12277 results for ""statistically+reactive"+taxa+in+microbial+community"

in 33.08 milliseconds.

• Discovery of genetic factors associated with thiopurine-induced severe adverse events

  Despite NUDT15 variants showing significant association with thiopurine-induced adverse events (AEs) in Asians, it remains unclear whether additional genetic variants should be tested to predict AEs. To clarify it, we performed a genome-wide association study to discover additional variants associated with thiopurine-induced severe AEs, alopecia and leukopenia. GWASs of these AEs were performed with 1221 Japanese patients with inflammatory bowel disease using population-optimized genotyping array and imputation.

  Study JGAS000661

• Hashed data from three immortalized fibroblastic reticular cells (iFRCs)

  Co-culture experiments of primary lymphoid and DLBCL-derived immortalized FRCs (iFRC) followed by scRNA-seq. iFRCs as well as lymphocytes from DLBCL samples (n=3) were harvested after 24h of incubation and different experimental conditions were multiplexed using in-house cell multiplexing oligonucleotides (CMOs; full list of barcodes provided in Table S9). Cells were incubated with CMOs at a final concentration of 1.8 μM for 20 minutes on ice, followed by four washes with PBS (centrifugation at 400 × g for 3 minutes at 4 °C). Single-cell RNA sequencing (scRNA-seq) and multiplexing libraries were prepared using the 10x Genomics Single Cell 3′ Gene Expression v4 assay, according to the manufacturer’s protocol. Sequencing was performed on an Illumina NovaSeq 6000 platform using paired-end 100 bp reads on an S4 flow cell.

  Dataset EGAD50000001779

• Deciphering the aggressive nature of morphoeic basal cell carcinoma

  Morphoeic basal cell carcinoma (mBCC) has a high risk of local recurrence compared to the more indolent nodular subtype reflected by a different set of driver mutations including FLNB and HECTD4. Surrounding mBCC stroma is abnormal, containing mutations such as EPHA3. Hedgehog pathway over-expression is seen in both the tumour and stroma of morphoeic tissue with the latter potentially being partly responsible for its aggressive nature and risk of recurrence.

  Study EGAS00001001915

• Broad utility of ultrasensitive analysis of ctDNA dynamics across solid tumors treated with immunotherapy

  Plasma ctDNA sequencing data from samples collected from a pan-cancer cohort of patients with advanced-stage disease treated with IO therapies. This study highlights the broader applicability of ultrasensitive ctDNA as a biomarker across cancer types and immunotherapy modalities. Here, we applied a whole-genome, tumor-informed approach to study ctDNA in 202 advanced-stage cancer patients treated at VHIO. This study captures the plasma sequencing data from the project.

  Study EGAS50000001271

• ecDNA copy number heterogeneity

  Neuroblastoma exhibits significant inter- and intra-tumour genetic heterogeneity and varying clinical outcomes. Here, we used DNA and RNA sequencing from the same single cells in cell lines and neuroblastoma patients to investigate these effects. We reveal extensive intercellular ecDNA copy number heterogeneity. We also provide direct evidence of how this heterogeneity influences the expression of cargo genes, including MYCN and its downstream targets, and the overall transcriptional state of neuroblastoma cells.

  Study EGAS50000000509

• RNaseq of mantle cell lymphoma patient samples

  This study presents bulk RNA sequencing data from 78 clinical mantle cell lymphoma (MCL) samples. Following rigorous quality control and batch effect correction to account for sample type and redundancy, 62 samples from 59 patients were included in the final analysis. The transcriptomic profiles capture the molecular diversity across both solid and liquid tumor contexts and support investigations into the phenotypic plasticity and metabolic states of drug-tolerant persister (DTP) cells.

  Study EGAS50000001086

• Circulating Tumor DNA Analysis Profiles of Repotrectinib in NTRK fusion–positive advanced solid tumors: a phase 1/2 trial

  The dataset contains circulating tumor DNA (ctDNA) profiles from frozen plasma samples of 593 patients from the TRIDENT-1 clinical trial. Plasma was processed with centrifugation and automated liquid handling systems, and cell-free DNA was extracted using the Qiagen QIAsymphony platform. ctDNA libraries were constructed with the Guardant360 2.11 assay, which used targeted, hybridization-based capture and barcoding of cfDNA fragments for digital analysis, followed by high-throughput sequencing on the Illumina NextSeq 550 instrument. Sequencing data were processed and interpreted using the Bioinformatics Pipeline (BIP v3.5.2 or later) for variant calling and quantification and managed within LabVantage LIMS (v3.7 or later) to support sample tracking and workflow integration. Aligned read files are provided in bam and bai formats.

  Dataset EGAD50000002249

• Bulk RNA-seq paired fastq files from i3Ns harbouring a SNCA A53T mutation, with or without RSL3 treatment

  FASTQ files from bulk RNA sequencing of a iPSC-derived rapid neuronal model (i3Ns) harbouring the SNCA A53T mutation in a WTC11 background as a model of synucleinopathy, with or without treatment of 300nM RSL3 for 6 hours. Libraries were prepared using the Watchmaker rRNA and globin depletion kit and sequenced on a NovaSeq X with an average depth of ~27 million paired-end reads with a fragment length of 100 base pairs, per sample. 19 samples are included in this dataset, each with two paired fastq files (R1 and R2). The dataset includes control neurons (WT: dcas9 parental line and C4 CRISPR control) and A53T clones (B7, H8 and L8) across two neuronal inductions (ind1 vs ind2), with or without treatment of RSL3 (UT vs. RSL3).

  Dataset EGAD50000002209

• RNA sequencing of untreated head and neck cancer patient-derived xenografts (PDXs) and matched patient tumor tissue.

  RNA sequencing was performed on untreated patient tumor tissue and matched patient-derived xenograft (PDX) models of primary head and neck squamous cell carcinoma (HNSCC). The aim of this analysis was to characterize the transcriptional landscape of the tumors in the in vivo setting. 117 total samples were sequenced with paired reads on 10 lanes from different flowcells. They were loaded as 2400 separate files to maintain the data as it was received from BGI - each sample is therefore composed of 5 separate EGAN with 4 files each, adding a 0.1 - .. - 0.5 to each BioSample ID to generate sample aliases. All R1 (and R2, separately) files referring to a BioSample ID should be concatenated to obtain fastq files corresponding to single patients or PDXs.

  Dataset EGAD50000002278

• Whole-exome sequencing (WES) analysis of untreated head and neck cancer patient-derived xenografts (PDXs) matched patient tumor tissue and normal mucosa tissue.

  WES analysis was performed on untreated patient tumor/normal mucosa tissue and matched patient-derived xenograft (PDX) models of primary head and neck squamous cell carcinoma (HNSCC) to investigate the preservation of tumor-specific genomic alterations in the in vivo context. 183 total samples were sequenced with paired reads on 8-10 lanes from different flowcells. They were loaded as 3538 separate files to maintain the data as it was received from BGI - each sample is therefore composed of 5 separate EGAN with 2-4 files each, adding a 0.1 - .. - 0.5 to each BioSample ID to generate sample aliases. All R1 (and R2, separately) files referring to a BioSample ID should be concatenated to obtain fastq files corresponding to single patients or PDXs.

