in molecular and cancer research.

  Study EGAS00001001205

• Collagen Proteostasis in Health and Disease

  This study uses human iPSC-derived cartilage to investigate the effects of the p.Arg719Cys mutation in the COL2A1 gene, which is linked to precocious osteoarthritis. Using a CRISPR-edited isogenic cell line pair, we compared wild-type and mutant cartilage for matrix defects and cellular stress responses. We performed RNA-sequencing and quantitative proteomics to characterize changes in gene expression, protein interactions, and collagen folding.

  Study phs004112

• Bulk RNAseq FASTQ files of three PDAC organoid lines treated with LGK974 or DMSO for 24h

  This dataset contains raw FASTQ files from bulk RNA sequencing of three patient-derived pancreatic ductal adenocarcinoma (PDAC) organoid lines (P28, P40, P47). Each organoid line was treated with either the WNT secretion inhibitor LGK974 or DMSO for 24 hours, with three biological replicates per treatment condition. RNA was extracted using the Qiagen QiaSymphony SP system, and libraries were prepared with the Illumina Truseq stranded polyA kit. Sequencing was performed on an Illumina NextSeq2000 platform using single-end 50bp reads. Quality control was conducted with FastQC, and reads were trimmed with TrimGalore as appropriate. Data are controlled-access and intended for transcriptomic analysis of WNT pathway perturbation in PDAC organoid models.

  Dataset EGAD50000002219

• Single-cell multi-omics reveals clonal evolution and T-cell dynamics underlying differential responses to ibrutinib in Waldenström macroglobulinemia.

  To elucidate the molecular basis underlying differential response and resistance to ibrutinib in Waldenström’s macroglobulinemia (WM), we conducted a prospective phase II trial (NCT02604511) of ibrutinib monotherapy in treatment-naïve patients. Seventy-four sequential bone marrow (BM) aspirates from 17 patients, collected from baseline through 48 treatment cycles, were profiled using single-cell RNA and V(D)J sequencing.

  Study EGAS50000001596

• Capture Hi-C on Hodgkin lymphoma cell line L-428

  In situ promoter capture Hi-C on Hodgkin lymphoma cell line L-428 in experimental triplicates. Hi-C libraries were prepared as previously described (Orlando et al., 2018, https://currentprotocols.onlinelibrary.wiley.com/doi/pdf/10.1002/cphg.63). Promoter capture was based on 32,313 biotinylated 120-mer RNA baits (Agilent). Hi-C libraries were sequenced using Illumina HiSeq 2000 technology. The files are in FASTQ format.

  Study EGAS00001003032

• Angiopredict: predicting response for bevacizumab treatment

  In ANGIOPREDICT, academic cancer biologists and industry-based biotechnology researchers worked with clinicians to identify biomarkers to predict whether individual metastatic colorectal cancer patients will respond positively to bevacizumab containing therapy. In this retrospective study, copy number profiles were determined using whole genome shallow sequencing, and progression free survival and treatment data was collected.

  Study EGAS00001002724

• Dataset for Direct Detection of Early-Stage Cancers using Circulating Tumor DNA

  The dataset for Direct Detection of Early-Stage Cancers using Circulating Tumor DNA includes 602 bam files from next-generation sequencing on the Illumina HiSeq2500 or MiSeq. The samples analyzed include cancer cell lines as well as plasma and tissue specimens from healthy individuals and patients with cancer.

  Dataset EGAD00001003601

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• DNA-seq BAM files from 16 patients affected by acute intermittent porphyria

  Paired-end BAM files from 16 patients affected by acute intermittent porphyria. Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001006951

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Expression Quantitative Trait Locus Mapping Studies in Mid-Secretory Phase Endometrial Cells Identifies HLA-F and TAP2 as Fecundability-Associated Genes

  We performed an unbiased genome-wide expression quantitative trait locus (eQTL) mapping study to identify common regulatory (expression) single nucleotide polymorphisms (eSNPs) in mid-secretory endometrium, corresponding to the luteal phase of the ovarian cycle. Biopsies were collected from 58 women with two or more early pregnancy losses and 53 of these samples passed all quality control. RNA was extracted from endometrial biopsies and DNA was extracted for sequencing from blood. Gene expression data can be found at NCBI GEO Series GSE77688.

  Study phs001146

• Comprehensive genomic characterization of early stage bladder cancer - nanopore sequencing

  For this project about non-muscle invasive bladder cancer (NMIBC), we analysed long read sequencing data from 4 patients using the Nanopore platform. The dataset is composed of 8 BAM files: 4 tumor samples and 4 paired blood samples.

  Study EGAS50000000510

• TRACERx100 metastatic samples

  Whole exome sequencing of 10 metastatic biopsies from four TRACERx100 patients (see EGA dataset EGAS00001002247), collected either after relapse or death. The data from these samples are initially published with Abbosh, C. et al. Phylogenetic ctDNA analysis depicts early stage lung cancer evolution. Nature, http://dx.doi.org/10.1038/nature22364 (2017). Abstract: Earlier detection of relapse following primary surgery for non-small cell lung cancer and the characterization of emerging subclones seeding metastatic sites might offer new therapeutic approaches to limit tumor recurrence. The potential to non-invasively track tumor evolutionary dynamics in ctDNA of early-stage lung cancer is not established. Here we conduct a patient-specific approach to ctDNA profiling in the first 100 lung TRACERx (TRAcking Cancer Evolution through therapy (Rx)) study participants, including one patient co-recruited to the PEACE (Posthumous Evaluation of Advanced Cancer Environment) post-mortem study. We identify independent predictors of ctDNA release in early-stage non-small cell lung cancer and perform tumor volume limit of detection analyses. Through blinded profiling of post-operative plasma, we observe evidence of adjuvant chemotherapy resistance and identify patients destined to experience recurrence of their lung cancer. Finally, we show that phylogenetic ctDNA profiling tracks the subclonal nature of lung cancer relapse and metastases, providing a new approach for ctDNA driven therapeutic studies.

  Dataset EGAD00001003301

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• Loss of RREB1 in pancreatic beta cells reduces cellular insulin content and affects endocrine cell gene expression

  Genome-wide studies have uncovered multiple independent signals at the RREB1 locus associated with altered type 2 diabetes (T2D) risk and related glycemic traits. However, little is known about the function of the zinc finger transcription factor RREB1 in glucose homeostasis or how changes in its expression and/or function influence diabetes risk. We studied its function using three transcriptomic strategies, profiling gene expression when RREB1 is knocked out or knocked down in the Endo-betaH1 cell line, in addition to the in vitro differentiation in hiPSCs.

  Dataset EGAD00001009740

• TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells.

  We examined tumours from a large cohort of patients with metastatic urothelial bladder cancer (mUC) treated with an anti–PD-L1 agent (atezolizumab) and identified major determinants of clinical response and immune escape. Whole transcriptome profiles were generated for 368 patients using TruSeq RNA Access technology (Illumina). Somatic mutations were determined via whole exome sequencing for a subset of these patients. - Response was associated with CD8+ T effector cell phenotype and, to an even greater extent, high neoantigen or tumour mutation burden (TMB). On the other hand, lack of response was associated with a transforming growth factor β (TGF-β) signature, particularly in patients with CD8+ T cells preferentially residing in collagen-rich matrix surrounding tumours. Integration of these three independent biological features provided the best basis for understanding outcome in this setting. -

  Study EGAS00001002556

• Single cell RNA sequencing of 33 primary colorectal cancer

  Study EGAS00001003779

• Genes and Blood Clotting Study (GABC)

  Objectives: Use genome-wide approaches to identify genetic variants that influence common thrombosis and hemostasis factors, as well as selected common human traits. Design/Methods: The GABC study was a prospective sibling cohort design. Siblings were recruited by targeted email to the undergraduate and graduate student email lists at the University of Michigan. Healthy persons between 14 and 35 years old who had healthy siblings within the same age restriction were able to participate. Study participants agreed to an online informed consent and subsequently completed a 52-question online survey describing their specific bleeding traits as well as many common human traits. Fifty milliliters of blood was collected into a citrate-dextrose solution (ACD) from each participant. An aliquot of whole blood was used for an automated complete blood count analysis and the remainder was processed into platelet poor plasma and buffy coat portions. Plasma and buffy coat aliquots were snap frozen and stored in liquid nitrogen for future studies. 1189 individuals representing 507 sibships were collected between 06/26/2006 and 01/30/2009. Phenotyping Survey Details: To characterize individual bruising and bleeding history, the online survey recorded answers to questions based on a modified von Willebrand Disease (VWD) screening questionnaire. To characterize a collection of participant's common human traits, the survey recorded answers to questions about height, weight, presence of skin tags, history of acne, eye color, hair color, hair line characteristics, skin sunburn sensitivity, skin tanning ability, natural skin color, freckling, cheek dimpling, earlobe shape, shoe size, foot arch characteristics, hand fifth digit morphology, history of dyslexia, history of migraine headaches, history of seasonal allergies, history of apthous ulcers, tendency to sneeze while walking into a bright sunny place, history of dental caries, need for corrective eye lenses, handedness and like or dislike of strongly flavored foods. Biochemical phenotyping: Assays for plasma Von Willebrand Factor (VWF) antigen were performed using ELISA and "Alphalisa" techniques. Automated complete blood count analysis was performed on a Bayer Advia 120 on all participants (including WBC differential, RBC indices, and platelet count.) For the dbGaP v2 update, new biochemical phenotypes have been submitted and include von Willebrand Factor, von Willebrand Factor propeptide, plasminogen, gamma prime fibrinogen, ADAMTS 13, antithrombin III, protein C, and protein S. All new phenotypes were obtained using "Alphalisa" techniques. Genotyping Details: SNP genotyping was performed using genomic DNA extracted from peripheral blood at the Broad Institute, (MIT/Harvard). Genotyping was performed on the Illumina Omni-1 quad chip at the Broad Institute. For the dbGaP v2 update, genotyping data from the Illumina Human Exome was deposited. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to blood clotting through large-scale genome-wide association studies of siblings. Genotyping was performed at the Broad Institute of MIT and Harvard, a GENEVA genotyping center. Data cleaning and harmonization was performed by the primary investigators at the University of Michigan, Ann Arbor, and at the GEI-funded GENEVA Coordinating Center at the University of Washington. This study serves as a resource for investigators who are interested in the genetic determinants of specific plasma proteins in a healthy population. The sibling cohort design allows for linkage analysis in addition to association studies. Analysis of thrombosis and hemostasis related traits should help elucidate specific biochemical and genetic networks that maintain hemostasis. We hope to identify specific genetic determinants of VWF levels in order to better understand the factors that influence the development of VWD.