  Dataset EGAD50000002325

• Policy Documentation

  Policy Documentation The following policy documentation is required to be prepared and submitted to the EGA, together with your data files and associated metadata. Data Access Agreement (DAA) The Data Access Agreement is a contract made between Data User and Data Access Committee. The agreement should be drafted by the DAC and includes, but is not limited to, details of data use, publication embargoes and storage. Completion of a DAA by the applicant/s should form part of the application process to the DAC. NOTICE The data access agreement template below is provided for guidance only and should be adapted as you see fit to suit your own purpose. In the interest of promoting data sharing, we suggest that if an agreement cannot be met around clause 19 in this example that both parties should agree to remain silent, and that the clause should be removed from the agreement. Example DAA template Alternate (harmonised) DAA template

  Documentation access/data-access-committee/policy-documentation

• Whole exome sequencing of Zimbabwean patients with suspected Mendelian disorders

  This study presents whole exome sequencing data from Zimbabwean individuals with suspected Mendelian disorders, including sickle cell disease, Fanconi anemia, haemophilia, and muscular dystrophy. The dataset includes both affected individuals and family members to support inheritance-based analyses. Variant calling was performed using the Illumina DRAGEN pipeline, with downstream variant prioritisation and interpretation conducted using the Zi-Mendelian bioinformatics pipeline. This study supports rare disease genomics and precision medicine efforts in African populations.

  Study EGAS50000001708

• High-depth whole genome sequencing of paired ductal carcinoma in-situ (DCIS) and germline control samples from 26 individuals.

  Deposited here are whole-genome sequencing data for 26 paired breast cancer DCIS and matched-normal samples taken from the same individual. Average sequence coverage is 118x for DCIS samples and 41x for matched-normals. Matched-normal samples are from blood. Sequencing was performed on an Illumina HiseqX. Due to specific restrictions imposed by the ethical approval at sample collection, the use of the germline data is restricted to filtering of somatic mutation calls only and cannot be used outside this purpose.They are a part of a broader project that uses high-depth WGS to investigate the somatic mutation genomic landscape of DCIS in order to uncover biological insights into breast cancer progression as well as possible methods to stratify DCIS patients for individualised therapy or disease monitoring.

  Dataset EGAD50000002237

• IgCaller

  IgCaller is a python program designed to fully characterize the immunoglobulin (IG) gene rearrangements and oncogenic translocations in lymphoid neoplasms from whole-genome sequencing (WGS) data. Using a cohort of 331 patients comprising different subtypes of B-cell neoplasms, we demonstrate that IgCaller identifies both heavy and light chain rearrangements providing additional information on their functionality, somatic mutational status, class switch recombination, and oncogenic IG translocations. We provided here IG reads of the previously unpublished WGS.

  Study EGAS00001004298

• Egypt_Genome_Project___low_coverage_whole_genome_sequencing

  All humans outside Africa are descendants of the same single exit, usually dated at 50-70 thousand years ago. However, the route taken out of Africa is still debated. The two main candidates are a northern route via Egypt and the Levant, or a southern route via Ethiopia and the Arabian Peninsula. We are generating genetic data to evaluate these two possibilities. In this study we propose to generate low-coverage sequencing data for 100 Egyptian samples.

  Study EGAS00001000480

• Exome_sequence_of_probands_in_Barrett_s_oesophagus_families

  Barrett?s oesophagus is common in the UK affecting 2 % of the population. Family history has beenrecorded among the 4000 Barrett's cases collected so far and have 241 families. Among them wehave assessed 6 multiplex families with proven Barrett?s and defined as having 1 pro band and atleast 3 affected first degree members. We propose to exome sequence the probands of these sixfamilies to assess the presence of pathogenic rare coding variants.

  Study EGAS00001000531

• High Altitude Pulmonary Hypertension

  The Central Asian Kyrgyz highland population provides a unique opportunity to address genetic diversity and understand the genetic mechanisms underlying hypoxia-induced high altitude pulmonary hypertension (HAPH). While a significant fraction of the population is unaffected, there are susceptible individuals who display HAPH in the absence of any lung, cardiac or hematologic disease. We report herein the analysis of the whole genome sequencing of healthy individuals compared with HAPH patients and other controls.

  Study EGAS00001003171

• Whole_Genome_Sequencing_of_JK_Family

  In collaboration with Dr David Savage, we have identified a patient with a very unusualphenotype, lacking almost all visceral fat, but showing a massive accumulation of white fattissue behind her neck and significantly elevated liver fat.Whole exome sequencing of the proband and her unaffected parents and brother has beenrun previously, however no causative variant has been found and the sequencing coveragewas generally poor. We propose to conduct whole genome sequencing of all 4 familymembers at a depth of 30X.

  Study EGAS00001001323

• UROMOL 2020 - RNA-seq data

  The molecular landscape in non-muscle-invasive bladder cancer (NMIBC) is characterized by large biological heterogeneity with variable clinical outcomes. Here, we performed a large integrative multi-omics analysis of patients diagnosed with NMIBC (n=834). Transcriptomic analysis identifies four classes (1, 2a, 2b and 3) reflecting tumor biology and disease aggressiveness. Both transcriptome-based subtyping and the level of chromosomal instability provide independent prognostic value beyond established prognostic clinicopathological parameters.

  Study EGAS00001004693

• miRNA_expression_in_response_to_LPS_stimulus_in_macrophages

  Our lab is currently using macrophages as a model system for understanding how geneticvariation modulates the response to external environmental stimulus. We want to extend thisbeyond regular polyadenylated RNA to small RNAs such as miRNAs. This project wouldcover the costs of a pilot to study miRNA response to LPS stimulus, and will be performed aspart of a rotation project in the lab. We will require a small number of miRNA libraries and asingle lane of MiSeq

  Study EGAS00001000691

• Exploration_of__mutational_processes_in_human_cancer_cell_lines__Exome

  Approximately 25 cell lines representative of 11 mutation signatures have been selected and will be grown from a single cell, referred to as parental clone, for a period of 3 months to allow accumulation of mutations. Following that period, we will obtain 2 subclones from each of the parental clone for sequencing analysis. In total we will be sequencing 2 parental clones and 4 subclones per cell line for approximately 25 cell lines.

  Study EGAS00001000790

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• Whole_genome_sequencing_of_a_Grem1_mutant_human_tumour

  The BMP antagonist Grem1 has been shown to be associated with a rare human polyposissyndrome (HMPS). We have shown that there is a 40KB duplication on chrom 15 found insome patients with HMPS. Traditional serrated adenomas (rare sporadic polyps) share somemorphological features with HMPS polyps and it has long been hypothesised that they are thesporadic version of HMPS polyps. We have obtained of one of theselesions and in this project we aim to characterise this tumour.

  Study EGAS00001000562

• WGS/RNA-seq pair of an inflammatory hepatocellular adenoma (IHCA)

  A 49 years old female patient consulted for diarrhea, rectal bleeding and lower limbs edema and was diagnosed with systemic AA amyloidosis. An inflammatory hepatocellular adenoma was further identified and resected, resulting in the improvement of amyloidosis-related symptoms. Molecular analyses of the tumor tissue revealed a somatic chromosome rearrangement responsible for interleukin-6 mRNA stabilization leading to an inflammatory acute response with serum amyloid A protein production by both neoplastic and normal hepatocytes.

  Study EGAS00001003025

• Exome sequencing of advanced hepatocellular carcinoma

  The aim of our project is to decipher the genomic of advanced hepatocellular carcinoma using whole exome sequencing. To this purpose, we aim to compare genetic landscape of advanced hepatocellular carcinoma with early tumor in order to understand the mechanisms of tumor progression. This work will also help to identify new therapeutic targets potentially useful to treat patients at advanced stage. This study contain whole exome sequencing aligned reads for 41 tumor with matched normal samples

  Study EGAS00001003130

• Tetralogy of fallot whole-exome sequencing

  829 adult and child probands of Northern European ancestry presenting with TOF were recruited from nine centres: seven in the UK, Leuven (Belgium), and Sydney (Australia). Patients sequenced exhibited no clinical features of recognised syndromes, extra-cardiac abnormalities or learning difficulties. All samples were screened for the 22q11.2 deletion associated with TOF prior to sequencing to ensure that this was not present. Samples were sequenced on HiSeq2000 and reads aligned using BWA.

  Study EGAS00001003302

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• WTCCC3_Anorexia_Nervosa

  As part of the Genetic Consortium for Anorexia Nervosa (GCAN) and Wellcome Trust CaseControl Consortium 3 (WTCCC3), we have amassed the largest anorexia nervosa (AN)sample in the world (~4,000). Following the WTCCC3 GWAS, we secured funding from theKlarman Family Foundation to extend the genetic analyses to variants on the exome chip(CoreExome array). This pre-lim relates to carrying out genotyping on the CoreExome arrayon up to a maximum of 580 new samples.

  Study EGAS00001000913

• APCDR AGV Project: Whole genome sequencing of 3 African populations (curated data)

  The African Genome Variation Project (AGVP) provides a resource to help design, implement and interpret genomic studies in sub-Saharan Africa (SSA) and worldwide. The AGVP represents dense genotypes from 1,481 and whole genome sequences (WGS) from 320 individuals across SSA. As part of the AGVP we sequenced 3 African populations; Baganda from Uganda (4x), Zulu from South Africa (4x), Gumuz, Wolayta, Oromo, Somali and Amhara from Ethiopia (8x).

  Study EGAS00001000960

• SOFT_study___sequencing_premenopausal_breast_cancer

  Our project will examine the role of PIK3CA mutations and their sensitivity to endocrine therapies and its role, with the addition of complete ovarian suppression. We plan to test our hypotheses using tumour samples collected from patients enrolled in the SOFT/IBCSG24-02 clinical study (Suppression of Ovarian Function Trial – (NCT00066690). SOFT is a phase III trial that randomised 3066 premenopausal women to evaluate if adding ovarian suppression to adjuvant endocrine therapy will improve clinical outcomes.

  Study EGAS00001000983

• cis-eQTL mapping of human pancreatic islets

  The intersection of genome-wide association analyses with physiological and functional data indicates that variants regulating islet gene transcription influence type 2 diabetes predisposition and glucose homeostasis. However, the specific genes through which these regulatory variants act remain poorly characterized. In this study, we generated eQTL data from human islet samples to establish the extent to which this allowed us to identify candidate effector transcripts at GWAS loci for T2D and glycemic traits.

  Study EGAS00001001265

• Korean Young Age Diffuse Gastric Cancers

  The incidence of diffuse gastric cancers (DGC) remains steadily high, but relatively small numbers of DGCs have been evaluated with whole exome sequencing (WES). Clinicopathological features of DGC vary according to age, but the molecular basis for these variations is unclear. To identify genomic alteration in this unique subset of gastric cancers, whole exome and SNP6 analyses were performed using frozen cancer tissue. The same analyses were also performed using blood of the same patients.

  Study EGAS00001001711

• CML_blast_phase_rearrangement_screen

  Genomic libraries (500 bps) will be generated from total genomic DNA derived from 10 Chronic Myeloid Leukemia in blast phase samples and subjected to a total of two lanes of 50 bp, paired end sequencing on the llumina HiSeq. Paired reads will be mapped to build 37 of the human reference genome to facilitate the generation of genome wide copy number information, and the identification of novel rearranged cancer genes and gene fusions

  Study EGAS00001000191

• Exome sequencing of DNA from pituitary neuroendocrine tumor (PitNET) and germline DNA from the same patient

  The goal of the project is to study tumor - normal DNA pairs from the PitNET patients. Total of 15 PitNET patients were recruited for the study to investigate sometic changes in the tumor compared to normal tissue. Illumina technology were used for sequencing and two data analysis pipelines employed for data analysis. Recurrent somatic variations were investigated and genomic disruption analysis from exome sequencing data attempted.

  Study EGAS00001004654

• Whole genome sequencing of patients affected by acute intermittent porphyria

  Acute intermittent porphyria (AIP) is an hereditary rare metabolic disorder of incomplete penetrance, affecting the biosynthesis of heme. IAP is an autosomal dominant disorder, resulting in a substantial reduction of the activity of the hydroxymethylbilane synthase coding gene (HMBS). Most HMBS mutation carriers are asymptomatic and only between 10% and 20% of patients present acute attacks of the associated symptoms. Here, we sequenced whole genomes of 16 AIP patients.

  Study EGAS00001004999

• scRNA_seq_of_circulatory_immune_cells_from_Crohn_s_disease_patient_blood

  Whole blood from Crohn's disease patients with active inflammation in the terminal ileum was depleted of red blood cells and partially depleted of granulocytes before single cell sequencing using 10X genomics 3'v3 kit followed by Illumina sequencing (HS4000 and NovaSeq) This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001004150

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• RNA-Sequencing and Somatic Mutation Status of Adrenocortical Tumors: Novel Pathogenetic Insights

  To investigate the relationship between transcriptome profile and genetic background in a large series of adrenocortical tumors and to identify new potential pathogenetic mechanisms, we performed transcriptome profiling by high-throughput sequencing. We collected snap-frozen tissue from patients with adrenocortical tumors (n = 59) with known genetic background: 26 adenomas with Cushing syndrome, 17 adenomas with mild autonomous cortisol secretion, 9 endocrine-inactive adenomas, 7 adrenocortical carcinomas. Additionally, we sequenced 4 control samples.

  Study EGAS00001004533

• Genes___Health_imputed_genotype_dataset

  Genes & Health is a cohort of British Bangladeshi and British Pakistani individuals. In the Feb2020 data freeze, 28,022 individuals were genotyped on the Illumina Infinium Global Screening Array v3 chip (with the additional Multi-Disease variants). Imputation was performed using the Michigan Imputation Server with the GenomeAsia pilot reference panel, which contains 1,739 genomes and 642 from them are from South Asian groups. This dataset contains imputed SNPs with imputation accuracy >0.3 and MAF >0.1%.

  Study EGAS00001005373

• Targeted sequencing of paired tumour/blood of 34 T1 stage bladder cancer patients

  Stage T1 bladder cancer presents a high risk of progression and requires improved understanding. In continuation of our whole-exome sequencing study on this subtype of the disease, we carried out this targeted paired tumour/blood sequencing study including 34 T1 stage bladder cancer patients. Agilent’s SureDesign tool was used to design a 1.133 Mb SureSelect custom capture for all coding exons of the 140 selected candidate genes.

  Study EGAS00001005767

• BCR_repertoire_sequencing

  Isotype-specific B-cell receptor repertoire sequencing in six immune-mediated diseases at diagnosis and during therapy reveals an unexpectedly complex B-cell architecture, which may provide a platform for a better understanding of pathological mechanisms and treatment responses. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001003185

• Single-cell RNA sequencing of 6 follicular lymphoma tumors

  Follicular lymphoma (FL) is an indolent cancer of mature B-cells but carries increased risk of transformation to a more aggressive histology over time. We present here comprehensive profiling both tumor and immune compartments in 6 diagnostic FL biopsies by single-cell RNA sequencing. This confirmed results from 155 FL tumors characterized by mass cytometry (CyTOF) which revealed two distinct evolutionary trajectories with disparate risk of transformation and alternate biologies.

  Study EGAS00001005257

• UROMOL 2020 - SNP data

  The molecular landscape in non-muscle-invasive bladder cancer (NMIBC) is characterized by large biological heterogeneity with variable clinical outcomes. Here, we performed a large integrative multi-omics analysis of patients diagnosed with NMIBC (n=834). Transcriptomic analysis identifies four classes (1, 2a, 2b and 3) reflecting tumor biology and disease aggressiveness. Both transcriptome-based subtyping and the level of chromosomal instability provide independent prognostic value beyond established prognostic clinicopathological parameters.