  Study phs000304

• Childhood B-cell acute lymphoblastic leukemia genomic and transcriptomic data

  The aim of the two studies was: 1) to genetically characterise childhood leukemia patients that lacked established cytogenetic abnormalities (termed B-other leukemia) and assess the clinical features of recurrent genetic abnormalities. 2) Assess the accuracy of whole genome sequencing as a diagnostic genetic test in childhood leukemia, relative to other traditional methods (karyotyping, FISH, MLPA) and whole transcriptome sequencing. As a result, this study includes targeted DNA-sequencing, whole genome sequencing and whole transcriptome sequencing data on childhood leukemia patients enrolled on UK clinical trials (UKALL2003 and UKALL2011).

  Study EGAS00001006863

• Breast Cancer Family Registry

  The Breast Cancer Family Registry (BCFR) is a multi-center prospective cohort, comprised of over 30,000 women and men from nearly 12,000 families from the United States, Canada, and Australia. Our BCFR resource has been used, and continues to be used, by breast cancer researchers around the world in order to find new ways to prevent, diagnose, and treat cancer. The BCFR provides an extensive and diverse range of resources, expertise, and specialized skills, and has several unique strengths: 1) the collection of a large number of individuals and families across a wide spectrum of breast cancer risk, including both affected and unaffected individuals; 2) the large collection of families with early-onset breast cancer; 3) the large collection of racial/ethnic minority families not replicated elsewhere; 4) the extensive molecular characterization performed to date; and 5) active follow-up of both probands and family members. Thus, the BCFR comprises a unique cohort of probands and family members at familial/genetic risk of breast cancer that will continue to facilitate a wide range of research studies, such as gene discovery, examination of cancer-related outcomes and risk factors in high-risk subjects, investigation of novel behavioral interventions, and cancer prevention trials among at-risk family members. Consequently, the BCFR Cohort, as one of the few cohorts available worldwide with biospecimens and extensive molecular and genetic characterization, combined with epidemiologic data and long-term follow up, will be an invaluable resource for translational research in the genetic epidemiology of breast cancer.

  Study phs002835

• Colon Cancer Family Registry (Colon CFR)

  The Colon Cancer Family Registry Cohort (CCFRC www.coloncfr.org) is a cohort of families recruited through six study sites located in the USA, Canada, Australia, and New Zealand. The CCFRC was formed as a resource to support studies on the etiology, prevention, and clinical management of colorectal cancer. Recruitment protocols fall broadly into two main categories: population-based and clinic-based ascertainment. Between 1998 and 2013, the CCFR recruited and interviewed probands who were either recently diagnosed with colorectal cancer that was reported to state or regional population cancer registries in the United States (Washington, California, Arizona, Minnesota, Colorado, New Hampshire, North Carolina, and Hawaii), Australia (Victoria), and Canada (Ontario) or were from multiple-case families referred to family-cancer clinics in the United States (Mayo Clinic in Rochester, Minnesota, and Cleveland Clinic in Cleveland, Ohio), Australia (Melbourne, Adelaide, Perth, Brisbane, and Sydney), New Zealand (Auckland), and Canada. Cases with known familial adenomatous polyposis were excluded. Once recruited, probands were asked for permission to contact their relatives for recruitment. Collectively, we have enrolled 42,49874 participants in 15,048 families who participated in standardized protocols used to collect information regarding family cancer history and colorectal cancer risk factors and biospecimens. All participants of population-based case families (excluding control-families) and clinic-based families are asked to provide updates on their personal and family history of cancer as well as their history of surgery, cancer screening, and some risk factors every 4-5 years either by telephone interview or by self-completed questionnaire via mail or online (PMID: 17982118).

  Study phs002733

• 1. Identidication of molecular biological mechanism associated with the development and prognosis of uterine cancer, uterine sarcoma, and endometrial hyperplasia / 2. Identification of molecular biological mechanism associated with the development of endometriosis and malignant transformation, ovarian cancer, fallopian tubal cancer, peritoneal cancer, and other malignant tumors in gynecological organs

  To identify molecular subtypes and carcinogenesis in clear cell ovarian carcinomas by whole-exome sequencing, RNA-sequencing, and methylation array, and to characterize high-grade serous carcinomas by NGS-based, integrative genomic analyses, with focus on homologous recombination deficiency, molecular subtypes and prognositic factors.

  Study JGAS000560

• Integrating Circulating Tumor DNA Analysis and Radiomics for Dynamic Risk Assessment in Localized Lung Cancer

  DNA was isolated from pre-treatment and mid-treatment plasma samples and matched germline samples from patients undergoing chemoradiation therapy for stage IIB-IIIB non-small cell lung cancer. Sequencing libraries were hybrid captured using custom selector pools designed to target genes frequently mutated in non-small cell lung cancer prior to ultra-deep next generation sequencing.

  Study phs003947

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• CALGB 40601: Randomized Phase III Trial of Paclitaxel Combined With Trastuzumab, Lapatinib, or Both As Neoadjuvant Treatment of HER2-Positive Primary Breast Cancer

  This randomized phase III trial studies paclitaxel and trastuzumab with or without lapatinib to see how well they work in treating patients with stage II or stage III breast cancer that can be removed by surgery. Drugs used in chemotherapy, such as paclitaxel, work in different ways to stop the growth of tumor cells, either by killing the cells, by stopping them from dividing, or by stopping them from spreading. Monoclonal antibodies, such as trastuzumab, can block tumor growth in different ways. Some block the ability of tumor cells to grow and spread. Others find tumor cells and help kill them or carry tumor-killing substances to them. Lapatinib may stop the growth of tumor cells by blocking some of the enzymes needed for cell growth. Giving paclitaxel with trastuzumab and/or lapatinib before surgery may make the tumor smaller and reduce the amount of normal tissue that needs to be removed. It is not yet known which regimen is more effective in treating patients with breast cancer.

  Study phs001570

• Cell-free DNA TAPS for early cancer detection

  Multimodal, genome-wide characterization of epigenetic and genetic information in circulating cell-free DNA (cfDNA) could enable more sensitive early cancer detection. However, due to technological challenges associated with DNA methylation sequencing in low input cfDNA samples, most studies have been limited by DNA damage caused by bisulfite sequencing, or the qualitative nature of enrichment-based sequencing. Recently, we developed TET-assisted Pyridine Borane Sequencing (TAPS), which is a mild, bisulfite-free method for base-resolution direct DNA methylation sequencing. Here we optimized TAPS for cfDNA (cfTAPS) to provide high-quality and high-depth whole-genome cell-free methylomes. We applied cfTAPS to 85 cfDNA samples from patients with hepatocellular carcinoma (HCC) or pancreatic ductal adenocarcinoma (PDAC) and non-cancer controls. From just 10 ng cfDNA (1-3 mL of plasma), we generated the most comprehensive cfDNA methylome to date. We demonstrated that cfTAPS provides multimodal information about cfDNA characteristics, including DNA methylation, tissue of origin, and DNA fragmentation. Integrated analysis of these epigenetic and genetic features enables accurate identification of early HCC and PDAC.

  Study EGAS00001004962

• MIBS MGS

  Metagenomic sequencing of the human gut in Maastricht IBS studies, cases and controls.

  Study EGAS00001001924

• Developing Targeted Therapy for Patients with Multiple Myeloma and Gain or Amplification of Chr1q (1q+)

  Multiple myeloma (MM) frequently presents with gain or amplification of chr1q (1q+), which is associated with inferior response to treatment and poor outcomes. To develop targeted therapy for MM with 1q+, we leveraged external and in-house dependency screens and drug screens, along with single-cell sequencing of patient tumors with subclonal 1q+. We demonstrated that MM with 1q+ exhibits higher sensitivity to MCL1 and PI3K inhibitors, which may be synergistic and act through established and novel mechanisms. Two human MM cell lines with 1q+, KMS12BM and KMS11, were profiled with either single-cell RNA-sequencing (scRNA-seq) alone (KMS12BM, KMS11) or both scRNA-seq and whole-genome sequencing (WGS; KMS12BM) to understand the factors that determine response to MCL1 and PI3K inhibitors and how these inhibitors work.

  Study phs003886

• National Human Genome Research Institute Tumor Sequencing Project (TSP) - Lung Adenocarcinoma

  The Tumor Sequencing Project (TSP) Consortium is a collaboration among participants at the Baylor College of Medicine Human Genome Sequencing Center, the Broad Institute Genome Sequencing Platform, the Dana Farber Cancer Institute, the Memorial Sloan-Kettering Cancer Center, the Genome Sequencing Center and Siteman Cancer Center at Washington University, the M.D. Anderson Cancer Center and the University of Michigan Medical Center. The TSP Part A will pilot approaches to large-scale identification of genomic changes in tumors by sequencing the exonic regions of 623 genes in 188 specimens of adenocarcinoma of the lung, as well as using high density SNP genotyping arrays for high resolution identification of changes in chromosomal copy number. The TSP Part B will pilot approaches to tumor characterization of lung adenocarcinoma samples using next-generation sequencing technologies and benchmark those results against Part A data generated with ABI3730 instruments.

  Study phs000144

• Genomic alterations in MM - CEL

  RNA from the same tumor sample (n=98) was also processed using the 3' IVT kit (Affymetrix) and hybridized to U133 Plus 2.0 arrays (Affymetrix).

  Dataset EGAD00010001577

• Single-cell RNA-sequencing of H3-K27M diffuse midline glioma.

  Fastq files are deposited for single-cell transcriptomes of patient H3-K27M diffuse midline gliomas, generated using the SMART-seq2 method.