  Study EGAS00001004862

• Hereditary_Cerebellar_Ataxias___Whole_Genome_Sequencing___2021

  Looking to identify mutations in order to validate that lines we have classified as from Ataxia patients contain the disease relevant mutations. This will allow us to publish on the existance of these lines which are now commercially avalable. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001006234

• Whole blood transcriptomic analysis of ANCA-associated vasculitis

  Whole blood mRNA sequencing from 30 patients with AAV (granulomatosis with polyangiitis/GPA, n=22) and microscopic polyangiitis (MPA, n=8) combined with functional enrichment and network analysis for aberrant pathways. Key genes and pathways were validated in an independent cohort of 18 AAV patients. Co-expression network and hierarchical clustering analysis, identified molecular endotypes. Multi-level transcriptional overlap analysis to SLE was based on our published data from 142 patients.

  Study EGAS00001006704

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  We investigated 10 female and 14 male SARS-CoV-2 positive children (age range: 0.8 to 18 years). Based on the WHO guidelines, 15 patients were classified as having mild COVID-19, while 7 children were classified as moderate COVID-19 cases. Two children were asymptomatic. 8 female and 10 male SARS-CoV-2 negative children were included as controls (age range: 4 to 16). 12 SARS-CoV-2 positive female and 9 male adults were included ( age range: 27 - 76) together with 13 female and 10 male SARS-CoV-2 negative adult controls (age: 24 - 77). 10 adult COVID-19 patients had mild disease, while 12 had moderate COVID-19. We performed single-cell RNA sequencing experiments.

  Dataset EGAD00001007969

• RNA-seq of non-LPS treated (N), non-tolerized (NT), and tolerized (T) IFNg-primed macrophages pretreated with or without HDAC3i

  In this experiment we investigated the effect of HDAC3 inhibition on the transcriptome of IFNg-primed macrophages under different tolerization conditions. Peripheral blood mononuclear cells (PBMCs) were isolated from 3 healthy donors. PBMCs were isolated from whole blood of healthy donors using Ficoll gradient (Invitrogen). Monocytes (CD14+ cells) were positively selected from PBMCs using CD14 Microbeads according to the manufacturer’s instructions (Miltenyi Biotec). Monocytes were subsequently treated with or without 500 nM HDAC3i (ITF3100) for 30 minutes prior to overnight IFNg priming (50 ng/mL). Cells were then kept without LPS (non-LPS; N), treated with 10 ng/mL LPS once (non-tolerized; NT), or treated with LPS twice (tolerized; T; second LPS concentration: 100 ng/mL). In total, there were 18 samples included.

  Dataset EGAD00001005959

• Variant calls for "Quality of Whole Genome Sequencing from Blood versus Saliva Derived DNA in Cardiac Patients"

  Paired blood and saliva samples from five unrelated individuals were directly compared for quality of whole genome sequencing. Two (Sample Pairs 1 and 2) were female probands diagnosed with tetralogy of Fallot, a type of congenital heart disease, and three (Sample Pairs 3, 4 and 5) were male probands diagnosed with hypertrophic cardiomyopathy. WGS was performed using Illumina HiSeq X to a target average coverage depth of 30x and a read length of 150 bp. The resulting reads were not filtered for minimum quality in order to avoid losing possible contaminant reads. Sequencing read alignment was done using Isaac Aligner to human genome build hg19. Short variant i.e. single-nucleotide variant (SNV) and small insertion-deletion (indel) calling was performed using Isaac Variant Caller with default parameters.

  Dataset EGAD00001005772

• Resequencing candidate genes for male spermatogenic impairment

  This study aims to identify novel candidate variants from human Y-chromosomal genes DAZ, BPY2 and CDY1/2 by resequencing the coding regions of these genes from male patients with spermatogenic impairment. The coding regions of the genes plus a selection of phylogenetically informative Y-chromosomal markers have been amplified by standard PCR, amplicon lengths range from 178 to 486 bp. Amplicons were quantified by gel electrophoresis and pooled in approx. equimolar concentrations per patient. For each of the 480 submitted samples, approx. 1 microgram of amplified DNA pool was provided in a total volume of 120 microlitres. The samples were indexed and libraries prepared for PE250bp Illumina MiSeq runs. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ .

  Dataset EGAD00001006784

• Single cell transcriptomic data of human gut macrophages

  Cellular suspensions (∼15000 cells, with expected recovery of ∼7500 cells) of sorted CD45+ HLA-DR+ CD14+ macrophages from colonic mucosa and muscularis propria were loaded on the 10X Chromium Controller instrument (10X Genomics) according to the manufacturer’s protocol using the 10X GEMCode proprietary technology. All samples from individual patients were loaded in one batch. The Chromium Single Cell 3´ v2 Reagent kit (10X Genomics) was used to generate the cDNA and prepare the libraries, according to the manufacturer’s protocol. The libraries were then equimolarly pooled and sequenced on an Illumina NextSeq500 using HighOutput flow cells v2.5. A coverage of 400M reads per sample was targeted, in order to obtain 50 000 reads per cell. The raw data were then demultiplexed and processed with the Cell Ranger software (10X Genomics) v2.1.1.

  Dataset EGAD00001007765

• Identification of immune mechanisms associated with the high rate of relapse in patient with visceral leishmaniasis and HIV co-infection

  RNA-seq transcriptomics of whole blood samples from longitudinal follow-up of a cohort of visceral leishmaniasis (VL) patients with and without HIV coinfection, from active disease through apparent cure and potential relapse. Analysis will identify potential correlates of relapse to identify immune mechanisms underlying the high rate of relapse in HIV/VL coinfection. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ .

  Dataset EGAD00001008361

• WGS and Avenio Surveillance Panel data to previously submitted data under study number EGAS00001004276 of ALK-rearranged lung cancer

  Some data was previously submitted data under study number EGAS00001004276. In this new dataset we provide additional WGS and Avenio Surveillance Panel data. We utilized 43 ALK+ NSCLC patients receiving targeted ALK therapy to evaluate ctDNA levels based on matched panel-based targeted next generation sequencing (tNGS) and untargeted shallow whole genome sequencing (sWGS). For the Avenio panel the sequencing was done on Illumina NextSeq 550 paired end 150 bp, for WGS the sequencing was done on Illumina HiSeq 4000, partly with KAPA_Hyper_Prep_Kit. In this dataset there are 132 WGS tumor samples and 134 panel sequencing data of plasma.

  Dataset EGAD00001007818

• Single nuclei sequencing of early, late-term, and early-onset pre-eclamptic decidua and villi.

  Hypertensive disorders in pregnancy, of which the multisystem syndrome pre-eclampsia is the most severe, leading to preterm delivery, maternal mortality, and life-long complications. To elucidate early disease dynamics, we present the first spatio-temporal study comparing single-nuclei transcriptomes of human preterm pre-eclamptic placentae and healthy controls, contextualizing this in a comprehensive study including early and late gestational placentae. This study includes early placentae samples from the fetal part (villi; n=10), maternal part (Decidua; n=3), late placentae samples from healthy pregnancies, villi (n=6), decidua (n=4), and late placentae samples from early-onset preeclamptic pregnancies, villi (n=5) and decidua (n=5).

  Dataset EGAD00001008273

• Disease specific alterations in the olfactory mucosa of patients with Alzheimer’s disease

  The sample AD_Library_1, AD_Library_2 and Control_Library were run on a Chromium Chip B with the Chromium Single Cell 3′ Library & Gel Bead Kit v3 kit (10x Genomics, CA, USA) . The 3’ gene expression libraries were sequenced at an approximate depth of 50,000 reads per cell using the NovaSeq 6000 S1 (Illumina, San Diego, CA, USA) flow cells. Cell Ranger v.3.0.2 was used to analyze the raw base call files. FASTQ files and raw gene-barcode matrices were generated and aligned human genome GRCh37 (hg19). The samples were integrated in R v.4.0.3 and generated Seurat objects, two related to AD samples and one to control samples, were analyzed using the Seurat package v.4.0.3 to perform downstream analysis, clustering of the cells and differential expression.