  Dataset EGAD00001011339

• EED inhibition of organoid development

  Transcriptomics and epigenomics after chemical inhibition of EED during early human brain organoid development. To investigate the role of H3K27me3 inhibition during neuroectoderm induction, we treated brain organoids with 3 concentrations of EED inhibitor (and control) during the transition of pluripotency to neuroepithelium. At the neuroepithelium stage, we profiled the organoids using scRNA-seq (transcriptome) and bulk Cut&Tag (H3K27me3, H3K27ac). Library preparation for scRNA-seq was carried out with the 10x genomics platform.

  Dataset EGAD50000000224

• DNA-seq FASTQ files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq FASTQ files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). Each sample was multiplexed across flowcells and lanes, leading to a total number of 86 FASTQ files.

  Dataset EGAD00001005756

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• RNA sequencing, ATACseq, and TCR-seq of Tfh cells and CXCR5- CD4+ T cells in HIV infected lymph nodes

  The high dimensional analyses of CD4+ T cells in human lymph nodes are case-based analyses of the TCR repertoire, transcriptome, and epigenetic signatures of various CD4+ T cells in human lymph nodes. The study aims to determine clonal overlap between phenotypically distinct CD4+ T cells and the similarities between these populations on transcriptional and epigenetic levels. This study performs TCR repertoire sequencing using Molecular Identifier Clustering-based Immune Repertoire Sequencing (MIDCIRS). We found clonal overlap between a population of CXCR5- T cells and follicular helper T (Tfh) cells. We also show epigenetic and transcriptional similarities between CXCR5-PD-1+ T cells and Tfh cells. This study shares an overlapping set of donors with phs001548.

  Study phs001849

• Development and Use of Network Infrastructure for High-Throughput GWA Studies

  The "Development and Use of Network Infrastructure for High-Throughput GWA Studies" project is collaboration between Group Health Cooperative (GH), the University of Washington (UW), and the Fred Hutchinson Cancer Research Center (FHCRC). It is one of 5 sites participating in The Electronic Medical Records and Genomics (eMERGE) Network funded by the National Human Genome Research Institute (NHGRI) with additional funding from the National Institute of General Medical Sciences (NIGMS). The overall eMERGE project is designed to assess whether linking biorepositories of patients in healthcare delivery systems with electronic medical records (EMRs) is an efficient strategy for high-throughput genome wide association (GWA) studies and whether information can be pooled across sites. The primary phenotype in the Group Health/UW Aging and Dementia eMERGE study project is dementia. Phenotyped participants originated from four population-based sources. Seattle-area members of GH (a large integrated health care system in Washington State) consented and enrolled in 1) the University of Washington Alzheimer's Disease Patient Registry (ADPR) and 2) the Adult Changes in Thought (ACT) study, 3) Marshfield Clinic Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults, 4) Vanderbilt's BioVU, a de-identified DNA biobank. The ADPR (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is a population-based registry of incident dementia cases designed to identify all new dementia cases within GH from 1987 to 1996. Potential dementia cases were identified through referrals from primary care physicians, mental health services, and neurologists, as well as review of CT scans, neurology, emergency room, geriatrician, and mental health clinic logs, and hospital discharge diagnoses. Medical history, physical, laboratory testing, and neuropsychological testing were performed on all consenting potential cases. These data were reviewed by a consensus conference including a neuropsychologist, study physicians, and an epidemiologist. After discussion of the case, dementia status is assigned using DSM-III-R criteria. Alzheimer's disease status was assigned using the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) criteria. The study base of the ADPR population was stable with an attrition rate of less than 1%/year. The ACT study (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is an ongoing community-based cohort study designed to determine the incidence of Alzheimer's Disease (AD), other types of dementia, and cognitive impairment and to determine risk factors for these conditions. The original cohort of 2,581 was enrolled in 1994-1996. An expansion cohort of 811 was enrolled in 2000-2002. Continuous enrollment to keep 2,000 persons enrolled and at-risk for dementia outcomes was begun in 2005. To date the study has accrued more than 4,000 participants. Dementia-free participants are enrolled in this cohort and evaluated every two years by study personnel with many evaluations including an assessment of cognitive functioning using the Cognitive Abilities Screening Instrument (CASI), which is an extended version of the Mini-Mental State Examination that has been widely used in epidemiological studies of the elderly. Persons with CASI scores lower than 86 or in whom interviewers suspect unusual cognitive decline are followed up with dementia diagnostic evaluations which include physical and neurological examinations and neuropsychological tests. Medical records are reviewed, and laboratory tests and neuroimaging are obtained if not available. The dementia diagnoses and dementia subtypes are determined during a consensus conference attended by the examining clinicians and other study physicians, a neuropsychologist, and research nurse. After discussion of the case, dementia status is assigned using DSM-IV criteria. Alzheimer's disease status was assigned using NINCDS-ADRDA criteria. Individuals diagnosed with dementia are seen again one year following diagnosis using the same procedures. Individuals not diagnosed with dementia are returned to the pool of at-risk individuals and are seen at their next routinely scheduled biennial visit. The ACT sub-sample is stable; for the original cohort, median enrollment in GH was 19 years prior to joining the ACT study, and 85% of the cohort has ≥ 10 years of GH enrollment. DNA for the ADPR participants were obtained through a companion study, Genetic Differences in Cases and Controls (PI: Walter Kukull; NIH/NIA R01 AG007584). DNA obtained through both studies were extracted from blood using Gentra Systems Puregene methods. DNA concentration is determined by UV optical density. All samples are checked for quality by OD 260/280 ratio. For long-term storage, samples are aliquoted and stored at -70°C. The Marshfield study, Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults. PMRP was started in 2002 as a 3 Phase project. Completed in April 2004, the objectives of Phase I were to build and develop a large population-based biobank with DNA, plasma and serum samples to facilitate genomics research. Phase 1 was also to educate, inform and consult with the Marshfield Epidemiologic Study Area population and communities concerning potential studies, create the DNA foundation of the personalized medicine database and build the bioinformatics tools to store securely and analyze genotypic and phenotypic data. Phase I tasks included operation of the ethics and security advisory board, scientific advisory board and community advisory group. More than 18,000 residents aged 18 and above from 19 different zip codes surrounding Marshfield, WI were invited to participate in Phase I. After providing written informed consent, participants completed brief questionnaires that included questions about demographics, some environmental exposures, family history of disease, and adverse drug reactions, as well as family members living in the area. Participants provided 50ml of blood from which DNA was extracted and plasma and serum samples were stored. The informed consent process allowed access to electronic medical records and included language about non-disclosure of personal research results. A tick-off box was included so that participants could either allow or decline subsequent recontact for future research studied. The objectives of Phase II are to create the phenotypic database, establish the scientific and administrative infrastructure to support genetic mapping of the DNA and the initial discovery projects and genotype a sufficient portion of the genetic material to support these discovery projects. The objectives of Phase III are to expand the discovery projects, complete the genotyping of the genetic database and expand physician/health care provider education and community consultation. The Vanderbilt BioVU model uses discarded blood leftover from clinical care and de-identified clinical information, both of which are tracked with a Research Unique Identifier that is permanently disconnected from the medical record number used to generate it. The Vanderbilt IRB determined that the project does not qualify as "human subject" research under §46.102(f)(1)(2). The program has been reviewed by OHRP twice (the latest immediately prior to launch), and the determination of the Vanderbilt IRB that the project is consistent with the 8/10/2004 guidance has been validated. The model includes a simple opt out mechanism developed for patients who do not wish to have their samples included. Planning (including community involvement, ethics and IRB discussions, focus groups, development of operating procedures and pilot studies to assess them) began in May 2004, and the resource commenced sample collection in February 2007 and as of May 2009 contains approximately 56,000 samples. The current resource will be available to all Vanderbilt investigators who sign a Data Use Agreement. The resource represents Vanderbilt's broad patient population and thus provides a potential resource for research in a range of common and rare diseases as well as drug response or medication safety. BioVU patient protection model: There has been extensive involvement by the ethics community and the IRB to put in place procedures to provide privacy protection. The overall protection plan is multifaceted and includes a combination of technology and policy: (1) creation of the SD described above; (2) return of only the specific clinical data items requested by investigators (rather than the complete de-identified chart); (3) submission of any specific proposed project to the IRB and to a separate protocol review committee, both of which must approve; (4) implementing a Data Use Agreement that permits only approved queries and data analyses, specifically prohibits attempts at re-identification (at the risk of institutional sanctions), and mandates redeposit of all genetic information generated in a research study back into a genomic database; and (5) tracking and auditing all use.

  Study phs000234

• Clonal_expansion_of_mutated_cell_population_in_bladder_urothelium_

  1cm biospies of from patients undergoing bladder cystectomy will be collected. The underlying muscle and stroma will be removed and the remaining epithelia dissected into small sequential areas which will be sent for ultra-deep exome sequencing using a panel of known cancer and viral genes. Sequence analysis using similar methods to Martincorena I et al (Science 2015, 348:880) will provide an idea of the somatic mutational landscape in these patient samples. Individual patient muscle samples will also be sequenced as a reference.

  Study EGAS00001001687

• Bam files from Whole exome sequencing (WES, ~50x mean read depth) of metachronous bladder tumors

  In this study we characterized genomic alterations in two to five metachronous bladder tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth and whole transcriptome RNA-seq was performed (RNA was not advalible for 4 tumors) Data provided here consist of 122 Bam files for WES (83 Tumors and 39 blood)

  Dataset EGAD00001002716

• The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk RNA-seq)

  RNA was isolated from purified human CD8 cells that were incubated with anti-HER2/CD3 TDB in the presence of SK-BR-3 cells. Sequencing libraries were generated and submitted for transcriptome profiling by high-throughput sequencing. Experiments were performed in triplicates for anti-HER2/CD3 TDB treatment and control. This Dataset is associated with the following ArrayExpress Experiment: E-MTAB-8211 - The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk)

  Dataset EGAD00001005187

• Integrated Exome-seq analysis of tumor thrombus

  We prospectively enrolled 83 patients with a renal mass and TT scheduled to undergo surgical resection. To accurately integrate genomic and transcriptomic findings and enable histological co-registration, simultaneous isolation of DNA and RNA was performed from individual samples characterized histologically through immediately flanking sections

  Study EGAS00001005511

• Single nucleus RNA Seq of LUAD patient derived lung samples

  Fastq files of single nucleus RNA Sequencing data from 26 patients including 26 lung adenocarcioma and 12 matched healthy tissue samples for 8 young female never smokers, 8 young female smokers, 7 elderly female never smokers and 3 male never smokers.

  Dataset EGAD00001008955

• Development of hunanized mice for human hematopoisis and immunity research

  We obtained peripheral blood or bone marrow samples from 112 acute myeloid leukemia patients and examined sensitivity and resistance of the AML samples to molecular targeting drugs. By doing RNA sequencing using AML cells, we found heterogenous gene expression patterns in AML with different mutational landscapes. From the RNA sequencing, we identified anti-apoptosis, cell cycle progression, and immune-related signals as pathways up-regulated in AML cells as compared with normal CD34+ cells. From the pathway analyses, we further setup in vitro experiments to find vulnerability genes in clinically-aggressive AML. BIRC, BCL2, MCL1, AURKB, and KIF10 may be essential molecules for AML cell survival and proliferation.

  Study JGAS000253

• Meisal temporal lobe epilepsy sequencing study

  Our understanding of mesial temporal lobe epilepsy (MTLE) is one of the most common forms of drug-resistant epilepsy in humans. Using RNA- and small RNA-sequencing in parallel, we explored differentially expressed genes in the hippocampus and cortex of MTLE patients who had undergone surgical resection and non-epileptic controls. We found significant enrichment for astrocytic and microglial genes amongst up-regulated genes and down-regulation of neuron-specific genes in the hippocampus of MTLE patients. The transcriptome profile of the small RNAs reflected disease state more robustly than mRNAs, even across brain regions which show very little pathology.

  Study EGAS00001003922

• (ChIP-seq) Shifted assembly and function of mSWI/SNF family subcomplexes underlie targetable dependencies in endometriod carcinomas

  ChIP-seq data of 18 samples from the VOA1066 undifferentiated endometrial carcinoma cell-line with various pulldowns: BRG1 (abcam, ab110642, GR3255117-11), BRD9 (CST, E4Q3F, Lot 1), ARID1A (CST, D2A8U, Lot 4), SS18 (CST, D6I4Z, Lot 1), PBRM1 (CST, D3F70, Lot 3), GLTSCR1 (CST, E6I3A, Lot 1), H3K27ac (CST, C36B11, Lot 16), or none. Sample were either untreated or received doxycycline-induced ARID1A treatment. Samples were sequenced on Illumina NextSeq 500 using 37 bp single-end sequencing parameters. Raw fastq files, along with processed bigwig files containing normalized genomic coverage, and called narrow peaks, are included for each sample.

  Dataset EGAD50000001473

• Preferential infiltration of distinct Vγ9δ2 T cells into Glioblastoma multiforme

  Glioblastoma multiforme (GBM), the most fatal CNS cancer, is highly infiltrative as a result of phenotypic alteration of cancer cells mainly driven by a mutual interaction among cancer cells, tumor-associated macrophages (TAMs) and other stromal cells. This work aims at characterizing GBM-infiltrating γδ T cells that may regulate the GBM tumor microenvironment and cancer cell gene expression. V(D)J repertoires of tumor-infiltrating and blood circulating γδ T cells from 4 patients were analyzed by NGS-based TCR sequencing. RNA gene expression profiling and immunostaining of cancer tissues were performed as well.

  Study EGAS00001002790

• RNA Sequencing of ECOG-E1308

  This study reports the RNA sequencing of HPV positive oropharyngeal squamous cell carcinoma samples from patients with HPV-associated stage III or stage IV cancer of the oropharynx that was surgically resectible. These patients participated in the ECOG-E1308 trial, a phase II trial that studied paclitaxel, cisplatin, and cetuximab followed by cetuximab and two different doses of intensity-modulated radiation therapy.

  Study phs003320

• A comprehensive assessment of somatic mutation detection in cancer using whole genome sequencing

  As whole genome sequencing for cancer genome analysis becomes a clinical tool, a full understanding of the variables affecting sequencing analysis output is required. Using tumor-normal sample pairs from two different types of cancer, chronic lymphocytic leukemia and medulloblastoma, we conducted a benchmarking exercise within the context of the International Cancer Genome Consortium. We compare sequencing methods, analysis pipelines, and even validation methods. Here we show that using PCR-free methods and increasing sequencing depth to ~100x showed benefits, as long as the tumor:control coverage ratio remains balanced. We observe widely varying mutation call rates and low concordance among analysis pipelines, reflecting the artifact-prone nature of the raw data and lack of standards for dealing with the artifacts. However, armed with the benchmark mutation set we have created, we show that many issues are in fact easy to remedy and have an immediate positive impact on mutation detection accuracy.

  Study EGAS00001001539

• 5' Single cell RNA sequencing of pre-treatment tissues from lung cancer patients receiving immunotherapy

  Study EGAS00001006188

• Fresh vs. frozen cell preparations of colorectal cancer single-cell RNA sequencing

  Study EGAS00001003769

• Somatic cancer gene mutation screening

  Sequencing of colorectal tumors and normal tissue using Ion AmpliSeq Cancer Hotspot Panel V2

  Dataset EGAD00001001010

• A spatiotemporal organ-wide gene expression and cell atlas of the developing human heart

  The process of cardiac morphogenesis in humans is incompletely understood. Its full characterization requires a deep exploration of the organ-wide orchestration of gene expression with a single-cell spatial resolution. Here, we present a molecular approach that reveals the comprehensive transcriptional landscape of cell types populating the embryonic heart at three developmental stages, and which maps cell type-specific gene expression to specific anatomical domains. Spatial Transcriptomics identified unique gene profiles corresponding to distinct anatomical regions in each developmental stage. Human embryonic cardiac cell types identified by single-cell RNA-sequencing confirmed and enriched the spatial annotation of embryonic cardiac gene expression. In situ sequencing was then used to refine these results and create spatial subcellular map for the three developmental phases. Finally, we generated a publicly available web resource of the human developing heart to facilitate future studies on human cardiogenesis.

  Study EGAS00001003996

• The Acquisition of Molecular Drivers in Pediatric Therapy-Related Myeloid Neoplasms

  Pediatric therapy-related myeloid neoplasms (tMN) occur in children after exposure to cytotoxic therapy and have a dismal prognosis1-4. The somatic and germline genomic alterations that drive these myeloid neoplasms in children and how they arise have yet to be comprehensively described. We use whole exome, whole genome, and/or RNA sequencing to characterize the genomic profile of 85 pediatric tMN cases (tMDS: n=29, tAML: n=56). Our data show that Ras/MAPK pathway mutations, alterations in RUNX1 or TP53, and KMT2A rearrangements are frequent somatic drivers, and we identify cases with aberrant MECOM expression secondary to enhancer hijacking. Unlike adults with tMN5-7, we find no evidence of pre-existing minor tMN clones (including those with TP53 mutations), but rather the majority of cases were unrelated clones arising as a consequence of cytotoxic therapy. These studies also uncover rare cases of lineage switch disease rather than true secondary neoplasms.

  Study EGAS00001004850

• A microRNA-signature that correlates with cognition and is a target against cognitive decline

  While some individuals age without pathological memory impairments, others develop age-associated cognitive diseases. Since changes in cognitive function develop slowly over time in these patients, they are often diagnosed at an advanced stage of molecular pathology, a time point when causative treatments fail. Thus, there is great need for the identification of inexpensive and minimal invasive approaches that could be used for screening with the aim to to identify individuals at risk for cognitive decline that can then undergo further diagnostics and eventually stratified therapies. In this study we use an integrative approach combining the analysis of human data and mechanistic studies in model systems to identify a circulating 3-microRNA signature that reflect key processes linked to neural homeostasis and informs about cognitive status. We furthermore provide evidence that expression changes of this signature represent multiple mechanisms de-regulated in the aging and diseased brain and are a suitable target for RNA therapeutics.

  Study EGAS00001005627

• Identification of responsible genes and development of standardized medicine for familial breast cancer by genetic analysis with NGS technology

  Aims: To clarify risk of germline variants of known causal genes for Hereditary Breast Ovarian Cancer Syndrome in Japan by combinatorial analysis of somatic and germline variants in the breast cancer tissue. Methods: Target caputure analysis by using Illumina HiSeq 2000; the panel genes are 119 genes including 30 HBOC known causal genes. Participants/Materials: 108 whole blood and 124 primary tumor samples from familial breast cancer patients.

  Study JGAS000224

• Whole-Exome Sequencing analyses in tamoxifen-associated endometrial cancer

  An increased incidence of endometrial cancer has been described for patients that have received tamoxifen to treat breast cancer. Using samples from endometrial tumors, isolated from surgivcal specimens of patients who previously received tamoxifen treatment for breast cancer, we aimed to identify whether there are specific somatic mutations enriched in this population, relative to endometrial tumors from the general population. For this, WES was performed on matched endometrial tumors and healthy tissue (n=21).

  Study EGAS00001006453

• Dataset for WGS and RNA samples of acute myeloid leukemia with MNX1 expression

  This dataset contains 10 samples of WGS, ATAC, 4C and RNAseq samples of patients with acute myeloid leukemia. The sequencing was performed on Illumina HiSeq 4000, 2000 and HiSeq X using Illumina TruSeq Nano DNA and Agilent Strand Specific RNA Kits. The sequencing was always paired.

  Dataset EGAD50000001098

• Single-cell RNA sequencing generated from 11 glioma patient samples

  This dataset includes paired-end fastq files from 6 IDH-mutant, 5 IDH-wild-type glioma patient samples of unmatched initial and recurrent timepoints profiled using single-cell RNA sequencing.