  Dataset EGAD00001008560

• Genomic Evolution of Breast Cancer Metastasis and Relapse

  Recurrent breast cancer is almost universally fatal. We characterize 170 patients locally relapsed or distant metastatic cancers using massively parallel sequencing. We identify that the relapse-seeding clone disseminates late from the primary tumor. TP53 and AKT1 appear to be enriched in ER-positive cancers predisposed to relapse. Mutation acquisition continues at relapse as the same mutation signatures continue to operate and new signatures, such as that caused by radiotherapy appear de novo. In 49% of cases we identify drivers mutations private to the relapse and these are sampled from a wider range of cancer genes, including SWI-SNF complex and JAK-STAT signaling.

  Dataset EGAD00001002696

• Myeloma Genome Project Targeted Sequencing Panel - Oxford Data

  This dataset comprises the BAM files from targeted genome sequencing of CD138+ selected myeloma tumour samples from 21 individuals. In 5 cases there is only one tumour sample, but in the other 16 cases there are sequential samples, spanning treatment relapses. There are denoted Tumor A, B C etc. Therefore there are a total of 48 myeloma tumour samples. For each individual there is also a germline control samples, obtained either from peripheral blood or from CD138-selected bone marrow cells.

  Dataset EGAD00001008735

• WGS/WES analysis refines molecular subtypes of hepatocellular carcinoma

  This work aims to identify homogeneous and robust molecular subtypes in HCC based on a large, homogenous and well-annotated cohort. We performed whole genome/exome sequencing (WGS/WES) on 529 HCC from 461 patients collected mainly in France. Based on the genomic data, we identified 9 robust HCC subtypes primarily driven by key mutations. We further characterized these subtypes using genomic and clinicopathological features. Among the 9 subtypes, 5 belonged to chromosome instable tumors, while 3 belonged to chromosome stable tumors. Our subtypes were associated with prognosis and showed distinct distributions across features like etiology and gender. This study offers a comprehensive molecular classification of HCC, enhancing our understanding of hepatocarcinogenesis and supporting the development of genome-based precision medicine for liver cancer.

  Dataset EGAD00001015428

• MultiOMICS study of a pair of infant monozygotic twins with concordant B-cell ALL (WGS)

  B-cell acute lymphoblastic leukemia (B-cell ALL) is the most common cancer in childhood. Studying identical twins with B-cell ALL provides a unique and tractable model for deciphering the developmental timing of pre- and post-natal mutations contributing to clonal evolution. To date, this has mainly focused on major cytogenetic subgroups of childhood B-cell ALL, including MLL fusions, ETV6-RUNX1, hyperdiploidy, and BCR-ABL1. However, formal demonstration of the prenatal origin and “backtracking” the natural history of the leukemia remains understudied in “B-other”/Normal Karyotype (NK) B-cell ALL. To characterize the genetic landscape of this particular leukemia subtype, we performed whole genome DNA- and B-cell receptor (BCR)- on a pair of 8-month-old monozygotic twins diagnosed with concordant “B-other”/NK B-cell ALL.

  Dataset EGAD00001005017

• Genomic characterisation of SDH deficient renal cell carcinoma - WGS

  SDH deficient renal cell carcinomas are a rare and recently defined subtype of kidney cancer, often associated with an inherited mutation in one of the SDH gene subunits. This dataset sought to understand the genomic events that underpin tumour formation, from putative cell of origin, characterisation of the tumour microenvironment, to the genomic evolution of these rare tumours. We performed whole genome and RNA sequencing of 4 patients with SDH deficient renal cell carcinomas, including one patient who had an additional paraganglioma. An addition patient in this cohort had the initial diagnosis revised to a clear cell renal cell carcinoma.

  Dataset EGAD00001008469

• RNAseq data of polyA+ RNA from Leukocytes from 624 individuals of the ProgeNIA cohort.

  We sequenced the polyA+ fraction of the RNA of the leukocytes from 624 sardinian individuals with RNAseq. Prior to library preparation we added either ERCC ExFold RNA Spike-In. An average of 60M reads per samples with 51 bp paired-end reads were generated on a HiSeq 2000 (Illumina). Sequencing reads were then aligned using STAR-2.2.0c2 to the h37d5 reference genome supplemented with the ERCC spike-ins sequences. We further provided an exon-exon junction database that we generated from the GENCODE v14 annotation. In order to remove a contamination from a parallel experiment, we discarded any reads that mapped to the genomic regions of CBLB (chr3:105370773-105592330) and BCL11A (chr2:60672555-60784156). Filtered aligned reads (bam format) are shared.

  Dataset EGAD00001003102

• Variant calling analysis of cfDNA whole exome sequencing in neuroblastoma

  This dataset contains VCF files from a variant calling analysis of 19 neuroblastoma patients. WES or WGS data of the primary tumor were compared to WES cfDNA analysis at the time of diagnosis and at a 2nd timepoint (complete remission, partial remission, disease progression or relapse). For 4 patients, WGS of germline, tumor at diagnosis and tumor at relapse DNA was performed on Illumina HiSeq2500, with 100-bp paired-end reads. For the other patients, WES was performed using either an AgilentSureSelect Human All Exon v5 or a Roche Nimblegen SeqCap EZ Exome V3 kit on Illumina HiSeq2000, with 100-bp paired-end reads. SNVs observed in any of the primary tumors or cfDNA samples studied by WES were targeted using a capture sequencing panel at all intermediate time points.

  Dataset EGAD00001003803

• Shallow whole genome sequencing

  This dataset contains a collection of tumour samples from high grade serous ovarian carcinoma patients with recurrent disease collected near the point of diagnosis as well as tumour samples collected after patient relapse upon or some time after study entry. The majority of diagnosis samples were preserved in neutral buffered formalin whereas the majority of post-relapse samples were preserved in universal molecular fixative (UMFIX, Sakura Finetek USA, Inc). DNA was extracted and whole genome sequencing libraries were prepared either using the TruSeq DNA Nano kit (Illumina) or the ThruPLEX DNA-Seq Kit (Takara Bio), which were respectively sequenced at low depth (~0.1-0.5X) on illumina HiSeq 2500 and HiSeq 4000 sequencing platforms. Sequenced reads were aligned to the GRCh37 reference genome (release hs37d5).

  Dataset EGAD00001011049

• single-cell RNA-seq Case-Control study of children progressing to Type1 diabetes

  It was a single-cell RNA sequencing study on the PBMC samples from four Finnish children at risk of developing Type 1 diabetes and their gender age and HLA matched control children. All four Case children were positive for multiple islet specific autoantibodies and two of them also progressed to clinical disease during the follow up whereas the control children remain negative for all autoantibodies. Single-cell analysis confirmed some of the signatures obtained from the bulk data. It identified that high IL32 in case samples in the bulk RNA-seq was contributed mainly by activated T cells and NK cells. Trajectory analysis of the scRNA-seq data suggested that IL32 expression increased as the T cells moved towards activated state.

  Dataset EGAD00001005768

• A non-canonical lymphoblast in refractory childhood T cell leukaemia

  Refractory cancers may arise either through the acquisition of resistance mechanisms by cancer cells or represent distinct diseases. The origin of childhood T-cell acute lymphoblastic leukaemia (T-ALL) that does not respond to initial treatment, i.e. refractory disease, is unknown. Refractory T-ALL carries a poor prognosis and cannot be predicted at diagnosis. Here, we performed single cell mRNA sequencing of T-ALL from children who did or did not respond to initial treatment. We identified a transcriptionally distinctive blast population, exhibiting features of innate-like lymphocytes, as the major source of refractory disease. Evidence of such blasts at diagnosis heralded refractory disease across independent datasets and was associated with survival in a large, contemporary trial cohort. Our findings portray refractory T-ALL as a distinct disease. They may have immediate clinical utility.

  Dataset EGAD00001015381

• Direct transcriptional consequences of somatic mutation in breast cancer

  The disordered transcriptomes of cancer encompass direct effects of somatic mutation on transcription; co-ordinated secondary alterations in transcriptional pathways; and increased transcriptional noise. To catalogue the rules governing how somatic mutation Overall, 59% of 6980 exonic substitutions were expressed. Compared to other classes, nonsense mutations showed lower expression levels than expected with patterns characteristic of nonsense-mediated decay. 14% of 4234 genomic rearrangements caused transcriptional abnormalities, including exon skips, exon reusage, fusion transcripts and premature poly-adenylation. We found productive, stable transcription from sense-to-antisense gene fusions and gene-to-intergenic rearrangements, suggesting that these mutation classes may drive more transcriptional disruption than previously suspected. Systematic integration of transcriptome with genome data therefore reveals the rules by which transcriptional machinery interprets somatic mutation.

  Dataset EGAD00001002236

• Massive parallel RNA sequencing of highly purified mesenchymal cells derived from bone marrow specimens of 10 healthy donors

  Highly purified mesenchymal cells (CD45-/7AAD-/CD235a-/CD31-/CD271+/CD105+) were prospectively FACS-isolated from bone marrow specimens of 10 healthy donors (HDs). This data set is used as a baseline control to observe the differences between gene expression profiles (GEPs) of pre-leukemia cases (45 low-risk myelodysplastic syndrome, 4 Shwachman-Diamond and 3 Diamond-Blackfan anemia patients) and gene expression patterns observed in a normal, healthy context. Through differential expression and gene set enrichment analysis we determined that inflammatory signaling pathways are significantly more active in mesenchymal cells of pre-leukemia cases compared to their healthy counterparts. Finally, we determined through statistical modelling of healthy donor's GEPs which pre-leukemia cases have significantly more active inflammatory signaling and demonstrated a strong relation to survival statistics.

  Dataset EGAD00001002659

• MultiOMICS study of a pair of infant monozygotic twins with concordant B-cell ALL (WGBS)

  B-cell acute lymphoblastic leukemia (B-cell ALL) is the most common cancer in childhood. Studying identical twins with B-cell ALL provides a unique and tractable model for deciphering the developmental timing of pre- and post-natal mutations contributing to clonal evolution. To date, this has mainly focused on major cytogenetic subgroups of childhood B-cell ALL, including MLL fusions, ETV6-RUNX1, hyperdiploidy, and BCR-ABL1. However, formal demonstration of the prenatal origin and “backtracking” the natural history of the leukemia remains understudied in “B-other”/Normal Karyotype (NK) B-cell ALL. To characterize the epigenetic landscape of this particular leukemia subtype, we performed DNA bisulfite-sequencing on a pair of 8-month-old monozygotic twins diagnosed with concordant “B-other”/NK B-cell ALL.

  Dataset EGAD00001005018

• Shot-gun stool metagenomics and colorectal cancer risk.

  This study aims to identify metagenomics biomarkers in colorectal cancer (CRC). The study includes 156 samples of shot-gun stool metagenomics, corresponding to 51 patients with CRC, 54 patients with high-risk adenoma, and 51 healthy controls. The sequencing libraries were prepared with 2 µg of total DNA using the Nextera XT DN Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing was performed at 150 nucleotides, paired-end, using an Illumina HiSeq 4000 platform.

  Study EGAS00001007025

• sWGS of Pap test smears from healthy donors and HGSOC patients and matched tumor tissue

  Shallow whole genome sequencing was performed on Pap test smears considering at least 10 M reads per sample. The cohort consists of 77 samples from healthy women, i.e. no tumor diagnosis, and 65 samples from women with a diagnosis of high-grade serous ovarian cancer (HGSOC) taken months or years before diagnosis. 44 primary tumor samples matched to the respective HGSOC patients were sequenced in the same manner as the Pap test smears.

  Study EGAS00001007084

• The genomic landscape of recurrent ovarian high grade serous carcinoma: the BriTROC-1 study

  The BriTROC-1 study, spanning 15 centres across the United Kingdom, is a prospective observational project investigating putative causes of relapse in high-grade serous carcinoma (HGSC). Potential genomic changes associated with disease recurrence are examined by studying paired tumour samples collected from patients at diagnosis and after relapse after receiving platinum based chemotherapy. Shallow whole genome sequencing and targeted amplicon sequencing are used to identify copy number aberrations and short variants respectively.

  Study EGAS00001007292

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• Genome-wide DNA Methylation Data from Illumina HumanMethylationEPIC arrays for whole blood samples from 403 healthy individuals

  Genome-wide DNA Methylation Data from Illumina HumanMethylationEPIC arrays for whole blood samples from 403 healthy individuals. Additional associated phenotype information is available for all individuals included in this study directly from CIBMTR. Data are available under controlled access release upon reasonable request and execution of a data use agreement. Requests should be submitted to CIBMTR at info-request@mcw.edu and include the study reference IB17-04.

  Study EGAS00001006033

• The Gut Microbiome of liver transplant recipients – Cross-sectional + Longitudinal (renal and liver)

  TransplantLines is designed as a single-center, prospective cohort study and biobank including all different types of solid organ transplant recipients as well as living organ donors. In the TransplantLines gut microbiome study the gut microbiome of solid organ transplant recipients is characterized and linked to clinical phenotypes. This batch contains the cross-sectional data from liver transplant recipients and longitudinal data from renal and liver transplant recipients.

  Study EGAS00001006258

• GENEVA Genes and Environment Initiatives in Type 2 Diabetes (Nurses' Health Study/Health Professionals Follow-up Study)

  Type 2 diabetes mellitus (T2D) affects approximately 21 million individuals in the U.S., or almost 10% of the U.S. adult population. Because diabetes is determined by both genetic and environmental factors, a better understanding of the etiology of diabetes requires a careful investigation of gene-environment interactions. The Nurses' Health Study (NHS) and Health Professionals' Follow-up Study (HPFS) are well-characterized cohort studies of women and men for whom stored blood and DNA samples are available as well as detailed information on dietary and lifestyle variables. The major goals of the project include: 1. To conduct a GWA analysis among 3,000 cases of T2D and 3,000 healthy controls in NHS/HPFS cohorts. 2. To use information on the joint effects of genes and a list of carefully selected environmental exposures at the initial screening stage to test gene-environment interactions. This approach optimizes our power to detect variants that have a sizeable marginal effect and those with a small marginal effect but a sizeable effect in a stratum defined by an environmental exposure. For this analysis, we have developed a joint test of genetic marginal effect and gene-environment interaction. This flexible two-degree-of-freedom test generally provides greater power than standard methods and has the potential to uncover both marginal genetic effects and stratum-specific effects. The Version 1 (v1) dbGaP release of data from the GENEVA Diabetes Study (NHS/HPFS) includes data from the NHS only. The Version 2 (v2) dbGaP release includes data from both the NHS and HPFS. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to type 2 diabetes mellitus through large-scale genome-wide association studies of well-characterized cohorts of nurses and health professionals. Genotyping was performed at the Broad Institute of MIT and Harvard, a GENEVA genotyping center. Data cleaning and harmonization were done at the GEI-funded GENEVA Coordinating Center at the University of Washington.