  Dataset EGAD00001007772

• Whole-Exome Sequencing and Targeted DNA Sequencing of Matched Ocular Melanocytosis and Uveal Melanoma

  Ocular melanocytosis is the most important predisposing condition for the eye cancer uveal melanoma (UM). Here we used whole-exome and deep targeted sequencing to identify for the first time a clonal Gq pathway mutation in ocular melanocytosis, which gave rise to UM. Additionally, we elucidated the order in which canonical genetic aberrations were acquired during tumor evolution. These findings provide a mechanistic explanation for the well-known clinical association of ocular melanocytosis with UM, and they provide new insights into UM tumor evolution. Reprinted from: Durante MA, Field MG, Sanchez MI, Covington KR, Decatur CL, Dubovy SR, Harbour JW. Genomic evolution of uveal melanoma arising in ocular melanocytosis, with permission from Cold Spring Harbor Molecular Case Studies.

  Study phs001835

• Genomic characterization of esophageal squamous cell carcinoma reveals critical genes underlying tumorigenesis and poor prognosis

  The genetic mechanisms underlying the poor prognosis of esophageal squamous cell carcinoma (ESCC) are not well understood. In this study, we comprehensively characterized somatic mutations, copy number alterations (SCNAs)/structural variants (SVs) found in ESCC from sequencing 10 whole-genome and 57 whole-exome matched tumor-normal pairs. We identified multiple somatic mutations seen previously in known cancer pathways and identified candidate genes for ESCC including VANGL1 and MIR4707. A survival analysis based on the expression profiles of 321 ESCC individuals indicated that the somatically altered genes we found were significantly associated with ESCC poorer survival. Subsequently, we performed functional studies to validate the roles of the altered genes in tumor proliferation and metastasis.

  Study EGAS00001001723

• Genomic data used in "ACT-Discover: identifying karyotype heterogeneity in pancreatic cancer evolution using ctDNA"

  Genomic data used in "ACT-Discover: identifying karyotype heterogeneity in pancreatic cancer evolution using ctDNA"

  Dataset EGAD00001010250

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• DAC for Studies of "Genetics and Genomics of Cardiovascular Diseases" Group at MDC Berlin, Germany

  DAC for Studies of "Genetics and Genomics of Cardiovascular Diseases" Group at MDC Berlin This is an umbrella DAC.

  Dac EGAC50000000481

• Dual inhibition of FLT3 and BCL-2 is effective in preclinical models of BCL11B-activated lineage ambiguous leukemia

  Aberrant activation of BCL11B (“BCL11B-a”) defines a subtype of lineage ambiguous leukemias with T-lymphoid and myeloid features, co-occurring activating FLT3 mutations, and a stem/progenitor immunophenotype and gene expression profile. As with other lineage ambiguous leukemias, optimal treatment is unclear and there are limited targeted therapeutic options. Here, we investigated the efficacy of BCL-2 and FLT3 inhibition with venetoclax and gilteritinib, respectively, in preclinical models of BCL11B-a leukemia. Despite variation in response to single agent therapies, the combination of venetoclax plus gilteritinib was highly effective in all models evaluated. BH3 profiling and single cell RNA-seq analysis suggests that resistance to venetoclax and/or gilteritinib monotherapies is due to the tumor-intrinsic activity of BCL-xL and/or MCL-1 prior to drug treatment. These data support clinical evaluation of venetoclax in combination with gilteritinib in BCL11B-a lineage ambiguous leukemias.

  Study EGAS50000000978

• Organoid drug profiling identifies methotrexate as a therapy for SCCOHT, a rare pediatric cancer

  Small cell carcinoma of the ovary, hypercalcemic type (SCCOHT) is a rare and lethal tumor in adolescent and young adult patients. Currently, there is no standard-of-care treatment for these patients. Reliable models that represent this disease and can be used for translational research are scarce. To model SCCOHTs, we have established eight patient-derived tumoroid lines from tumor lesions of three patients with SCCOHT. The tumoroids recapitulate genomic and transcriptomic characteristics of the corresponding patient tumors and capture intrapatient tumor heterogeneity. Organoid drug profiling using a library of 153 clinical compounds identified methotrexate as an effective and selective drug against SCCOHTs with a clinically relevant IC50 of 35 nmol/L. RNA sequencing demonstrated that methotrexate induced TP53 pathway activation and apoptosis. These data underscore that organoid technology can support the design of therapeutic strategies for rare cancers.

  Study EGAS00001007911

• Single-cell and spatial transcriptomic profiling of hormone-naïve localised prostate cancer

  Localised prostate cancers (PCa) are heterogeneous and multifocal, with diverse outcomes. Current prognostic methods are epithelium-centric, overlooking the complex cellular landscape within the tumour microenvironment (TME), which remains incompletely characterised. We performed a comprehensive analysis of cancerous and adjacent-benign cores from 24 patients with hormone therapy-naïve localised PCa using single-cell RNA-sequencing. By integrating copy number variation and transcriptional signatures, we classified epithelial cells across a malignant spectrum, revealing widespread molecular perturbation. We found an expansion of Club cell phenotypes, suggestive of Luminal dedifferentiation. We also performed a detailed annotation of stromal phenotypes, focusing on fibroblasts, and identified a novel peri-neural fibroblast population. Spatial transcriptomics elucidated the precise anatomical distribution of CAFs within the PCa TME. This study provides a valuable foundation for advancing our understanding of PCa pathobiology and developing a comprehensive cellular model of the disease.

  Study EGAS00001008332

• Gene-Specific RNA Sequencing in PLCG2-Associated Immune Dysregulation with Cold Urticaria

  This study utilized gene-specific RNA-sequencing of PLCG2 to screen for disease causing in-frame exon-skipping transcripts of PLCG2 in a collection of 9 subjects with cold urticaria, 2 subjects with known PLCG2-associated antibody deficiency and immune dysregulation (PLAID)-causing deletions of PLCG2 (positive controls) and 3 healthy subjects (negative controls). Full length cDNA of PLCG2 was generated using gene specific reverse transcription of peripheral blood mononuclear cell RNA. The full length PLCG2 cDNA was used as the template to create Illumina sequencing libraries. To identify the underlying genetic basis for the exon-skipping transcripts, trio-based whole genome sequencing was performed for probands in whom in-frame exon-skipping transcripts of PLCG2 were identified.

  Study phs003807

• Germline and Somatic Genetic Landscape of Pediatric Rhabdomyosarcoma

  Dynamic approaches that integrate population-based research and molecular biology are needed to explain the mechanisms underlying pediatric rhabdomyosarcoma (RMS) and to determine novel prevention strategies. RMS, the most common soft-tissue sarcoma in children and adolescents, has one of the poorest 5-year survival rates among all pediatric cancers (less than 65%). One of the strongest risk factors for RMS is having a cancer predisposition syndrome. The syndromes that are most commonly seen among those with RMS are Li-Fraumeni, neurofibromatosis type 1, Costello, Noonan, and DICER1. Based on smaller clinic-based studies, only about 7% of RMS cases are thought to be associated with the genes responsible for these syndromes. However, there have been no population-based assessments to support this estimate. Even in the most recent large-scale evaluations of germline mutations in predisposition genes among children with cancer, very few RMS cases were included (43 cases). Furthermore, no distinctions were made between the major histologic subtypes of RMS: embryonal (eRMS) and alveolar (aRMS), which display differences in terms of age distribution, incidence, and cytogenetics. For instance, nearly 80% of alveolar cases are driven by a chromosomal translocation between either PAX3 or PAX7 and FOXO1, whereas these fusions are not seen in embryonal cases. In fact, RMS research is shifting from categorization based on histology to fusion status (eRMS is overwhelmingly fusion-negative). Another limitation in previous studies has been the inability to evaluate the frequency of de novo germline mutations (DNMs) in cancer predisposition genes due to the absence of any well-characterized cohorts of RMS case-parent trios. Therefore, a major gap in our understanding of the role of cancer predisposition in pediatric RMS that limit translational impact is there have been no population-based assessments to determine the true impact of these mutations on pediatric RMS, which limits clinical sequencing guidelines and surveillance protocols in these children.Overall Project Strategy: The objective of this project is to advance our understanding of the relationship between cancer predisposition genes and pediatric RMS. Our central hypotheses are: 1) mutations in cancer predisposition genes are more common than expected in children with RMS; and 2) children with fusion-negative tumors have a higher burden of germline mutations than those with fusion-positive tumors. The framework for this study relies on >600 well annotated samples collected from newly diagnosed RMS patients and stored in the Children’s Oncology Group (COG) Biopathology Center.

  Study phs002304

• M116 scRNA-seq

  scRNA-seq was performed using Chromium Next GEM Single Cell 3’ Kit v3.1 (10X Genomics) according to the manufacturer’s instructions. Briefly, M116's PBMCs were thawed and quantified in order to calculate the number of cells to be loaded. Then, barcoded Single Cell 3ʹ Gel Beads, a master mix containing PBMCs, and Partitioning Oil were combined onto the Chromium Next GEM Chip G to generate Gel Beads-In-Emulsion (GEMs), where polyadenylated mRNAs were reverse transcribed. This way, all generated cDNAs from the same cell shared a common 10X Barcode. Following the reverse transcription, GEMs were broken and cDNAs were amplified and cleaned up with SPRIselect beads (Beckman Coulter®). Next, a portion of these cDNAs were enzymatically fragmented and subjected to adaptor ligation before using them as a PCR template for the incorporation of i5/i7 indexes. Finally, libraries were purified with SPRIselect beads, quantified and quality checked by using the 2200 TapeStation (Agilent®), and subjected to paired-end 150-bp sequencing (Novaseq systems, Illumina®) following standard practices at external facilities (Novogene®). Files types included in this dataset are raw Fastq files.

  Dataset EGAD50000001289

• Single cell RNA sequencing of synovial B cells in early Rheumatoid Arthritis

  Rheumatoid Arthritis (RA) is a prevalent autoimmune disease characterized by inflammation of the peripheral joints and occurence of autoantibodies, i.e. Rheumatoid Factor (RF) and anti-citrullinated protein antibodies (ACPA), in circulation. Previous studies have shown that there are memory B cells and autoantibody producing plasma cells present in the joint tissue of patients with long-standing RA. However, it has remained unclear, whether these B cell populations are already present in the joint tissue of patients at the disease onset and whether these are autoreactive. Here, we used a single cell RNA sequencing approach to dissect the B cell repertoire at this early timepoint. We found evidence for B and T cell interaction and presence of memory and plasma cell pools in ACPA- and ACPA+ RA. Our results demonstrated clonal relationships between the memory and plasma cell compartments and autoreactivity within the plasma cell pool. These findings challenge our understanding of the local adaptive immune response in the joints of ACPA- and ACPA+ RA patients with direct implications for B and T cell targeting therapy in both patient subgroups.

  Study EGAS00001005144

• Single-cell RNA-sequencing of rhabdomyosarcoma tumour tissue (2025-09-30)

  This study investigates high-risk rhabdomyosarcoma (RMS) using multiple single-cell and spatial genomic technologies. We generated and analysed single-cell and single-nucleus RNA-sequencing, chromatin accessibility, and spatial transcriptomics data from primary tumours and validation samples. These datasets characterise cellular diversity within rhabdomyosarcoma and identify cell states associated with aggressive disease. The data support research into tumour biology, risk stratification, and therapeutic target discovery. This repository houses the single-cell RNA sequencing of RMS tumours data. . This dataset contains all the data available for this study on 2025-09-30.

  Dataset EGAD00001015710

• Single-cell RNA-sequencing of rhabdomyosarcoma tumour tissue (2025-09-30)

  This study investigates high-risk rhabdomyosarcoma (RMS) using multiple single-cell and spatial genomic technologies. We generated and analysed single-cell and single-nucleus RNA-sequencing, chromatin accessibility, and spatial transcriptomics data from primary tumours and validation samples. These datasets characterise cellular diversity within rhabdomyosarcoma and identify cell states associated with aggressive disease. The data support research into tumour biology, risk stratification, and therapeutic target discovery. This repository houses the single-cell RNA sequencing of RMS tumours data. . This dataset contains all the data available for this study on 2025-09-30.

  Dataset EGAD00001015717

• Singel-cell RNA sequencing and CUT&RUN sequencing of human RUNX2-deficient osteoblasts

  Runx2 is a master regulator of bone formation, and its dysfunction causes cleidocranial dysplasia (CCD) in humans. When iPS cells were generated from patients with CCD and Runx2-deficient iPS cells were generated using gene-editing techniques, abnormal laminopathy-like nuclei were observed. Runx2-deficient cells showed reduced Lamin A/C expression, but not protein levels. However, in Runx2-deficient cells, both the gene expression and protein levels of Nesprin-1 were reduced, perinuclear actin fibers were sparser, and nuclear stiffness was reduced. Forced expression of Lamin A/C increased nuclear stiffness but did not improve nuclear morphology. In contrast, the induction of Nesprin-1 expression alone normalized nuclear stiffness and restored nuclear morphology and perinuclear actin distribution. In Runx2-null cells, mechanical stress-induced phosphorylation of emerin was not observed. In contrast, forced expression of nesprin-1 in Runx2-null cells resulted in phosphorylation of emerin, indicating the restoration of intracellular tension. These observations were confirmed by atomic force microscopy. Therefore, the intracellular tension was inferred to pull the nuclear membrane into its normal shape. CUT&RUN assay and single RNA-seq analysis showed that an aberrant nuclear membrane caused loss of nuclear lamina gene regulation machinery, making the progression of normal osteogenic differentiation impossible; however, supplementation with Nesprin-1 restored gene regulation mechanisms and promoted pre-osteoblast formation with normal nuclear morphology. Nesprin-1 expression induced by Runx2 is essential for epigenetic regulation of the nuclear lamina. We propose CCD as a new type of laminopathy involving defective expression of Nesprin-1 regulated by Runx2.

  Study JGAS000663

• Identification of Novel Therapeutic Targets for Calcific Aortic Valve Stenosis Using Integrative Genomics

  In order to identify novel therapeutic targets for calcific aortic valve stenosis, we have generated a large transcriptomic dataset from RNA sequencing of human aortic valve tissues from 500 individuals undergoing aortic valve replacement or heart transplant at the Institut universitaire de cardiologie et de pneumologie de Québec – Université Laval (QUEBEC-CAVS-RNA). This dataset represents a unique resource to understand the molecular mechanisms underlying aortic valve diseases.

  Study phs003541

• ADAGESIII: Contribution of genotype to glaucoma phenotype in African Americans

  Glaucoma results in vision loss due to damage of the optic nerve that is irreversible if undetected or untreated. The most common form of glaucoma is primary open angle glaucoma (POAG). While glaucoma affects all races, persons of African descent are disproportionately affected; studies show African-Americans (AAs) are about four to five times more likely than Caucasian Americans to develop the disease. Glaucoma is the leading cause of irreversible blindness in Americans of African descent, and the second leading cause in all Americans. The lack of understanding about the etiology of POAG impedes our ability to identify and treat it early in its development. Evidence of genetic contribution in the pathogenesis of POAG is well established. Since POAG tends to run in families, it is critical to identify the genetic basis of the disease in order to develop effective therapies for early intervention. While genome wide association studies (GWAS) for glaucoma have been completed for Caucasian populations, evidence from other studies suggests that a GWAS of glaucoma specific genes to the African-American population will yield unique and important findings for both this population and for glaucoma in general. A better understanding of the relationship among the stage of disease, the rate of change, ancestry, and other important risk factors being tracked in the ongoing African Descent and Glaucoma Study (ADAGES) will allow us to evaluate the relationship between genetics, visual loss and structural damage in this high-risk cohort. The scientific plan for this new study focuses on glaucoma in ∼2058 African-Americans by detailed phenotyping of new subjects, acquisition of samples from both new and established previously phenotyped study subjects for a repository, establishment of a data coordinating center, and genome wide association studies. The recruitment, enrollment, and phenotyping of both established and new subjects occurs at five clinical centers, University of California (UCSD), New York Eye and Ear Infirmary (Mt Sinai) and Columbia University Medical Center, a private practice in the Atlanta area, the University of Alabama at Birmingham, and the Robert Cizik Eye Clinic in Houston, TX. UCSD is also the location for the Data Coordinating Center and the Repository with Robert N. Weinreb as Principal Investigator. LA BioMed at Harbor-UCLA did the genotyping with a GWAS panel of ∼1 million single nucleotide polymorphisms (SNPs) using the Illumina MEGA array under the direction of Jerome Rotter, Ida Chen, and Kent Taylor.

  Study phs001673

• Single-cell RNA sequencing of human omental tissue in benign and metastatic ovarian cancer

  To elucidate the cellular and molecular mechanisms underlying omental homeostasis and its transformation during ovarian cancer metastasis, a human omental cell atlas was generated encompassing both benign and metastatic conditions. Single-cell RNA sequencing was performed on freshly dissociated omental tissue samples from patients with newly diagnosed benign and malignant disease. Samples collected during diagnostic surgery covered distinct anatomical regions, enabling comparison between non-metastasized omentum and sites along the metastatic gradient, including distant, peritumoral, and tumor core areas.

  Study EGAS50000001465

• Egyptref: An integrated personal and population-based Egyptian genome reference

  North African individuals are not represented in current genetic data sets. To address this issue, we generated an integrated personal and population-based Egyptian genome reference called Egyptref. Towards this end, we performed a human de novo assembly of an Egyptian individual using long PacBio reads (99x genome coverage) and polished it using Illumina short reads (90x). Variants were phased using 10x Genomics linked reads (80x). This personal genome was complemented with whole genome sequencing-based variant data of 109 further Egyptians and mitochondrial haplogroups from mtDNA sequencing of 326 further Egyptians (of which 100 individuals from EGAD00001001372/EGAD00001001380) to obtain a population-based genome. We used Egyptref for assessing the impact of genetic variation, e.g. by integration of blood RNA sequencing data of the assembly individual.

  Study EGAS00001004303

• Genomic Architecture of Progression and Treatment Response in AMD

  Numerous studies have identified common and rare genetic variation associated with risk of advanced age-related macular degeneration (AMD). However, risk is just one facet of AMD disease architecture. Both disease progression and response to treatment are two critical elements that may also be influenced by genetic variation. The primary aim of this study was to identify genetic variation influencing progression and response to treatment for AMD, with a secondary aim of further elucidating the genetic etiology of AMD risk. We ascertained AMD cases and controls of European ancestry from Vanderbilt Eye Institute (VEI) and the Bascom Palmer Eye Institute (BPEI) and obtained blood samples from all participants. Eyes were examined using standard ophthalmological methods, and graded according the modified Age-Related Eye Disease Study scale (AREDS grades 1-5) using fundus photography. Individuals were re-examined in follow-up exams at regular intervals to assess any change in AMD grade. Eyes with advanced neovascular AMD that were examined using ocular coherence tomography imaging (OCT), treated with anti-angiogenesis therapy and monitored for response to treatment. All individuals ascertained for the study were exome-chipped for genome-wide single nucleotide variation coverage. To target rare genetic variation, whole exome sequencing was performed on individuals at the phenotypic extremes based on 1) AMD grade, 2) rate of progression from intermediate to advanced AMD and 3) response to anti-VEGF treatment for eyes with advanced neovascular AMD.

  Study phs001046

• Comprehensive NGS Profiling to Enable Detection of ALK Gene Rearrangements and MET Amplifications in Non-Small Cell Lung Cancer

  We evaluate the analytical performance of the PGDx™ elio™ tissue complete assay, a 505 gene next-generation sequencing (NGS) tissue-based assay, that has now been FDA-cleared for use by physicians to help guide treatment decisions for cancer patients, using a NSCLC cohort of 38 patients.

  Study EGAS50000000010

• RNA-sequencing data from metastatic Castration-Resistant Prostate Cancer (mCRPC)

  The goal of this study is to characterize the transcriptional landscape of advanced prostate cancer

  Study EGAS00001005954

• BS-seq in plasma of CRC patients

  We performed whole genome bisulfite sequencing of plasma DNA in 11 colorectal cancer patients to study the colonic DNA in plasma.