  Study phs000091

• A Phase I/II Trial of Sirolimus (Rapamune®) and Cyclosporine in Patients with Refractory Aplastic Anemia

  The most successful treatment for aplastic anemia is bone marrow transplantation. However, few patients are eligible for this procedure. For others, treatment usually consists of immunosuppressive agents, such as antithymocyte globulin (ATG) and cyclosporine. Unfortunately, even with immunosuppressive therapy, relapse is common. New combinations of medications may offer alternative and more effective treatment options. Sirolimus and cyclosporine are two drugs routinely used to suppress the immune system and prevent rejection in patients who have received organ transplants. While cyclosporine has been proven effective for treating aplastic anemia, sirolimus has not been tested for this disease. This study will evaluate the safety and efficacy of sirolimus in combination with cyclosporine for treating individuals with aplastic anemia that have not responded to other treatments. This study will last at least 6 months. Participants will first be screened to verify diagnosis of aplastic anemia. The screening will include a physical examination, blood test, bone marrow biopsy from the pelvic bone, and review of medications and medical history. Individuals who are eligible will then start the first treatment period. Participants will receive two medications: cyclosporine will be taken twice a day and sirolimus will be taken once a day. Depending on side effects, the dose of either drug may be temporarily stopped or lowered. On Day 1, blood will be drawn and females will undergo a pregnancy test. Subsequent study visits will occur weekly for the first month, every 2 weeks for 2 months, and then once a month for the remainder of the study. Each visit will include a physical examination, vital sign assessment, and review of side effects and medications. Blood tests will be performed weekly for the first 3 weeks, and then every 2 weeks. After 6 months of treatment, if a participant has shown improvements in disease status without major side effects, the treatment will continue. Over time the doses may be lowered. If a participant has not improved while on the study medication, treatment will stop at 6 months. Whenever treatment is discontinued, the participant will again undergo a physical examination, blood tests, and bone marrow biopsy.

  Study phs000695

• Discovering the Genetic Basis of Human Neuroblastoma: A Gabriella Miller Kids First Pediatric Research Program (Kids First) Project

  The Gabriella Miller Kids First Pediatric Research Program (Kids First) is a trans-NIH effort initiated in response to the 2014 Gabriella Miller Kids First Research Act and supported by the NIH Common Fund. This program focuses on gene discovery in pediatric cancers and structural birth defects and the development of the Gabriella Miller Kids First Pediatric Data Resource (Kids First Data Resource). All of the WGS and phenotypic data from this study are accessible through dbGaP and kidsfirstdrc.org, where other Kids First datasets can also be accessed. Children with disseminated neuroblastoma have a very high risk of treatment failure and death despite receiving intensified chemotherapy, radiation therapy and immunotherapy. The long-term goal of our research program is to ultimately improve neuroblastoma cure rates by first comprehensively defining the genetic basis of the disease. The central hypothesis to be tested here is that neuroblastoma arises largely due to the epistatic interaction of common and rare heritable DNA variation. Here we will perform a comprehensive whole genome sequencing of 563 quartets of neuroblastoma patient germline and diagnostic tumor DNAs and germline DNAs from both parents. The case series was recently collected through a Children's Oncology Group epidemiology clinical trial and is robustly annotated with complete demographic (age, sex, race, ethnicity), clinical (e.g. age at diagnosis, stage, risk group), epidemiologic (parental dietary and exposure questionnaire) and biological (e.g. tumor MYCN status and multiple other tumor genomic measures) co-variates. Subjects were consented for genetic research and DNA is immediately available for shipment for sequencing. We propose Illumina-based whole genome sequencing in the 593 "trio" germline samples (Aim 1; due to missing parent: 487 full neuroblastoma triads, 106 child-single parent dyads = 1673 whole genome sequences) and matched diagnostic tumor DNA (Aim 2; N=366) at 30x sequencing depth (N=2039 whole genome sequences). Also in Aim 2 we will perform whole exome (100x) and RNA sequencing on the 366 tumor DNA and 228 tumor RNA samples from this cohort. Finally, we propose a pilot study of structural variation using long-range sequencing in 10 non-overlapping tumor samples chosen based on potentially relevant chromosomal alterations discovered with conventional NGS. Thus, a total of 2277 individual samples and 2655 sequences will be generated. We will use our established analytic pipeline that is currently being used to study the germline genomes of all cases sequenced through the NCI supported Therapeutically Applicable Research to Generate Effective Treatments program. We plan a three-stage analytic approach, first focusing on classic de novo and inherited Mendelian damaging alterations. We will next integrate our extensive epigenomic data from human neuroblastoma cell lines and genome-wide association study data (N=5,703 neuroblastoma cases to date) to guide a comprehensive assessment of noncoding variants that influence tumor initiation with a recently established analytic pipeline. Finally, we will utilize the tumor DNA analyses to inform relevance via somatic gain or loss of function effects at the sequence and/or copy number levels. All data generated in this project will be immediately placed into the Genomic Data Commons (GDC) and we will compute within this environment by importing our analytic pipelines into the GDC. These data will be fully integrated into the Kids First Data Resource and freely shared with all academically qualified petitioners. This comprehensive data set derived from a large and richly phenotyped series of neuroblastoma DNA quartets will be integrated with existing germline and/or tumor genomic data from over 6,000 neuroblastoma subjects (but none with matched patient-parent germline sequencing data) to provide an unparalleled opportunity to comprehensively discover the genetic basis of neuroblastoma.

  Study phs001436

• How to use EGA Webin?