  Study EGAS00001003117

• 16S rRNA-Seq of rectal mucus from patients suspected to have colorectal cancer

  Metataxonomic sequencing data targeting the 16S rRNA gene hypervariable regions V3 and V4 on 545 rectal mucus samples from patients suspected to have colorectal cancer and healthy controls.

  Dataset EGAD50000001803

• Common Fund (CF) Genotype-Tissue Expression Project (GTEx)

  Lay Description The aim of the Genotype-Tissue Expression (GTEx) Project is to increase our understanding of how changes in our genes affect human health and disease with the ultimate goal of improving health care for future generations. GTEx will create a database that researchers can use to study how inherited changes in genes lead to common diseases. GTEx researchers are studying genes in different tissues obtained from many different people. The GTEx project also includes a study of the GTEx donor consent process - this study will help ensure that the consent process and other aspects of the project effectively address the concerns and expectations of participants in the study. GTEx is a pioneering project that uses state-of-the-art protocols for obtaining and storing a large range of organs and tissues, and for testing them in the lab. Until now, no project has analyzed genetic variation and expression in as many tissues from the same person in such a large population as planned for GTEx. Scientific Description Understanding the role of variation in the human genome is crucial to elucidating genetic contributions to human health and disease. Despite the results of genome-wide association studies (GWAS) documenting strong statistical associations between genetic variation and human traits, the functional role for most of these variants is largely unexplained. Nearly 90% of these GWAS-implicated sites lie outside of protein-coding sequences, suggesting that these variants might regulate gene expression. The goal of the Genotype-Tissue Expression (GTEx) project is to establish a resource database and tissue biobank in which to study the relationship between genetic variation and gene expression and other molecular phenotypes in reference/non-diseased tissues. The ultimate resource will include approximately 960 post-mortem donors with several dozen tissues from each, a resource large enough to study both cis- and trans- gene expression quantitative trait loci (eQTLs). Some tissue will also be banked for additional molecular analyses. To request biosamples, please see the Biobank page for more information. GTEx was initially funded as a 2-year pilot project by the NIH Common Fund (CF) in 2010, and has been scaled up after demonstration of feasibility. The project will collect and analyze RNA levels in many different human tissues and each donor will be characterized for germline genetic variation through dense genotyping arrays and sequencing of either whole exomes or whole genomes. By treating RNA expression levels as quantitative traits, eQTLs will be identified as sites containing genetic variation that correlate with changes in RNA expression. Such eQTLs have been associated with 4%-12% of expressed human genes, and with common complex human diseases, including obesity, atherosclerosis, type 2 diabetes, Crohn's disease, and asthma. Additionally, few studies have examined the tissue specificity of eQTLs. A subset of banked tissue samples will also be analyzed for other molecular phenotypes, such as DNA methylation, DNaseI hypersensitivity sites, and proteomics. The GTEx project will thus serve as a resource database and tissue bank for many future studies, especially for understanding the functional basis of inherited susceptibility to disease. All GTEx releases since Version 5 follow the NIH Genomic Data Sharing (GDS) Policy whereby there are no restrictions on use or publication after release. Additional information about the GTEx Data Release and Publication policy can be found on the GTEx Data Portal at www.gtexportal.org.

  Study phs000424

• Ither2 RNA-Seq dataset - Implementation of pediatric precision oncology into clinical practice: The individualized Therapies for Children with cancer program “iTHER”

  iTHER is a prospective national precision oncology program aiming to define tumor molecular profiles in children and adolescents with primary very high-risk, relapsed, or refractory pediatric tumors in order to identify relevant aberrations to inform treatment.

  Dataset EGAD00001010179

• A novel orthotopic patient-derived xenograft model of radiation-induced glioma following medulloblastoma

  Radiation-induced glioma (RIG) is a highly aggressive brain cancer arising as a consequence of radiation therapy. We report a case of RIG that arose in the brain stem following treatment for paediatric medulloblastoma, and the development and characterisation of a matched orthotopic patient-derived xenograft (PDX) model (TK-RIG915). Patient and PDX tumours were analysed using DNA methylation profiling, whole genome sequencing (WGS) and RNA sequencing. While initially thought to be a diffuse intrinsic pontine glioma (DIPG) based on disease location, results from methylation profiling and WGS were not consistent with this diagnosis. Furthermore, clustering analyses based on RNA expression suggested the tumours were distinct from primary DIPG. Additional gene expression analysis demonstrated concordance with a published RIG expression profile. Multiple genetic alterations that enhance PI3K/AKT and Ras/Raf/MEK/ERK signalling were discovered in TK-RIG915 including an activating mutation in PIK3CA, upregulation of PDGFRA and AKT2, inactivating mutations in NF1, and a gain-of-function mutation in PTPN11. Additionally, deletion of CDKN2A/B, increased IDH1 expression, and decreased ARID1A expression were observed. Detection of phospho-S6, -4EBP1 and -ERK via immunohistochemistry confirmed PI3K pathway and ERK activation. Here, we report one of the first PDX models for RIG, which recapitulates the patient disease and is molecularly distinct from primary brain stem glioma. Genetic interrogation of this model has enabled the identification of potential therapeutic vulnerabilities in this currently incurable disease.

  Study EGAS00001004709

• Transcriptomic Profiling after B-Cell Depletion Reveals Central and Peripheral Immune Cell Changes in Multiple Sclerosis

  We investigated the immunological effects of B cell depletion therapy using ocrelizumab in treatment-naïve relapsing-remitting multiple sclerosis (RRMS) patients. Our primary aim was to delineate transcriptomic alterations in immune cell populations in peripheral blood before and after therapy, using single-cell RNA sequencing (scRNAseq). This study included 18 newly diagnosed, treatment-naïve RRMS patients who provided matched pre- and 6-month post-treatment peripheral blood mononuclear cells (PBMCs). A secondary cohort of five patients also contributed paired cerebrospinal fluid (CSF) samples. All RRMS patients were treated with ocrelizumab, except one patient in the CSF cohort who received rituximab.

  Study phs003938

• Genetic measurement of memory B-cell recall using antibody repertoire sequencing

  We developed an improved high throughput sequencing approach to measure the quantities and sequences of the repertoire of antibody heavy chain RNA in a blood sample. Using this approach we analyzed the antibody repertoire in response to yearly vaccinations with influenza vaccines TIV and LAIV in healthy adults in two subsequent years. We determined vaccine response patterns specific to LAIV and TIV and found antibody sequences that were shared between two samples of the same individuals following influenza vaccination in subsequent years, thereby providing a genetic measurement of B-cell memory recall.

  Study phs000656

• RNA-Sequencing of cervical cancers

  We used RNA sequencing of 81 cervical cancer specimens to developed an immune-based gene expression signature to predict distant metastasis in cervical cancer patients treated with RT/cisplatin. Our 55-gene risk score, validated across independent cohorts, was strongly linked to higher rates of metastasis and lower survival. The score also correlated with higher copy-number alteration and a less immune-responsive tumor microenvironment, indicating its potential in identifying high-risk patients and informing targeted therapies.

  Dataset EGAD50000000120

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• VA APOLLO Project - Research for Precision Oncology (RePOP)

  The Research for Precision Oncology Program (RePOP) is a research activity that establishes a cohort of Veterans diagnosed with cancer and who have had genomic analyses performed on their tumor tissue as part of standard of care. All data relevant to a patient's cancer and cancer care will be collected under RePOP, including patient demographics, co-morbidities, genomic analysis, treatments, medications, lab values, imaging studies, and outcomes. All RePOP participants will have signed/verbal informed consent and signed HIPAA authorization to have their data stored and shared from RePOP's Precision Oncology Program Data Repository (PODR). The Applied Proteogenomics OrganizationaL Learning and Outcomes (APOLLO) network is a collaboration between NCI, the Department of Defense (DoD), and the Department of Veterans Affairs (VA) to incorporate proteogenomics into patient care as a way of looking beyond the genome, to the activity and expression of the proteins that the genome encodes. The emerging field of proteogenomics aims to better predict how patients will respond to therapy by screening their tumors for both genetic abnormalities and protein information, an approach that has been made possible in recent years due to advances in proteomic technology.

  Study phs001374

• RNA-sequencing of tumors from 45 patients with recurrent or metastatic gastric cancer treated with immune checkpoint inhibitors

  Dac EGAC00001002295

• RNA sequencing of Non-Small Cell Lung Cancer and adjacent normal tissue (ICON)

  RNA sequencing was performed on 108 NSCLC tumor samples and their paired adjacent normal tissues (n=21) to identify associations with clinical and immune characteristics.

  Dataset EGAD50000000361

• RNA sequencing data of high-grade serous ovarian cancer samples

  RNA sequencing data of over 200 HGSOC samples at diagnosis, after chemotherapy and during progression.

  Dataset EGAD00001006456

• MicroRNA Biomarkers for Prediction of Preeclampsia

  Maternal serum was collected between 17-28 weeks gestation. Samples were obtained from the high-risk Placental Study at the University of California, San Diego (n=48) and from the average-risk Proteomic Assessment of Preterm Risk (PAPR) Study at Sera Prognostics (n=164). RNA was extracted from 500 microliter of maternal serum using the miRNeasy Micro kit (Qiagen). NEBNext Small RNAseq Library Preparation Kit was used for library construction.

  Study phs002016

• Bulk RNAseq FASTQ files of WNT7B reporter PDAC organoids (P28 and P40) sorted by mNeonGreen high and low

  This dataset contains raw FASTQ files from bulk RNA sequencing of two patient-derived PDAC organoid lines (P28 and P40) carrying a WNT7B reporter knock-in. Organoids were sorted into mNeonGreen high (WNT-high) and low (WNT-low) populations, with three biological replicates per sorted population. RNA was extracted using the Qiagen QiaSymphony SP system, and libraries were prepared with the Illumina Truseq stranded polyA kit. Sequencing was performed on an Illumina NextSeq2000 platform using single-end 50bp reads. Quality control was conducted with FastQC, and reads were trimmed with TrimGalore as appropriate. Data are controlled-access and intended for transcriptomic analysis of WNT7B expression-dependent transcriptional programs in PDAC organoids.

  Dataset EGAD50000002218

• Transcriptomic profiling of myeloid cells from secondary lymphoid organs (lymph nodes and tonsils) from lymphoma patients and controls.

  Despite their recognized impact on the pathogenesis and prognosis of B-cell lymphoma, tumor-associated macrophages (TAM) have not been extensively explored in diffuse large B-cell lymphoma (DLBCL) and follicular lymphoma (FL). We investigated mononuclear phagocyte (MNP) heterogeneity using single cell RNA sequencing (scRNAseq) in B-cell lymphoma lymph nodes compared to reactive secondary lymphoid organs (lymph nodes and tonsils).

  Study EGAS50000001135

• HG Transcriptome sequencing in the INTERVAL cohort

  We performed bulk RNA-sequencing on peripheral blood collected from 4,732 blood donors recruited as part of the INTERVAL study. Using these data, we mapped gene expression and splicing quantitative trait loci (QTLs). Then, we integrated these data with protein, metabolite and lipid QTLs in the same individuals. The study aimed to identify the shared genetic etiology across transcriptional phenotypes, molecular traits and health outcomes in humans.

  Study EGAS00001003346

• Multiomics Characterization of Low-grade Serous Ovarian Carcinoma

  Low-grade serous ovarian carcinoma (LGSOC) is a rare tumor subtype with high case fatality rates. There is a pressing need to develop effective treatments using newly available preclinical models for therapeutic discovery and drug evaluation. In this study, we use multiomics integration of whole exome sequencing, RNA sequencing, and mass spectrometry-based proteomics on fourteen LGSOC patient derived cell lines to elucidate novel biomarkers and therapeutic vulnerabilities.

  Study EGAS00001004724

• Hepatitis B virus integrations promote local and distant oncogenic driver alterations in hepatocarcinogenesis

  This study contain the WGS and WEX aligned bam files and RNA-seq fastq files for human liver tumors.

  Dataset EGAD00001006426

• SARS-CoV2 mRNA-vaccination-induced Immunological Memory in Human Non-Lymphoid and Lymphoid Tissues

  This dataset includes combined single-cell RNA-Seq and T cell receptor profiling data for SARS-CoV-2 spike protein-reactive CD4+ T cells and NK cells from blood, liver, lungs, and bone marrow of human donors.

  Dataset EGAD50000000062

• Oxidative DNA damage and ubiquitin proteasome system dysfunction underpins neurodegeneration in young adults with a DNA repair disorder

  Deposited here are time series bulk RNA-seq data generated from XP patients and controls as well as rescued patient hiPSC cells during cortical neuronal differentiation.

  Dataset EGAD50000000230

• Oxidative DNA damage and ubiquitin proteasome system dysfunction underpins neurodegeneration in young adults with a DNA repair disorder

  Deposited here are time series bulk RNA-seq data generated from isogenic wild-type (WT), XPA and XPG gene knockouts hiPSC cells during cortical neuronal differentiation.

  Dataset EGAD50000000228

• Tumor Profiler Project - AML scRNA data

  The dataset contains single-cell RNA seq data from 23 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000823

• DAC for "Resolving spatial subclonal genomic heterogeneity of loss of heterozygosity and extrachromosomal DNA in gliomas"

  This DAC will be created for sequencing data for the manuscript "Resolving spatial subclonal genomic heterogeneity of loss of heterozygosity and extrachromosomal DNA in gliomas." The dataset includes Illumina-based exome sequencing of tumor specimens, paired blood specimens, bulk RNA-seq, and Visium FFPE.

  Dac EGAC50000000579

• Genome editing strategies to generate working models in Polycystic Kidney Disease

  Bulk RNA-seq of genome-edited HEK293T cell lines engineered to model specific PKD1 variants. These clones were created with the purpose of enabling the exploration of genotype-phenotype correlations in Polycystic Kidney Disease (PKD)

  Dataset EGAD50000001694

• WES, ultra-deep sequencing exome and RNAseq data of diseased liver samples

  1. Utra-deep exome sequencing data, illumina pair-end reads, fastq, 190 samples 2. WES data, illumina pair-end reads, fastq, 120 samples 3. RNA-seq data, illumina, pair-end reads, fastq, 20 samples

  Dataset EGAD00001004792

• single-cell RNA sequencing data of BALF and blood cells obtained from COPD patients and control donors

  The dataset consists of FASTQ files from Seq-Well and some Chromium (10x Genomics) libraries from 10 control donors and 10 COPD GOLD2 patients.

  Dataset EGAD00001006069

• Merged single-cell RNA-seq data for 22 Hodgkin lymphomas and 5 reactive lymph nodes

  This dataset contains merged data from the 22 Hodgkin lymphoma and 5 reactive lymph node samples, including count data and cell cluster assignments.

  Dataset EGAD00001006221

• Single-cell RNA-seq counts and merged data for 28 Hodgkin lymphomas and 5 reactive lymph nodes

  This dataset contains raw count data (10X CellRanger) for 28 Hodgkin lymphoma samples and 5 reactive lymph nodes, and merged data from all samples (RData object) including cell cluster assignments.

  Dataset EGAD00001008270

• RNA-seq dataset of Ewing and Ewing-like-sarcoma tumoroid biobank reveals distinct drug sensitivities: translocation makes the difference

  Creation of living organoid biobank for ewing and ewing-like sarcomas

  Dataset EGAD00001015419

• scRNAseq: Human liver cholangiocyte organoids capture the heterogeneity of in vivo human liver ductal epithelium

  Liver ductal organoids expanded in either conventional (Huch et al., 2015) or refined medium were split and seeded either in the same medium or in DM+. They were sequenced on day 10 after splitting. Droplet-based scRNA-seq was performed using the 10x Genomics Chromium Single Cell Kit v3, and libraries were sequenced on an Illumina NovaSeq 6000 S4. Raw sequencing data were processed using Cell Ranger software (v6.0.1) with the human genome reference (hg38) and gene annotation (Ensembl 98). Dataset integration and downstream analysis were mainly performed using Seurat (v4.3.0.1) with R v4.1.3 “One Push-up”.

  Dataset EGAD50000001464

• ANGIOPREDICT - an FP7-funded project enabling personalised medicine for patients with metastatic colorectal cancer.

  In ANGIOPREDICT, academic cancer biologists and industry-based biotechnology researchers will work together with clinicians to identify biomarkers to predict whether individual metastatic colorectal cancer patients will respond positively to Avastin® combination therapy. Diagnostic tests using these biomarkers will also be developed to provide clinicians with the means to predict patient treatment responses in the future.

  Study EGAS00001005423

• Cell-Free DNA Genomic Profiling and its Clinical Implementation in Advanced Prostate Cancer

  Sixty-eight patients with advanced prostate cancer in castration-resistant or castration-sensitive settings undergoing treatment at the University Hospital Basel or the St. Claraspital Basel (Switzerland) were selected for targeted parallel sequencing analysis on liquid biopsy (plasma cfDNA) and matched formalin-fixed, paraffin-embedded (FFPE) tumor tissue samples. The liquid biopsy sequencing (plasma cfDNA) was performed using a custom-designed targeted AmpliSeq HD Prostate Cancer cfDNA panel on all 68 patients. The sequencing on 42 matched FFPE tumor biopsy samples was performed using a custom-designed or an alternative commercial panel (ThermoFisher). Raw data underwent automated processing on the Ion Torrent Server v5.16.1 (ThermoFIsher) and were aligned to a hg19 reference genome using the Torrent Alignment Software (ThermoFihser).

  Dataset EGAD50000000348

• The Haplotype-Resolved Genome and Epigenome of the Aneuploid HeLa Cancer Cell Line

  The genomic architecture of HeLa remains largely unexplored beyond its karyotype, partly because like many cancers, its extensive aneuploidy renders such analyses challenging. We carried out haplotype-resolved whole-genome sequencing of the HeLa CCL-2 strain, examined point- and indel-mutation variations, mapped copy-number variations and loss of heterozygosity regions, and phased variants across full chromosome arms. We also investigated variation and copy-number profiles for HeLa S3 and eight additional strains. We find that HeLa is relatively stable in terms of point variation, with few new mutations accumulating after early passaging. Haplotype resolution facilitated reconstruction of an amplified, highly rearranged region of chromosome 8q24.21 at which integration of the human papilloma virus type 18 (HPV-18) genome occurred and that is likely to be the event that initiated tumorigenesis. We combined these maps with RNA-seq and ENCODE Project data sets to phase the HeLa epigenome. This revealed strong, haplotype specific activation of the proto-oncogene MYC by the integrated HPV-18 genome approximately 500 kilobases upstream, and enabled global analyses of the relationship between gene dosage and expression. These data provide an extensively phased, high-quality reference genome for past and future experiments relying on HeLa, and demonstrate the value of haplotype resolution for characterizing cancer genomes and epigenomes. Reprinted from Adey et. al. 2013, Nature, with permission from Nature Publishing Group.

  Study phs000642

• Advanced Genetic and Molecular Analysis of Solid Tumors

  This study is designed to understand the role of immunosuppressive regulatory B cells (Breg) in pancreatic cancer. Breg and conventional B cells (Bcon) from patients are compared by RNA sequencing analysis. Bregs and Bcon were isolated from freshly isolated PBMCs in peripheral blood. These data represent the examination of differentially expressed genes in these two blood-derived B cell subsets from both healthy and pancreatic cancer patients.

  Study phs001999

• WES for CNV-verified CTCs enriched by high-throughout microfluidic device from entire cancer patient leukopak

  WES analysis (illumina platform, PE150, 100x coverage) was performed on a pool of copy number variation (CNV)-verified CTCs that were enriched using high-throughout microfluidic device from entire leukopak from patients with metastatic prostate cancer (GU-1 and GU-2).

  Study EGAS50000000724

• The dataset for Detecting Liver Cancer Using Cell-Free DNA Fragmentomes

  The dataset for Detecting Liver Cancer Using Cell-Free DNA Fragmentomes includes 444 BAM files from whole genome next-generation sequencing on the Illumina NovaSeq 6000. The samples analyzed include plasma samples from individuals with and without cancer.

  Dataset EGAD00001010931