  EGA Webin EGA Webin serves as a platform for registering metadata for array based submissions, large scale sequence submission as well as for legacy EGA submission accounts (ega-box-XXXX). For large scale submitters of sequence data you have also the option to submit metadata via XMLS programmatic submission, while new submitters are advised to utilise the Submitter Portal for their submissions. You can request a legacy EGA submission account (ega-box-XXXX) by populating this form. Please, allow two business days for our Helpdesk team to contact you after populating this form. WEBIN actions: Register metadata for a sequence submission Register study, samples, experiments, runs, DAC, policy and dataset/s after file upload. Register components for your array-based metadata submission Register study, samples, DAC or policy before uploading files. Edit existing submission metadata Change or update previously submitted metadata. Register metadata for a sequence submission Ensure that all sequence files have been encrypted before uploading them to your submission account using the EgaCryptor. Go to the EGA Webin and log in using your submission account name (ega-box-XXX) and password. Register components of your metadata submission Study Samples Data Access Committee (DAC) Data access policy Dataset For array-base submissions: Study, Samples, Data Access Committee (DAC) and Data access policy may all be registered BEFORE file upload and dataset registration through the array-base template. Register your Study Go to the “Studies (Projects)” box Click on “Register Study” and fill in the information related to your study. Click on “Submit”, this will save the information and generate an EGA study ID. To use the study accession number in a publication, the study has to be previously released on the EGA website, we suggest the following format: "Sequence data has been deposited at the European Genome-phenome Archive (EGA), which is hosted by the EBI and the CRG, under accession number EGASXXXXXXXXXXX.Further information about EGA can be found on https://ega-archive.org and “The European Genome-phenome Archive in 202 "(10.1093/nar/gkab1059)" Register your Samples Go to the “Samples” box Click on “Register Samples” Select “Download spreadsheet to register samples” and customise your template, there is a default EGA template (EGA default checklist) but more attributes can be added if required. For the EGA default checklist, there are mandatory,recommended and optional attributes. As well custom fields which can be added if required. Mandatory attributes Field Name Description tax_id Taxonomy ID of the organism as in the NCBI Taxonomy database. Entries in the NCBI Taxonomy database have integer taxon IDs. See our tips for sample taxonomy here scientific_name Scientific name of the organism as in the NCBI Taxonomy database. Scientific names typically follow the binomial nomenclature. For example, the scientific name for humans is Homo sapiens. sample_alias Unique name of the sample. If not selected system will auto generate an unique alias sample_title Title of the sample sample_description Description of the sample phenotype *** Where possible, please use the Experimental Factor Ontology (EFO) to describe your phenotypes. Recommended attributes Field Name Description subject_id Identifier for the subject where the sample has been derived from gender * Sex Optional attributes Field Name Description sex sex of the organism from which the sample was obtained disease_site Affected organ sample type Affected organ donor_id ** Identifier of the donor where the sample has been derived from *Gender should be described as 'male', 'female' or 'unknown'. If 'unknown' due to a known sex chromosome aneuploidy, please create a user defined attribute called 'Sex chromosome karyotype' and add the appropriate value, for example, 'XXY'. **Donor id (Subject id) should be a de-identified subject handle. If unknown, please add 'unknown' to the field. ***Phenotypes should, where possible, be an Experimental Factor Ontology accession. If a term cannot be found to describe your phenotype please use free text. All sample phenotypes considered important for further analysis of the data should be provided (for example, tumour type), additional phenotype attributes can be created by defining your own attributes; use the notion 'phenotype2', 'phenotype3', etc. After you have customised the fields for the sample submission, download the template and fill in the information. Example of the sample template: Finally upload the sample template to get the EGA accession IDs for the samples. Register your Data Access Committee (DAC) Further information on the role of your DAC Go to the “Data Access” box Click on “Register Dacs” Input the information about the DAC and register at least one main DAC contact. Register your Data Access Policy Your Data Access Policy provides the terms and conditions of data use, this is also referred to as the Data Access Agreement (DAA). Completion of a DAA by the applicant/s should form part of the application process to the Data Access Committee (DAC). Go to the “Data Access” box Click on “Register Policies” Select the DAC to which this policy will be linked to and fill in the policy information. Submitting your Runs and Analyses This section is only for sequence data submission, for array-based submission it can be skipped. Please refer to our Submitting array based metadata Runs Registration Go to the “Raw Reads (Experiments and Runs)” box Click on “Submit Reads” Select “Download spreadsheet template for Read submission” Select the template corresponding to your submission type For the templates you have the option to customise the optional fields. To check their description click on “Show Description “ Download the template and fill in the required information. Example of the runs template: We recommend that Fastq, BAM, and CRAM read files are submitted using Webin-CLI When using this interface instead of Webin-CLI, raw sequences must be uploaded in one of the supported data formats before they can be submitted. The files can be uploaded using FTP or Aspera. The study and the sequenced samples must be pre-registered before the raw reads are submitted. Please note that each individual study and sample should be registered only once. You will be asked to provide information about the sequencing libraries and instruments. Submitting your Dataset This section is only for sequence data submissions, for array based submissions it can be skipped. Please refer to our Submitting array based metadata The dataset describes the data files, defined by the run (EGARXXXXXXXXXXX) and analysis (EGAZXXXXXXXXXXX) accessions that make up the dataset and links the collection of data files to a specified Data Access Committee and Data Access Policy. As a result, you must have registered your Reads and experiments, Data Access Committee (DAC) and Data access policy before submitting your Dataset. Please consider the number of datasets that your submission consists of, for example, a case control study is likely to consist of at least two datasets. In addition, we suggest that multiple datasets should be described for studies using the same samples but different sequence technologies. Please contact EGA Helpdesk for further assistance. Go to the “Data Access” box Click on “Register Dataset” Select the Data Access Committee (DAC) and Data access policy Register your dataset After submitting your dataset you should contact the EGA Helpdesk to provide a release date for your dataset. Datasets are automatically held (i.e. not released) unless they are affiliated to a study that has already been released. Edit/update existing submission metadata Go to the “Report” section of the object you would like to edit. Locate the object and click on the arrow under action. An option menu will be displayed. Objects can be edited through their XML or with the WEBIN menu. After an object has been edited, changes would be available on the website until the submission is released again. Please contact the EGA Helpdesk if you require further assistance.

  Documentation submission/metadata/submission/EGA_webin

• Korea Epigenome Project(KEP), Korea National Research Institute of Health(KNIH)

  The KEP was launched in 2012 to produce 50 epigenomic sets on Korean chronic diseases related target cells with the participation on Internationsl Human Epigenome Consortium(IHEC) of which focus is constructing 1000 reference epigenome map on 250 human cell type. The objective of the KEP was to provide a comprehensive epigenomic map of Korean chronic disease-related target tissues. Single cells were isolated from the pancreas, fat and kidney. Islet, ductal, acinar, and beta cells from the pancreas were purified into a single homogenous cell type using flow-assisted cell sorting technique. Adipocytes and pre-adipocytes were purified from fat, using Percoll gradient centrifugation technique. Mesangial, distal tubule, proximal tubule, podocytes, and collecting duct cells from the kidney were collected using mechanical sieving and immunostaining methods. Each cell type was derived from normal tissue or those with diabetes, obesity, or chronic kidney disease. Sixty reference epigenome datasets of pancreatic, fat, kidney cells were produced. Cell types such as the islets, and beta from the pancreas, adipocytes, pre-adipocytes from fat tissue, podocyte, mesangial, tubules from kidney were used for primary target to produce a Korean metabolic reference epigenome. And the bisulfite converted-whole genome sequencing, Infinium 450k DNA methylation bead array, mRNA, miRNA-Sequencing were performed to produce a comprehensive epigenomic map. The aim of roadmap reports is preparation of Long-term and Mid-term Technology Roadmaps for Korean Human Epigenome Project towards a competitive execution of International Epigenome Project and successful expansion of the research outcomes. Roadmap reports reviewed on recent technological development of DNA methylation and histone modification analysis, emerging new trends in epigenome medicine, plans for hardware and software analysis systems aimed to epigenome analysis, medical expert opinion on target cells and isolation scheme, bioinformatics expert opinion on analytical tools, new ideas for a putative epigenome studies, trends in single cell epigenome analysis. In conclusion, roadmap report suggested several projects for the future KNIH epigenome research in collaboration with epigenome research group. These are including refocusing the goals of KNIH-driven research in identification of disease mechanism, development of new studies on GWAS-EWA, higher priority on the epigenomic studies of human primary cells, establishment of collaborative relationship with tissue banking centers, establishment of mapping centers and data analysis portals, establishment of Korean Epigenome Research Consortium, establishment of steering committee governing both research and funding, launching of additional funding for epigenomic researches.

  Study EGAS00001001774

• EGAD00010000628

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000628

• EGAD00010000630

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000630

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• DNAmet

  DNAmet analysis of olfactory mucosa (OM) cells derived from cognitively healthy and individuals with AD exposed to traffic-related ultrafine particles (UFPs) for 72h in submerged cultures. The UFPs used for exposures were: A0 and A20. Exposures were compared to the corresponding blank samples.

  Dataset EGAD50000001531

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• snRNAseq prostate cancer

  single-nucleus RNA seq characterization of human fresh frozen prostate cancer samples and non-malignant controls for the same patients. Biopsies were sectioned in 100 micron thick sections, adjacent to those used for spatial transcriptomics.

  Dataset EGAD50000001633

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267

• Multi-omics characterisation of immune cells in Long Covid

  We generated 10X Multiomics (paired RNA+ATAC) for Long Covid patients with up to 14 months follow-up.

  Study EGAS50000000142

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Nanopore Telomere Sequencing of II.3, II.4, and III.4

  This datasets contains the putative telomeric sequences isolated by TARPON in ubam format after using a Duplex Capture Based Enrichment Protocol for patients II.2, II.4, and III.4.

  Dataset EGAD50000002363

• Triple-negative breast cancer sequencing data

  Single-cell RNA sequencing and spatial transcriptomic sequencing data associated with manuscript 'Ectopic NMDAR expression in cancer unmasks germline-encoded autoimmunity'

  Dataset EGAD50000002266